CN115044487A

CN115044487A - Marine fungus strain with tobacco mosaic virus prevention and control effect

Info

Publication number: CN115044487A
Application number: CN202210796104.2A
Authority: CN
Inventors: 王秀芳; 任广伟; 申莉莉; 杨金广; 徐蓬军; 王新伟; 王凤龙
Original assignee: Qingzhou Tobacco Research Institute of China National Tobacco Corp of Institute of Tobacco Research of CAAS
Current assignee: Qingzhou Tobacco Research Institute of China National Tobacco Corp of Institute of Tobacco Research of CAAS
Priority date: 2022-07-06
Filing date: 2022-07-06
Publication date: 2022-09-13
Anticipated expiration: 2042-07-06
Also published as: CN115044487B

Abstract

The invention provides a marine fungus strain with tobacco mosaic virus prevention and treatment effect, which is an Aspergillus villosus (MFS 2119) strain with the preservation number of CGMCCNO.40163. The MFS2119 strain screened by the invention is used for preventing and treating the tobacco mosaic virus and can also be used for preparing products with the function of preventing and treating the tobacco mosaic virus. The invention also provides a metabolite of the MFS2119 strain, which can be used for preventing and treating tobacco mosaic virus diseases. The MFS2119 strain with biological activity to the tobacco mosaic virus is obtained, can be applied to the prevention and the treatment of the tobacco mosaic virus, and the inhibition rate of fermentation supernatant to TMV is determined to be 95% by using a local withered spot method; the inhibition rate of the fermented crude extract on TMV is 74.74%; meanwhile, the crude extract of the MFS2119 strain fermentation liquor shows certain biological activity to myzus persicae, and has practical application value in production.

Description

Marine fungus strain with tobacco mosaic virus prevention and control effect

Technical Field

The invention belongs to the technical field of microorganism screening, and particularly relates to a marine fungus strain with tobacco mosaic virus prevention and control effects.

Background

Along with the increasing concern of people on self health and living environment, chemical pesticide is abused to increase pesticide residues in the environment, the problems of the increase of the drug resistance of the pests, the rampant of the pests and the like are the most prominent. With the further understanding of the social problems, environmental problems, and human health problems associated with chemical pesticides in various countries of the world, more and more chemical pesticides are being restricted or prohibited from being used. As a novel pesticide with low toxicity and low residue and with less possibility of generating drug resistance by pests, biopesticide naturally becomes a hot spot concerned and tried to be developed by the modern pesticide industry, and the research, development and industrialization of biopesticide also become the strategic demands of the country.

Microbial pesticides are an important class of biopesticides, including agricultural antibiotics and live microbial pesticides. The microbial pesticide is separated and purified from natural products, can directly act on pest control, and can also be used as a lead compound to synthesize a new pesticide. The pesticide not only can retain the advantages of low toxicity, low residue and the like of the original bioactive substances, but also overcomes the defects of poor stability, low activity and the like of certain natural products, so that the potential of the bioactive substances is fully exploited.

Fungi are important resources for developing microbial pesticides, and a great amount of scientific research power is put into research in all countries in the world. More than 70 kinds of biopesticides with terrestrial fungi or metabolites thereof as active ingredients registered at present are widely applied to control of plant diseases, insect pests and field weeds. China also achieves outstanding results in the aspects of application and basic research. Although the current yield of the biopesticides only accounts for 9 percent of the total yield of the biopesticides in China, the development potential of the biopesticides is huge from the long-term benefit consideration of human beings and the development trend of the biopesticides. The living environment of marine fungi is harsh (high salt, high pressure, oxygen deficiency, low nutrition, no light and the like), and in order to obtain a living space, the marine fungi generate secondary metabolites with unique structures in a long-term evolution process, particularly marine animal and plant symbiotic fungi, actively participate in the metabolic activities of animals and plants by secreting metabolites with various biological activities in order to strive for the maximum survival of the marine fungi, and play an important role in the anti-infection and anti-phagocytosis ecological defense of the animals and plants. Regarding the function and application of marine fungus secondary metabolites, researchers are more concerned about the development of medical drugs for treating human diseases, and the research on agricultural antiviral function of marine fungus metabolites is less.

Tobacco Mosaic Virus (TMV) is a plant virus disease caused by TMV, is commonly generated in all Tobacco regions in the world, causes serious loss, and is one of the most serious diseases damaging Tobacco. TMV is spread primarily by sap rubbing and can infect a wide variety of 350 host plants including tobacco, tomato, potato, eggplant, pepper, solanum nigrum and other solanaceous crops. The whole growth period from the seedbed to the field can occur, the color of the baked diseased leaves is not uniform, the quality is reduced, and the yield is reduced. At present, many researches on biological control of tobacco mosaic virus are carried out in China, but most researches are limited to screening of biocontrol strains, mainly screening of bacteria, and carrying out deep researches on aspects such as separation and extraction of antagonistic substances generated by fungi. The invention explores from the aspect of biological prevention and control, screens the antagonistic marine fungus strain with excellent prevention and control effect, separates and extracts the produced antagonistic active substance, and applies to the prevention and control of tobacco mosaic virus.

Disclosure of Invention

The invention aims to provide a marine fungus strain with tobacco mosaic virus prevention and treatment effect, namely a marine fungus strain Aspergillus florcosus from seawater and application thereof in tobacco common mosaic virus prevention and treatment, and metabolites of the strain can be used for biological prevention and treatment of tobacco common mosaic virus, so that the defects of the prior art are overcome.

The invention provides an Aspergillus funiculosum (Aspergillus ficcosus) MFS2119 strain from seawater, which is preserved in China general microbiological culture collection center at 26.4.2022, and the preservation addresses are as follows: the Beijing West Lu No. 1 Hospital No. 3 of Chaoyang district, the preservation number is: CGMCC NO. 40163.

The MFS2119 strain screened by the invention is used for preventing and treating the tobacco mosaic virus and can also be used for preparing products with the function of preventing and treating the tobacco mosaic virus;

the product is preferably a microbial agent.

The present invention also provides a metabolite of the MFS2119 strain, which is prepared by the following method:

fermenting the MFS2119 strain, adding ethyl acetate into the fermented supernatant for extraction, concentrating the obtained organic phase on a rotary evaporator under reduced pressure, eluting with methanol, and evaporating to dryness at room temperature to obtain crude metabolite of the MFS2119 strain.

The fermentation is carried out by inoculating MFS2119 strain into PDB liquid culture medium and fermenting at 28 ℃.

The metabolite is used for preventing and treating tobacco mosaic virus diseases.

The MFS2119 strain with biological activity to the tobacco mosaic virus is obtained, can be applied to the prevention and the treatment of the tobacco mosaic virus, and the inhibition rate of fermentation supernatant to TMV is determined to be 95% by using a local withered spot method; the inhibition rate of the fermented crude extract on TMV is 74.74%; meanwhile, the crude extract of the MFS2119 strain fermentation liquor also shows certain biological activity to myzus persicae, and has practical application value in production.

Drawings

FIG. 1: a culture morphology of strain MFS2119,

FIG. 2: the effect of strain MFS2119 fermentation supernatant on TMV inhibition,

FIG. 3: the effect of crude extract of the secondary metabolite of the strain MFS2119 on the inhibition of TMV is shown,

FIG. 4: 14d photograph of MFS2119 PDB fermentation culture;

FIG. 5: a picture of a rice culture medium fermentation culture 7d of the strain MFS 2119;

FIG. 6: HPLC spectrogram of crude extract of secondary metabolism of strain MFS2119 (PDB culture solution in upper picture, rice culture solution in lower picture)

Detailed Description

The present invention will be described in detail below with reference to specific embodiments and the accompanying drawings.

Example 1: separating, purifying and identifying strain

A seawater sample collected from Liaoning disc jin Liaohe lipstick beach in 10 months in 2020 is placed on a PDA culture medium (the preparation method of the culture medium comprises the steps of peeling potatoes, cutting 200g into small blocks, adding 1L of seawater, boiling for 30min, filtering by 4-6 layers of gauze, adding 20g of glucose, dissolving, supplementing lost water by distilled water, adding 1.5-2% of agar into a solid culture medium, carrying out high-pressure sterilization at 121 ℃ for 20 min.) and culturing at 28 ℃, and carrying out single-spot separation and purification to obtain the MFS2119 strain. Aspergillus pilosus (Aspergillus floccosus) was identified by 18s rDNA ITS gene sequence analysis.

The 18s rDNA ITS gene sequence is as follows:

GGTATCGAGTGCGGGTCTCGTGGCCAACCTCCCACCCGTGACTATTGTACCTTGTTGCTTCGGCGGGCCCGCCAGCTTGCTGGCCGCCGGGGGGCGTCTCGCCCCCGGGCCCGTGCCCGCCGGAGACCCCAACATGAACCCTGTTCTGAAAGCTTGCAGTCTGAGTTGTGATTCTTTGCAATCAGTTAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCCCGGCTTGTGTGTTGGGTCCTCGTCCCCCGGCTCCCGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTTGTCTTCCGCTCTGTAGGCCCGGCCGGCGCCCGCCGACGCATTTTTTTGCAACTTGTTTTTTTCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAAAAGGCGGAGGGAA。

example 2: culture form and physicochemical parameters of Aspergillus nidulans (MFS 2119) Strain

Micromorphological characteristics of the MFS2119 Strain

Observing under a microscope, and finding that the MFS2119 strain conidiophores grow on the creeping hyphae, are upright, 400-1200 mu m high and 5-8 mu m in diameter; spherical cyst with diameter of 20-30 μm; the spore-forming cells are in ampoule shape, are grown on cysts in a single layer, have no partition or 1 partition, and have the size of 2.5-4 multiplied by 8-12 mu m; the conidium is in chain shape, is spherical, has thorns and has a diameter of 3-8 μm.

Culture conditions of MFS2119 Strain

Culturing the bacterial colony on a PDA culture medium for 7 days, wherein the diameter is 9cm, the bacterial colony is flat, the aerial hyphae are dense and yellow-white, and the edges of the bacterial colony are filiform and white; the middle of the back is yellow-white and the edge is white. Peduncle yellow-green, moderate production (fig. 1). The cells were spherical after culturing on PDA liquid medium. The optimal growth temperature of the MFS2119 strain is 28 ℃, the optimal pH value is 10, the optimal culture time is 8d, and the optimal culture medium is seawater PDA culture medium.

Example 3: inhibitory Effect of MFS2119 Strain on TMV

The inhibitory effect of the obtained strain on TMV was determined by the local focal spot method. Weighing 1g of fresh TMV diseased leaves, adding 10mL of sterilized phosphate buffer solution, grinding into homogenate, filtering by using sterilized gauze, and taking supernatant as inoculation liquid: inoculating the strain into PDB liquid culture medium, performing large-scale fermentation culture, and taking fermentation supernatant as anti-TMV bacterial liquid for later use. Mixing the bacterial liquid and TMV inoculation liquid in equal amount, mixing PDB liquid culture medium and TMV inoculation liquid in equal amount, standing at room temperature for 10min respectively, friction inoculating triclosan-NN tobacco, and spraying appropriate amount of carborundum on the surface of leaf blade before inoculation. The mixed solution of the left half leaf inoculation bacterial liquid and the TMV inoculation liquid, the mixed solution of the right half leaf inoculation PDB culture medium and the TMV inoculation liquid are used as a control, and 200uL of the inoculation liquid is inoculated to each half leaf. After inoculation, the leaves were washed with clear water and repeated 3 times. And observing the result after 3d of inoculation, and counting the number of the dead spots to calculate the inhibition rate. The result shows that the strain fermentation liquor has better effect of inhibiting TMV, the inhibition rate of the bacterial strain fermentation liquor on the scorched spots reaches 95 percent (table 1, figure 2), the inhibition rate of the bacterial strain secondary metabolism crude extract on the scorched spots of the TMV reaches 74.74 percent (table 2, figure 3), and the biocontrol strain generates a resistant substance for inhibiting the activity of the TMV in the growth and metabolism process.

The inhibition ratio (%) [1- (treatment average number of scorched spots/control average number of scorched spots) ] × 100.

Table 1: table of TMV inhibition by fermentation supernatant of MFS2119 Strain

Table 2: table of inhibition of crude secondary metabolite of MFS2119 strain on TMV

Example 4: preparation of metabolites

The marine fungus MFS2119 strain to be tested is respectively inoculated in a liquid PDB culture medium (figure 4) and a solid rice culture medium (figure 5), and the mixture is subjected to standing fermentation culture for about 40 days at the temperature of 28 ℃. After fermentation, taking supernatant of a liquid PDB culture medium, adding equal volume of ethyl acetate for extraction for 3 times, directly adding equal volume of ethyl acetate into solid fermented rice culture thalli for extraction for 3 times, respectively carrying out reduced pressure concentration on obtained organic phases on a rotary evaporator, eluting with methanol, and evaporating to dryness at room temperature to obtain crude extracts of secondary metabolites of MFS2119 strains by liquid fermentation and solid fermentation.

Dissolving crude fermentation extract of MFS2119 strain obtained by two culture modes with appropriate amount of methanol, performing High Performance Liquid Chromatography (HPLC) analysis, performing comparative analysis according to number of chromatographic peaks and ultraviolet absorption curve, and analyzing abundance and content of secondary metabolite of MFS2119 strain in liquid and solid culture modes (figure 5). From the results, the two culture modes have slightly different types of secondary metabolites of the strain MFC2117, two main peaks of a chromatographic peak at 235nm are the same, and two positions are different and the same.

Table 3: HPLC Standard program Table

Time (min)	Flow rate (mL/min)	Methanol	Water (W)
				0-5	0.8	10％	90％
5-35	0.8	10％-100％	90％-0
				35-45	0.8	100％	0
45-50	0.8	100％-10％	0-90％
				50-60	0.8	10％	90％

Example 5: bioassay of Secondary Metabolic active substances of MFS2119 Strain on Aphis citricola

Inoculating the strain MFS2119 of marine fungus into a liquid PDB culture medium, and standing, fermenting and culturing at 28 ℃ for about 40 days. After fermentation, taking supernatant of the liquid PDB culture medium, adding equal volume of ethyl acetate for extraction for 3 times, respectively carrying out reduced pressure concentration on obtained organic phases on a rotary evaporator, eluting with methanol, and evaporating to dryness at room temperature to obtain a secondary metabolic crude extract of the MFS2119 strain through liquid fermentation.

And testing the toxicity of the crude extract of the fungus on the myzus persicae by adopting an insect-soaking and leaf-soaking method. Spreading filter paper in a culture dish (diameter of 9cm), adding 1mL of distilled water to maintain proper humidity, soaking tobacco leaves with proper size in the solution for 10s, air drying, placing in the culture dish, and moistening the stems of the tobacco leaves with absorbent cotton. Soaking tobacco leaves with aphids into the diluted crude extract solution for 10 seconds, and picking 30 aphids (healthy wingless aphids with consistent sizes) in a culture dish.

The crude extract is prepared into 10000mg/L mother solution by acetone, and is diluted by clear water in a gradient way to prepare solutions of 5000mg/L, 2500mg/L, 1250mg/L, 625mg/L and 312.5mg/L, CK (acetone) respectively. And (3) respectively setting the number of the replicates, checking and counting the aphid death condition under each concentration of crude extract in 24h, processing the data by SPSS software, and calculating LC50, a regression equation and a correlation coefficient.

Table 4: LC50 analytical table of crude extract of secondary metabolite of MFS2119 strain on myzus persicae

Regression equation	LC50(mg/L)	Confidence interval	Correlation coefficient
				y＝-9.572+3.308x	783.39	630.604-961.542	0.92

The result shows that the active ingredients of the secondary metabolism crude extract of the marine fungus MFS2119 strain have higher toxicity to myzus persicae, and the insecticidal rate can reach 100% when the treatment concentration is 5000 mg/L. Statistical analysis is carried out through SPSS software to obtain that LC50 of the strain MFC2117 fermentation liquor extract to myzus persicae is 783.39mg/L, and a toxicity regression equation is as follows: y-9.572 +3.308x, R0.92, 95% confidence limit 630.604-961.542.

Claims

1. The aspergillus villosus is characterized in that the preservation number of the aspergillus villosus is CGMCC NO. 40163.

2. Use of Aspergillus funiculosum according to claim 1 for the control of tobacco mosaic virus.

3. Use of Aspergillus funiculus according to claim 1 for the preparation of a preparation for the control of tobacco mosaic virus.

4. The use of claim 3, wherein the product is a microbial agent.

5. A preparation for controlling tobacco mosaic virus, comprising Aspergillus sojae according to claim 1.

6. The product of claim 5, wherein the product further comprises the Aspergillus congii metabolite of claim 1.

7. The product of claim 6, wherein the metabolite is obtained by extraction of the fermentation supernatant of Aspergillus villosus as defined in claim 1.

8. A metabolite of Aspergillus congii according to claim 1, wherein said metabolite is obtained by extraction of a fermentation supernatant of Aspergillus congii according to claim 1.

9. The metabolite according to claim 8, wherein the fermentation supernatant is prepared by inoculating the Aspergillus villosus of claim 1 into a PDB liquid medium and fermenting.

10. Use of a metabolite as claimed in claim 8 or 9 in the manufacture of a product for use in the control of tobacco mosaic virus disease.