CN115109861B - Method for detecting loss rate of plasmid in recombinant engineering bacteria - Google Patents
Method for detecting loss rate of plasmid in recombinant engineering bacteria Download PDFInfo
- Publication number
- CN115109861B CN115109861B CN202211039465.9A CN202211039465A CN115109861B CN 115109861 B CN115109861 B CN 115109861B CN 202211039465 A CN202211039465 A CN 202211039465A CN 115109861 B CN115109861 B CN 115109861B
- Authority
- CN
- China
- Prior art keywords
- recombinant
- plasmid
- loss rate
- engineering bacteria
- pcr amplification
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6851—Quantitative amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
- C12R2001/00—Microorganisms ; Processes using microorganisms
- C12R2001/01—Bacteria or Actinomycetales ; using bacteria or Actinomycetales
- C12R2001/185—Escherichia
- C12R2001/19—Escherichia coli
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The application relates to a method for detecting the loss rate of plasmids in recombinant engineering bacteria, which comprises the following steps: and respectively carrying out PCR amplification reaction on the recombinant engineering bacteria before and after induction, comparing products of the amplified sequences, determining whether the plasmid is lost or not, and calculating the plasmid loss rate. The method for detecting the plasmid loss rate is basically consistent with the result obtained by the plate coating method, and the method has high sensitivity and stable repeated detection result, and can avoid the phenomenon of false negative of the plate coating method.
Description
Technical Field
The application relates to the technical field of gene detection, in particular to a method for detecting the loss rate of plasmids in recombinant engineering bacteria.
Background
The recombinant engineering bacteria expression system (especially recombinant escherichia coli engineering bacteria) usually contains an expression plasmid for expressing target protein, the plasmid can be provided with an antibiotic resistance gene, and with the improvement of passage generation, the plasmid in part of the recombinant engineering bacteria can be lost, so that the antibiotic resistance gene is lost, and the capability of expressing the target protein is lost. Therefore, the recombinant engineering bacteria with lost plasmids can not survive in the environment of antibiotics with certain concentration (such as seed culture solution), and the bacteria can grow normally in the fermentation culture solution without antibiotics.
The conventional method for detecting the plasmid loss rate is a plate coating culture method, and the plasmid loss rate can be detected by comparing the survival number of thalli in a culture medium containing or not containing antibiotics in the experimental process, so that the plasmid stability is evaluated. At present, the plate coating culture method is commonly used as a glass bead, a cell shovel or a glass coating rod method. The glass bead method has even coating, but the glass beads are dispersed and the operation and recovery are troublesome; the cell shovel is troublesome and uneven in operation and is easy to scratch the surface of the agarose; although the glass coating rod method is simple in operation, the agarose surface of the plate is uneven, so that the coating is uneven, a plurality of cells are piled together, and a single bacterial colony cannot be well separated, so that the counting of living bacteria and the separation of positive bacterial clones are influenced, and the inconvenience is brought to the experiment. In addition, false negatives may occur with conventional coating methods, subject to a variety of conditions. Therefore, it is very important to provide a plasmid loss rate detection method with simple operation and stable detection result.
Disclosure of Invention
In order to solve the technical problem, the application provides a method for detecting the loss rate of plasmids in recombinant engineering bacteria.
In a first aspect, the present application provides a method for detecting a plasmid loss rate in a recombinant engineering bacterium, the method comprising:
(1) Designing a specific primer according to a non-transcription translation region of a recombinant plasmid in the recombinant engineering bacteria;
(2) Taking recombinant engineering bacteria at the end of fermentation after induction expression, coating the recombinant engineering bacteria on a culture medium plate for culturing, randomly selecting more than or equal to 30 clones on the culture medium plate for culturing respectively, and carrying out PCR amplification on each cultured clone by using the specific primer designed in the step (1);
(3) And detecting the result of the PCR amplification product, and calculating the plasmid loss rate which is the cloning number without the amplification result/the total cloning number.
The fermentation end refers to the fermentation culture after induction till the culture is finished or is finished.
Preferably, the step (2) is: taking recombinant engineering bacteria at the end of fermentation after induction expression, coating an antibiotic-free culture medium on a flat plate for culturing, randomly selecting more than or equal to 30 clones on the flat plate of the culture medium to culture in a culture medium containing antibiotics respectively, and carrying out PCR amplification on each cultured clone by using the specific primer designed in the step (1); the antibiotic is an antibiotic corresponding to an antibiotic resistance gene contained in the recombinant engineering bacteria.
Further preferably, the number of clones picked in the step (2) is 80 or more, or specifically 100.
Further preferably, the method for detecting the PCR amplification product in step (3) is a gel electrophoresis method, and the presence of the amplification product in the amplified recombinant engineered bacterial clone is determined by gel electrophoresis.
Further preferably, the recombinant engineering bacteria are recombinant escherichia coli engineering bacteria or recombinant yeast engineering bacteria, and more preferably recombinant escherichia coli engineering bacteria.
Further preferably, the method further comprises the steps of: preserving a bacterial liquid before induction for later use, and performing PCR amplification on the preserved bacterial liquid in the step (2) by using the primer in the step (1) as a positive control; preferably, the step (2) further comprises using a blank host bacterium as a negative control.
As a specific technical scheme of the application, the step (1) is as follows: designing a PCR forward primer and a PCR reverse primer according to a non-transcription translation region of a plasmid pET-30a (+);
preferably, the nucleotide sequences of the forward primer and the reverse primer are as follows:
a forward primer: TGCGCATGATCGTGCTCCTGTCGTT;
reverse primer: TGATGCCTCCGTGTAAGGGGGATTT.
Further preferably, the step (2) is: taking a bacterial liquid before induction, and storing for later use; taking recombinant engineering bacteria at the end of fermentation after induction expression, coating an antibiotic-free LB culture medium on a flat plate for culture, randomly selecting more than or equal to 30 clones on the flat plate of the culture medium, inoculating the clones into a 96 deep-well plate for culture, wherein each well in the deep-well plate is filled with an LB culture medium containing antibiotics, and performing PCR amplification on each cultured clone by using a specific primer designed in the step (1); the antibiotic is an antibiotic corresponding to an antibiotic resistance gene contained in the recombinant engineering bacteria; and the bacterial liquid preserved before induction is used as a positive control, and the blank host bacteria and/or sterile water are used as a negative control.
More preferably, the step (2) is: taking a bacterial liquid before induction, and storing for later use; taking recombinant engineering bacteria at the end of fermentation after induction expression, coating an antibiotic-free LB culture medium plate, and performing inversion constant-temperature culture at 35-40 ℃ (preferably 37 ℃) overnight; randomly picking more than or equal to 30 clones on a culture medium plate and inoculating the clones into a 96 deep-well plate, wherein each well of the deep-well plate is filled with 400-600 mu L of LB culture medium containing 20 mu g/mL Kan (kanamycin) and culturing the clones at 35-40 ℃ (preferably 37 ℃) and 180-250 rpm overnight; performing PCR amplification on each cultured clone by using the specific primer designed in the step (1); the antibiotic is an antibiotic corresponding to an antibiotic resistance gene contained in the recombinant engineering bacteria; and preserving the bacteria liquid before induction as a positive control, and using blank host bacteria and/or sterile water as a negative control.
Preferably, the PCR amplification reaction comprises a cycle of three steps of pre-denaturation, annealing and extension, etc.
More preferably, the PCR amplification reaction conditions include first 95 ℃ pre-denaturation for 3 min, then 94 ℃ denaturation for 15 s to make the DNA double strand untwisted into single-stranded state, 55 ℃ annealing for 15 s to make the forward and reverse primers pair with the target sequence, 72 ℃ extension for 45 s, under which conditions 29 cycles are performed, and finally 72 ℃ re-extension for 3 min, maintained at 16 ℃.
Compared with the prior art, the technical scheme provided by the embodiment of the application has the following advantages:
(1) The method for detecting the plasmid loss rate provided by the application is basically consistent with the result obtained by a flat plate coating method;
(2) The detection method provided by the application has high sensitivity and stable repeated detection result, and can avoid the phenomenon of false negative occasionally appearing in the flat plate coating method.
Drawings
FIG. 1 shows the results of agarose gel electrophoresis of the strains described in example 2 of the present application, wherein the last lane is a positive control band.
Detailed Description
In order that the above-mentioned objects, features and advantages of the present application may be more clearly understood, the solution of the present application will be further described below. It should be noted that the embodiments and features of the embodiments of the present application may be combined with each other without conflict.
In the following description, numerous specific details are set forth in order to provide a thorough understanding of the present application, but the present application may be practiced in other ways than those described herein; it is to be understood that the embodiments described in this specification are only some embodiments of the present application and not all embodiments.
Example 1 construction of a recombinant engineered bacterium expressing EK enzyme and fermentation expression thereof
An engineering bacterium for recombinant expression of EK enzyme was constructed by the method described in example 1 of CN202210697584.7 and stored at-80 ℃.
The prepared recombinant EK enzyme engineering bacteria are induced and expressed according to the method of the embodiment in the patent CN202210697584.7 to prepare the EK enzyme.
Example 2 detection of plasmid loss Rate
5mL of the resuscitation bacteria solution in example 1 is taken under aseptic condition and stored in a refrigerator at 4 ℃ to be used as a positive control; 5mL of the fermented broth after the end of the fermentation in example 1 was taken under aseptic conditions, diluted and spread on an anti-LB-free plate, and cultured overnight at 37 ℃ in an inverted state. The next day, 100 single clones on the LB plate were randomly picked and inoculated into 96-well plates containing 500. Mu.L of LB medium containing Kan liquid at a final concentration of 20. Mu.g/mL per well, and cultured overnight at 37 ℃ and 220 rpm.
And (3) carrying out PCR amplification by using the designed PCR primer and the overnight culture liquid as a template, and meanwhile, taking sterile water and host bacteria BL2 (DE 3) as negative controls and taking resuscitative liquid before induction as a positive control. The PCR forward primer and reverse primer are as follows:
a forward primer: TGCGCATGATCGTGCTCCTGTCGTT;
reverse primer: TGATGCCTCCGTGTAAGGGGGATTT.
1. Preparing materials:
solution preparation, according to the configuration shown in table 1:
TABLE 1
PCR amplification
(1) Pre-denaturation: heating the solution to 95 deg.C, and maintaining for 3 min;
(2) Denaturation: heating the solution to 94 ℃, and keeping the temperature at 15 s;
(3) Annealing: reducing the reaction temperature to 55 ℃, and annealing 15 s;
(4) Extension: heating the reaction temperature to 72 ℃ and extending to 45 s;
(5) Final extension: heating the solution to 72 deg.C, and maintaining for 3 min;
the steps (2), (3) and (4) are circulated 29 times, and then the extension is carried out for 3 min at 72 ℃, and finally the temperature is reduced to 16 ℃ and the storage is kept.
3. Agarose gel electrophoresis detection
After the PCR amplification is finished, the PCR amplification product of the strain is detected by agarose gel electrophoresis, and part of the detection result is shown in FIG. 1 (only a part of the result image is shown as an example in the figure), wherein the last lane is a positive control band. The result shows that the plasmid is partially lost, the plasmid loss number is 35, the calculated plasmid loss rate is 35 percent, and the result is basically consistent with the verification result of a plate coating method.
The above example 2 is repeated for a plurality of times, and the plate coating method is carried out in parallel for verification, and the experimental result shows that the detection result adopting the plate coating method occasionally has a false negative phenomenon, while the detection method provided by the application has high sensitivity, stable repeated detection result and no false negative result.
It is noted that, in this document, relational terms such as "first" and "second," and the like, may be used solely to distinguish one entity or action from another entity or action without necessarily requiring or implying any actual such relationship or order between such entities or actions. Also, the terms "comprises," "comprising," or any other variation thereof, are intended to cover a non-exclusive inclusion, such that a process, method, article, or apparatus that comprises a list of elements does not include only those elements but may include other elements not expressly listed or inherent to such process, method, article, or apparatus. Without further limitation, an element defined by the phrase "comprising a … …" does not exclude the presence of another identical element in a process, method, article, or apparatus that comprises the element.
The foregoing are merely exemplary embodiments of the present disclosure, which enable those skilled in the art to understand or practice the present disclosure. Various modifications to these embodiments will be readily apparent to those skilled in the art, and the generic principles defined herein may be applied to other embodiments without departing from the spirit or scope of the disclosure. Thus, the present disclosure is not intended to be limited to the embodiments shown herein but is to be accorded the widest scope consistent with the principles and novel features disclosed herein.
Claims (7)
1. A method for detecting the loss rate of plasmids in recombinant engineering bacteria is characterized by comprising the following steps:
(1) Designing a specific primer according to a non-transcription translation region of a recombinant plasmid in a recombinant engineering bacterium, wherein the forward primer is TGCGCATGATCGTGCTCCTGTCGTT, the reverse primer is TGATGCCTCCGTGTAAGGGGGATTT, and the recombinant plasmid is a recombinant pET plasmid;
(2) Taking recombinant engineering bacteria at the end of fermentation after induction expression, coating an antibiotic-free culture medium on a flat plate for culturing, randomly selecting more than or equal to 30 clones on the flat plate of the culture medium to respectively perform suspension culture in a culture medium containing antibiotics, and performing PCR amplification on each cultured clone by using a specific primer designed in the step (1); the antibiotic is an antibiotic corresponding to an antibiotic resistance gene contained in the recombinant engineering bacteria;
(3) And detecting the result of the PCR amplification product, and calculating the plasmid loss rate, wherein the plasmid loss rate is the clone number without the amplification result/the total clone number.
2. The detection method according to claim 1, wherein the number of clones picked in the step (2) is 80 or more.
3. The method according to claim 2, wherein the number of clones picked in the step (2) is 100.
4. The detection method according to claim 1, wherein the method for detecting the PCR amplification product in step (3) is a gel electrophoresis method, and the presence or absence of the amplification product in the amplified recombinant engineered bacterial clone is determined by gel electrophoresis.
5. The detection method according to any one of claims 1 to 4, wherein the recombinant engineered bacterium is a recombinant engineered Escherichia coli bacterium.
6. The detection method according to claim 5, further comprising the steps of: and (3) preserving the bacterial liquid before induction for later use, and performing PCR amplification on the preserved bacterial liquid by using the primer to serve as a positive control.
7. The detection method according to claim 6, further comprising the steps of: blank host bacteria are taken to perform PCR amplification by using the primer, and the primer is used as a negative control.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202211039465.9A CN115109861B (en) | 2022-08-29 | 2022-08-29 | Method for detecting loss rate of plasmid in recombinant engineering bacteria |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202211039465.9A CN115109861B (en) | 2022-08-29 | 2022-08-29 | Method for detecting loss rate of plasmid in recombinant engineering bacteria |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN115109861A CN115109861A (en) | 2022-09-27 |
| CN115109861B true CN115109861B (en) | 2022-12-02 |
Family
ID=83335446
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202211039465.9A Active CN115109861B (en) | 2022-08-29 | 2022-08-29 | Method for detecting loss rate of plasmid in recombinant engineering bacteria |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN115109861B (en) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103146625A (en) * | 2013-01-24 | 2013-06-12 | 陈晓东 | Plasmid clone bacterial strain of vibrio cholerae rfb-0139 gene, preparation method and appliance thereof |
| CN104894042A (en) * | 2014-12-24 | 2015-09-09 | 温州医科大学 | Escherichia coli for arsenic detection |
| CN215103263U (en) * | 2021-02-07 | 2021-12-10 | 江苏普瑞康生物医药科技有限公司 | Colony statistics sticky plastic film for plasmid loss rate experiment |
-
2022
- 2022-08-29 CN CN202211039465.9A patent/CN115109861B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103146625A (en) * | 2013-01-24 | 2013-06-12 | 陈晓东 | Plasmid clone bacterial strain of vibrio cholerae rfb-0139 gene, preparation method and appliance thereof |
| CN104894042A (en) * | 2014-12-24 | 2015-09-09 | 温州医科大学 | Escherichia coli for arsenic detection |
| CN215103263U (en) * | 2021-02-07 | 2021-12-10 | 江苏普瑞康生物医药科技有限公司 | Colony statistics sticky plastic film for plasmid loss rate experiment |
Non-Patent Citations (2)
| Title |
|---|
| 包含ARS/CEN元件的游离质粒在巴斯德毕赤酵母中的稳定性研究;刘国强等;《生物学杂志》;20200418(第02期);第1.2.7节、第2.4节、图4、图5 * |
| 基于thyA基因的大肠杆菌染色体-质粒平衡致死系统的构建与应用;吉玉辉等;《中国兽医科学》;20081120(第11期);第1.8节、第1.9节、第2.6节、第2.8节 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN115109861A (en) | 2022-09-27 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US8628967B2 (en) | Process for chromosomal integration and DNA sequence replacement in clostridia | |
| Wilkinson et al. | Physical map of the Clostridium beijerinckii (formerly Clostridium acetobutylicum) NCIMB 8052 chromosome | |
| CN110846268A (en) | Food-grade lactobacillus plantarum expression system and application thereof in yoghourt preparation | |
| CN106967744B (en) | Method for eliminating multi-copy plasmids in salmonella by utilizing suicide vector | |
| CN111041029B (en) | Strong promoter and application thereof in production of vitamin B12Application of strain | |
| US8753846B2 (en) | Methods of modifying nucleic acids in host cells | |
| CN111849852A (en) | Construction method of high-optical-purity L-lactic acid engineering bacteria | |
| CN115109861B (en) | Method for detecting loss rate of plasmid in recombinant engineering bacteria | |
| US20210163963A1 (en) | Bacillus Subtilis Efficiently-Induced Expression System Based on Artificial Series Promoter | |
| CN112980891B (en) | Coli genome editing tool based on CRISPR-Cas | |
| CN110791522B (en) | Double-plasmid food-grade lactobacillus plantarum expression system and application thereof | |
| EP2267126A1 (en) | Process for the stable gene interruption in clostridia | |
| CN113583931B (en) | Citrobacter williamsii ansB gene knockout mutant strain and application thereof | |
| Chen et al. | Regulatory role of cAMP receptor protein over Escherichia coli fumarase genes | |
| US20100330678A1 (en) | Process for the stable gene interruption in clostridia | |
| CN104513830A (en) | Gene expression vector applicable to gluconobacter oxydans and application of gene expression vector | |
| Yamamoto et al. | Identification of pTi-SAKURA DNA region conferring enhancement of plasmid incompatibility and stability | |
| CN115976058B (en) | Toxin gene and application thereof in construction of recombinant and/or gene-edited engineering bacteria | |
| CN114480387B (en) | Staphylococcus aureus constitutive promoter, expression vector, construction method, recombinant strain and application thereof | |
| Zhang et al. | A novel high-copy plasmid, pEC, compatible with commonly used Escherichia coli cloning and expression vectors | |
| CN115029365B (en) | Construction and application of antibiotic-free efficient stable expression system of escherichia coli probiotics EcN | |
| CN114774421B (en) | Mutant of endogenous promoter of zymomonas mobilis | |
| CN114875046B (en) | Filamentous fungus replicon | |
| US20230287398A1 (en) | Construction method of a tight regulation system for gene expression in zymomonas mobilis and applications | |
| TWI697559B (en) | Shuttle vector, prokaryotic host cells and kit comprising the same, and method for producing proteins via the host cells |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CP01 | Change in the name or title of a patent holder | ||
| CP01 | Change in the name or title of a patent holder |
Address after: 100025 21 floor, 2 building, 2000 business center, Eight Mile Village, Chaoyang District, Beijing. Patentee after: Beijing huizhiheng Biotechnology Co.,Ltd. Patentee after: Jilin Huisheng Biopharmaceutical Co.,Ltd. Address before: 100025 21 floor, 2 building, 2000 business center, Eight Mile Village, Chaoyang District, Beijing. Patentee before: Beijing huizhiheng Biotechnology Co.,Ltd. Patentee before: Jilin Huisheng biopharmaceutical Co.,Ltd. |