CN116024095A - Cladosporium strain from submarine sediment for controlling myzus persicae - Google Patents

Abstract

The invention provides a strain for preventing and controlling myzus persicae, which is an MFC2117 strain of Cladosporium sp with a preservation number of CGMCC No.40162. The MFC2117 strain screened by the invention is used for preventing and controlling myzus persicae or tobacco mosaic virus, and can also be used for preparing products with the function of preventing and controlling myzus persicae or tobacco mosaic virus. The invention also provides a metabolite of the MFC2117 strain, which can be used for preventing and controlling myzus persicae or tobacco general mosaic virus. The MFC2117 strain with biological activity on the tobacco aphid can be applied to control of the tobacco aphid on tobacco. A biological assay of the myzus persicae by adopting a micro-drop method shows that the highest mortality rate of secondary metabolites in fermentation liquor to the myzus persicae can reach 100 percent when the treatment concentration is 500 mg/L.

Description

Cladosporium strain from submarine sediment for controlling myzus persicae

Technical Field

The invention belongs to the technical field of microbial control, and particularly relates to a bacterial strain for controlling myzus persicae, namely a Cladosporium sp strain from a submarine sediment, and a mixture of secondary small molecular compounds obtained from the bacterial strain. The strain and the metabolite thereof can be applied to the prevention and control of myzus persicae.

Background

With the increasing attention of people to self health and living environment, the defects caused by the traditional chemical pest control measures have attracted great attention. The problems of increased pesticide residue in the environment, increased drug resistance of the pests, rampant re-occurrence of the pests and the like caused by the excessive use of chemical pesticides are most remarkable. With the further understanding of various social problems, environmental problems, and human health problems caused by chemical pesticides in various countries of the world, more and more chemical pesticides are restricted or prohibited. Biological pesticides, which are novel pesticides with low toxicity and low residue and are not easy to generate drug resistance by diseases and insect pests, naturally become hot spots for modern pesticide industry to pay attention to and try to develop, and research and industrialization of the biological pesticides are also strategic demands of the country.

Microbial pesticides are an important class of biopesticides, including agricultural antibiotics and live microbial pesticides. The microbial pesticide is separated and purified from natural products, can directly act on pest control, and can also be used as a lead compound to synthesize a novel pesticide. The pesticides not only can keep the advantages of low toxicity, low residue and the like of the original bioactive substances, but also overcomes the defects of poor stability, low activity and the like of certain natural products, so that the potential of the bioactive substances is fully exploited.

Fungi are important resources for developing microbial pesticides, and a great amount of scientific research force is put into research all over the world. The registered biopesticides containing land fungi or metabolites thereof as active ingredients are up to 70 or more, and these biopesticides are widely used for controlling plant diseases, insect pests and weeds in fields. The Chinese also has very outstanding results in application and basic research. Although the current yield of biopesticides in China only accounts for 9% of the total yield of pesticides, the development potential of biopesticides is huge in terms of long-term benefit of human beings and development trend of pesticides. The marine fungi are derived from marine environments and are not parasitic bacteria of land organisms, and in front of a biological pesticide development mode directly taking a living body of a microorganism as an effective pesticide or a sterilization component, the marine fungi have no advantages compared with the land fungi, but have great advantages in a pesticide development mode taking metabolism of the microorganism as an effective component.

The living environment of the marine fungi is harsh (high salt, high pressure, hypoxia, low nutrition, no illumination and the like), in order to obtain living space, the marine fungi generate a plurality of secondary metabolites with unique structures in the long-term evolution process, particularly the marine animal and plant co-epiphyte is used for striving for the maximum living of the marine fungi, the metabolites with various biological activities are secreted to actively participate in the metabolism activities of the animal and plant, and the marine fungi play an important role in the ecological defense of the animal and plant against infection and phagocytosis, and are considered as the best object for screening antibiotics. 70% -80% of the novel compounds isolated from marine fungi have a wide variety of biological activities and have attracted considerable attention from chemists and biologists, and the species include terpenes, peptides, alkaloids, ketones and esters, many of which are the active ingredients or precursors of certain pesticides and fungicides. Regarding the functions and the purposes of the marine fungus secondary metabolites, researchers are focused on the development of medical drugs for treating human diseases, and the research on agricultural insecticidal and bactericidal functions of the marine fungus metabolites is less.

The Myzus persicae (Sulzer) belongs to the homoptera aphidaceae, is one of important agricultural pests, can be a plurality of plants such as tobacco, cruciferous vegetables, peach trees and the like, and is also a transmission medium of a plurality of plant viruses such as Cucumber Mosaic Virus (CMV), potato Virus Y (PVY) and the like. At present, the most effective method for controlling the myzus persicae is chemical control, and meanwhile, a plurality of successful applications (such as propagation and release of natural enemy myzus persicae) related to biological control methods exist, but no report is yet available for exploring fuming aphid biological preparations by utilizing marine microorganism secondary metabolites.

Disclosure of Invention

The invention aims to provide a strain for controlling myzus persicae, namely a Cladosporium sp strain from submarine sediment and application thereof in biological control of myzus persicae, and simultaneously, the strain which is screened and can generate secondary metabolite with biological activity on myzus persicae is applied to the biological control of myzus persicae, so that the defects of the prior art are overcome.

The invention firstly provides a Cladosporium sp (MFC 2117) strain from a submarine sediment, which is preserved in China general microbiological culture Collection center (China general microbiological culture Collection center) at the month 4 and 26 of 2022, and the preservation address is: the collection number of Beijing city, the North Chen Xili No. 1 and 3 in the Chaoyang district is: CGMCC No.40162.

The MFC2117 strain screened by the invention is used for preventing and controlling myzus persicae or tobacco mosaic virus, and can also be used for preparing products with the function of preventing and controlling myzus persicae or tobacco mosaic virus.

The invention also provides a metabolite of the MFC2117 strain, and a specific preparation method thereof is as follows:

ethyl acetate is added to the fermentation supernatant of the MFC2117 strain for extraction, the obtained organic phase is concentrated under reduced pressure on a rotary evaporator, and the organic phase is evaporated to dryness at room temperature after being eluted by methanol to obtain the crude metabolic extract of the MFC2117 strain.

As a specific description of one example, the fermentation is carried out by inoculating MFC2117 strain into PDB seawater medium and fermenting at 28deg.C.

The metabolite is used for preventing and controlling myzus persicae or tobacco mosaic virus.

The MFC2117 strain with biological activity on the tobacco aphid can be applied to control of the tobacco aphid on tobacco. A biological assay of the myzus persicae by adopting a micro-drop method shows that the highest mortality rate of secondary metabolites in fermentation liquor to the myzus persicae can reach 100 percent when the treatment concentration is 500 mg/L.

Drawings

Fig. 1: colony morphology of strain MFC2117 on PDA medium;

fig. 2: strain MFC2117 effect profile on TMV antagonistic activity;

fig. 3: photograph of strain MFC2117 liquid fermentation 14 d;

fig. 4: photograph of strain MFC2117 solid fermentation 7 d;

fig. 5: HPLC profile of strain MFC2117 secondary metabolite crude extract (PDB culture on top, rice culture on bottom).

Detailed Description

The strains of the present invention will be described in detail with reference to specific examples.

Example 1: isolation, identification and culture of marine fungus MFC2117 strain

Placing sediment of a first seawater bath ground in Qingdao city of Shandong in 12 months in 2020 on a PDA culture medium (the preparation method of the culture medium comprises peeling potato, cutting 200g into small pieces, adding seawater 1L, boiling for 30min, filtering with 4-6 layers of gauze, adding 20g glucose, dissolving, supplementing the lost water with distilled water, adding 1.5-2% agar into the solid culture medium, sterilizing at 121deg.C under high pressure for 20 min.) and culturing at 28deg.C, and separating and purifying single strain MFC 2117. The genus Cladosporium (Cladosporium sp.) was identified by 18s rDNA ITS gene sequence analysis.

The 18s rDNA ITS gene sequence is as follows:

ACGGTAGTGACTGCGGATGACATTACCGAGTGCGGGTCCTTTGGGCCCAACCTCCCATCCGTGT CTATTATACCCTGTTGCTTCGGCGGGCCCGCCGCTTGTCGGCCGCCGGGGGGGCGCCTTTGCCCCCCG GGCCCGTGCCCGCCGGAGACCCCAACACGAACACTGTCTGAAAGCGTGCAGTCTGAGTTGATTGAATG CAATCAGTTAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCG ATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTA TTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCCCGGCTTGTGTGTTGGGTCGCCGT CCCCCTCTCCGGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGATCCTCGAGCGTATGGGG CTTTGTCACATGCTCTGTAGGATTGGCCGGCGCCTGCCGACGTTTTCCAACCATTTTTTCCAGGTTGA CCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGAAA。

the colony culture morphology was as follows: culturing the bacterial colony on a PDA culture medium for 7 days, wherein the diameter is 9cm, the bacterial colony is flat, the aerial hypha is dense, yellow and white, and the edge of the bacterial colony is filiform and white; the middle of the back is yellow-white, and the edges are white. The sporophores produced in large quantities are yellow-green and black (figure 1). After culturing on PDB liquid medium, the cells were spherical (FIG. 3). The optimal growth temperature of the MFC2117 strain is 28 ℃, the optimal pH value is 10, the optimal culture time is 8d, and the optimal culture medium is a seawater PDB culture medium.

The microscopic morphology is as follows: conidiophores grow on creeping hypha, stand upright, and have a height of 400-700 μm and a diameter of 8-13 μm; the cysts are spherical and have the diameter of 40-55 mu m; ampoule-shaped spore-producing cells, single layer on sporangium, no partition, 2.5-4×5-8 μm; the conidium is chain-shaped and strung, spherical, smooth, colorless and has a diameter of 2-5 μm.

Example 2: field control experiment of marine fungus MFC2117 strain fermentation supernatant on myzus persicae

The marine fungus MFC2117 strain is inoculated in PDB liquid culture medium, and is subjected to standing culture for about 40d at the temperature of 28 ℃. And taking fermentation supernatant to perform a field control experiment. In the peak period of myzus persicae in tobacco field, the fermentation supernatant is uniformly sprayed on the front and back sides of the aphid leaf at the upper part of tobacco plant by using a 1L sprayer. The number of the insect population is investigated before spraying, the number of the remaining live insects is investigated once for 1 st, 3 rd and 7 th days after spraying, and the correction and prevention effects of the fermentation supernatant 1 st, 3 rd and 7 th days on the myzus persicae are calculated according to the investigation result and are 75.28%,89.05% and 91.11% respectively. The result shows that the fermentation supernatant of the MFC2117 strain has a field control effect on the myzus persicae.

Example 3: biological assay of secondary metabolic active substances of marine fungus MFC2117 strain on myzus persicae

The marine fungus MFC2117 strain is inoculated in PDB liquid culture medium, and is subjected to standing culture for about 40d at the temperature of 28 ℃. After fermentation, the supernatant was extracted 3 times with an equal volume of ethyl acetate, and the obtained organic phase was concentrated under reduced pressure on a rotary evaporator, eluted with methanol and evaporated to dryness at room temperature to obtain a crude metabolic extract of MFC2117 strain.

The toxicity of the secondary metabolic crude extract on the myzus persicae was tested by the insect and leaf dipping method. Spreading filter paper in a culture dish (diameter of 9 cm), adding 1mL distilled water to maintain proper humidity, immersing tobacco leaf with proper size in the solution for 10s, air drying, placing in the culture dish, and moistening tobacco leaf handle with absorbent cotton. Tobacco leaves with aphids are immersed in the diluted crude extract solution for 10s, and 30 aphids (healthy wingless aphids of uniform size) are picked up in a petri dish.

The crude extract was made up with acetone as 10000mg/L mother liquor, diluted with clean water in a gradient, and 5000 mg, 2500, 1250, 625 and 312.5mg/L solutions, CK (acetone) were prepared, respectively. Each of the three replicates was counted and the data were processed with SPSS software to calculate LC50, regression equation and correlation coefficients at 24h for checking the death of the myzus persicae at each concentration of the crude extract.

The result shows that the active ingredient of the marine fungus MFC2117 strain secondary metabolism crude extract has higher toxicity to the myzus persicae, the higher the concentration is, the higher the insecticidal rate is, and the insecticidal rate can reach 100% when the treatment concentration is 500 mg/L. Statistical analysis is carried out through SPSS software to obtain the LC50 of the strain MFC2117 fermentation liquor extract to the myzus persicae of 288.35mg/L, and the virulence regression equation is: y= -7.952+3.232x, r=0.85, 95% confidence limit 176.499-381.814.

The result shows that the MFC2117 strain screened by the invention has good control effect on myzus persicae and has good popularization and application values.

Example 4: inhibition of tobacco mosaic virus by marine fungus MFC2117 strain

The inhibition of TMV by the MFC2117 strain was determined using the local spot-drying method. 1g of fresh TMV leaf is weighed, 10mL of sterilized phosphate buffer solution is added to the leaf and is ground into homogenate, and the homogenate is filtered by sterilized gauze and then the supernatant is taken as an inoculation liquid: inoculating the strain into a PDB liquid culture medium, performing large-scale fermentation culture, and taking a fermentation supernatant to be used as an anti-TMV bacterial liquid for later use. And (3) mixing the bacterial liquid with TMV inoculation liquid in an equivalent way, mixing a PDB liquid culture medium with TMV inoculation liquid in an equivalent way, respectively standing for 10min at room temperature, then rubbing and inoculating Sansheng-NN cigarettes, and spraying a proper amount of silicon carbide on the surfaces of blades before inoculation. The mixed solution of the left half leaf inoculation bacterial liquid and the TMV inoculation liquid, the mixed solution of the right half leaf inoculation PDB culture medium and the TMV inoculation liquid are used as a control, and each half leaf is inoculated with 200uL. After inoculation, leaf surface washing is carried out by using clear water, and 3 times of repetition are carried out. The results were observed after 3d inoculation, and the inhibition rate was calculated by counting the number of dead spots. The results show that the strain fermentation broth has a good TMV inhibition effect, the spot-eliminating rate reaches 95% (Table 1, figure 2), and the biocontrol strain produces a resistant substance for inhibiting TMV activity in the growth and metabolism process.

Inhibition ratio (%) = [1- (treatment average number of dead spots/control average number of dead spots) ]×100.

Table 1: table of inhibition of TMV by MFC2117 strain fermentation supernatant

Example 5: marine fungus MFC2117 strain secondary metabolite enrichment analysis

The marine fungus MFC117 strain was inoculated to the liquid PDB medium (FIG. 3) and the solid rice medium (FIG. 4), respectively, and was left to ferment at 28℃for about 40 d. After fermentation, adding an equal volume of ethyl acetate into supernatant of a liquid PDB culture medium for extraction for 3 times, directly adding the equal volume of ethyl acetate into solid fermentation rice culture thalli for extraction for 3 times, respectively concentrating the obtained organic phases under reduced pressure on a rotary evaporator, eluting with methanol, and evaporating to dryness at room temperature to obtain the MFC2117 strain liquid fermentation and solid fermentation secondary metabolism crude extract.

Table 2: HPLC standard program table

The crude fermentation extracts of the strain MFC2117 obtained by the two culture methods were dissolved in a proper amount of methanol, analyzed by High Performance Liquid Chromatography (HPLC), and compared and analyzed according to the number of chromatographic peaks and the ultraviolet absorption curve, and the variety abundance and content of the secondary metabolites of the strain MFC2117 under the two different culture methods of liquid and solid were analyzed (fig. 5). From the results, the two culture modes have certain difference in the variety abundance of the secondary metabolite of the strain MFC2117, and the number of chromatographic peaks of the secondary metabolite of the strain MFC2117 at 235nm is more than that of the rice culture mode in the liquid fermentation mode, but the main peak of the chromatographic peaks is more obvious in the rice culture mode.

Claims (10)

1. A cladosporium strain is characterized in that the preservation number of the strain is CGMCC NO.40162.

2. The use of a cladosporium strain according to claim 1 for controlling myzus persicae or tobacco mosaic virus.

3. The use of a cladosporium strain according to claim 1 for the preparation of a product for controlling myzus persicae or tobacco mosaic virus function.

4. A product for controlling myzus persicae or tobacco mosaic virus function, characterized in that the product comprises the cladosporium strain of claim 1.

5. The article of manufacture of claim 4, further comprising a metabolite of the cladosporium strain of claim 1.

6. The preparation according to claim 5, wherein the metabolite is obtained by extracting the fermentation supernatant of the cladosporium strain according to claim 1 with an organic solvent.

7. The product according to claim 6, wherein the fermentation supernatant is prepared by inoculating the cladosporium strain according to claim 1 into a PDB seawater culture medium for fermentation.

8. A metabolite of the cladosporium strain of claim 1, which is obtained by adding an organic solvent to the fermentation supernatant of the cladosporium strain of claim 1, extracting, concentrating the obtained organic phase under reduced pressure on a rotary evaporator, eluting with methanol, and evaporating and drying.

9. The metabolite of claim 8, wherein said fermentation supernatant is obtained by inoculating a strain of cladosporium in PDB seawater medium and fermenting at 28 ℃.

10. Use of the metabolite according to claim 8 for combating myzus persicae or tobacco mosaic virus.

Images