CN115029334A

CN115029334A - High-specific-activity alkaline xylanase mutant

Info

Publication number: CN115029334A
Application number: CN202210814184.XA
Authority: CN
Inventors: 鲍锴; 吴秀秀; 李馨培; 于靖
Original assignee: Qingdao Vland Biotech Group Co Ltd
Current assignee: Weifang Kdn Biotech Co ltd; Qingdao Vland Biotech Group Co Ltd
Priority date: 2022-07-12
Filing date: 2022-07-12
Publication date: 2022-09-09
Anticipated expiration: 2042-07-12
Also published as: CN115029334B; CN117384886A; CN117384887A

Abstract

The invention relates to the technical field of genetic engineering and protein modification, in particular to a high-specific-activity alkaline xylanase mutant and application thereof. The invention provides a mutant containing at least one mutation site in I37V, A59S, D63E, D104Y, T107M/K, N167G and D192E on the basis of wild-type xylanase H1. Compared with wild xylanase H1, the specific activity of the xylanase mutant provided by the invention is generally improved by 8.5-32.8%; the xylanase mutant containing the D192E single-point mutation has the highest specific activity which reaches 1625.11U/mg, is favorable for reducing the production cost of the xylanase and promotes the wide application of the xylanase in the industrial field.

Description

High-specific-activity alkaline xylanase mutant

Technical Field

The invention relates to the technical field of genetic engineering and protein engineering, in particular to an alkaline xylanase mutant with high specific activity and application thereof.

Background

Xylan is a kind of five-carbon sugar widely existing in nature, xylanase is an enzyme capable of degrading xylan into xylobiose, xylooligosaccharide above xylobiose, a small amount of xylose and the like, and the xylanase is an enzyme playing a key role in the degradation process of xylan. Since the composition of xylan is complex and its hydrolysis requires the synergistic action of a plurality of enzymes, xylanase in a broad sense refers to a generic term for a series of enzymes capable of hydrolyzing xylan into oligosaccharides or monosaccharides, including endo-beta-1, 4-D-xylanase, beta-D-xylosidase, alpha-L-arabinosidase, alpha-D-glucuronidase, acetyl xylanase, phenolic acid esterase, etc., and xylanase in a narrow sense refers to endo-beta-1, 4-D-xylanase. Xylanases are widely available and can be produced by different types of microorganisms. Xylanases can be classified as alkaline, neutral, and acidic depending on their tolerance to acid-base environments.

The alkaline xylanase plays an important role in the paper industry, the feed industry and the food industry, and particularly in the industrial production of pulping for paper making, bleaching promotion, waste paper deinking and the like, the alkaline xylanase can obviously reduce the pollution discharge in the paper making process and improve the product quality. The pretreatment before bleaching is carried out on the alkaline wheat straw pulp by using xylanase AU-PE89, so that the grade product rate of finished product pulp A is improved by 1.43%, the fine pulp yield is improved by 1.48%, the sheet making strength indexes are improved to some extent, and the damage to fibers in the washing and bleaching section is reduced. As a result of studies on the addition of xylanase produced from Arthrobacter (Arthrobacter sp.) MTCC5214 during bleaching of pulp, it was found that the kappa number of kraft pulp was reduced by 20%, which corresponds to a 29% reduction in chlorine during bleaching, and that the enzyme treatment resulted in a 9.6% increase in the brightness of the pulp compared to untreated pulp.

In order to expand the application range of alkaline xylanase in production and application, many scholars have recently made great progress in expression, purification and expanded culture of alkaline xylanase genes isolated from nature by using cloning technology and genetic engineering technology. For example, when Bai et al performed structural comparison and mutation analysis on xylanase Xyn11A-LC from Bacillus subtilis SN5, it was found that alkaline xylanase has increased charged residue content at higher pH and has fewer serine, threonine and tyrosine relative to neutral and acidic xylanases, and mutation analysis showed that participation of at least six amino acids (Glu 16, Trp18, Asn44, Leu46, Arg48, Ser 187) makes the enzyme more active under alkaline conditions. Long et al, by adopting a method of co-expression of double plasmids, transfer xylanase genes from Aspergillus niger into Pichia pastoris to express, so that the expression capacity of the xylanase genes is improved by 33%, and the expression capacity is improved by 2.4 times compared with that of shake flask culture by optimizing culture conditions, thereby providing a new method for improving the yield of xylanase in production. Liujun and the like establish a random mutation library of xylanase genes by an error-prone PCR method and a double enzyme digestion vector reconstruction method, screen out four mutants which have relative enzyme activities higher than that of a starting strain enzyme by about 15 percent within the range of pH 8.0-9.5, and then carry out combined mutation on the four mutation sites, wherein the affinity and the catalytic efficiency of each combined mutant enzyme and a substrate are higher than those of a wild starting strain enzyme, and the pH stability is also obviously higher than that of the wild type enzyme.

The xylanase used at present has the problems of low specific activity, instability, high cost, incapability of meeting production requirements and the like, and needs to be subjected to property optimization through molecular modification. The invention provides the alkaline xylanase with high specific enzyme activity, which is more suitable for practical application in the industrial field.

Disclosure of Invention

The invention aims to provide an alkaline xylanase mutant. The specific activity of the mutant is obviously improved compared with that of a wild type, and the wide application of the mutant in the industrial field is facilitated.

In order to achieve the above object, the present invention provides the following technical solutions:

the present invention relates to a xylanase mutant comprising an amino acid sequence having at least 90% identity to SEQ ID No. 1 and comprising a substitution of an amino acid in at least one position selected from the group consisting of SEQ ID No. 1: 37, 59, 63, 104, 107, 167, 192.

In some embodiments of the invention, the amino acid sequence of the mutant is at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or at least 99% identical to SEQ ID No. 1.

In some more specific embodiments, the amino acid sequence of the mutant has at least 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, or at least 99.9% identity to SEQ ID No. 1.

In some embodiments of the invention, the mutant comprises a substitution of at least one amino acid of the group: I37V, A59S, D63E, D104Y, T107M/K, N167G and D192E.

The invention also relates to DNA molecules encoding the xylanase mutants.

The invention also relates to a recombinant expression vector containing the DNA molecule.

The invention also relates to a host cell comprising the recombinant expression vector.

The plasmid is transferred into a host cell, and the specific activity of the xylanase mutant subjected to recombinant expression is remarkably improved.

In some embodiments of the invention, the host cell is pichia pastoris (a: (b))Pichia pastoris）。

In some embodiments of the invention, the host cell is trichoderma reesei (trichoderma reesei) (ii)Trichoderma reesei）。

The invention also provides application of the xylanase mutant in the field of papermaking.

The invention provides a mutant containing at least one mutation site in I37V, A59S, D63E, D104Y, T107M/K, N167G and D192E on the basis of wild type xylanase H1. Compared with wild xylanase H1, the specific activity of the xylanase mutant provided by the invention is generally improved by 8.5-32.8%; the xylanase mutant containing the D192E single-point mutation has the highest specific activity which reaches 1625.11U/mg, and unexpected technical effects are achieved.

In conclusion, the specific activity of the xylanase mutant provided by the invention is obviously improved, so that the production cost of xylanase is reduced, and the wide application of the xylanase in the industrial field is promoted.

Detailed Description

The invention discloses an alkaline xylanase mutant, a preparation method and application thereof, and a DNA molecule, a vector and a host cell for coding the alkaline xylanase mutant. While the methods and applications of this invention have been described in terms of preferred embodiments, it will be apparent to those of ordinary skill in the art that variations and modifications in the methods and applications described herein, as well as other suitable variations and combinations, may be made to implement and use the techniques of this invention without departing from the spirit and scope of the invention.

The present invention uses conventional techniques and methods used in the fields of genetic engineering and molecular biology, such as MOLEC m LAR CLONING: a Laboratory MANUAL, 3nd Ed. (Sambrook, 2001) and CURRENT PROTOCOLS IN MOLEC LAR BIOLOGY (Ausubel, 2003). These general references provide definitions and methods known to those skilled in the art. However, those skilled in the art can adopt other conventional methods, experimental schemes and reagents in the field on the basis of the technical scheme described in the invention, and the invention is not limited to the specific embodiment of the invention. For example, the following experimental materials and reagents may be selected for use in the present invention:

bacterial strain and carrier: coli DH5 α, Pichia pastoris GS115, vector pPIC9k, Amp, G418 were purchased from Invitrogen.

Enzyme and kit: PCR enzyme and ligase were purchased from Takara, restriction enzyme was purchased from Fermentas, plasmid extraction kit and gel purification recovery kit were purchased from Omega, and GeneMorph II random mutagenesis kit was purchased from Beijing Bomais Biotech.

The formula of the culture medium is as follows:

coli medium (LB medium): 0.5% yeast extract, 1% peptone, 1% NaCl, ph 7.0;

yeast medium (YPD medium): 1% yeast extract, 2% peptone, 2% glucose;

yeast screening medium (MD medium): 2% peptone, 2% agarose;

BMGY medium: 2% peptone, 1% yeast extract, 100 mM potassium phosphate buffer (pH6.0),1.34% YNB，4×10 ^-5 % biotin, 1% glycerol;

BMMY medium: 2% peptone, 1% yeast extract, 100 mM potassium phosphate buffer (pH6.0), 1.34% YNB, 4X 10 ^-5 % biotin, 0.5% methanol;

LB-AMP medium: 0.5% yeast extract, 1% peptone, 1% NaCl, 100. mu.g/mL ampicillin, pH 7.0;

LB-AMP plates: 0.5% yeast extract, 1% peptone, 1% NaCl, 1.5% agar, 100. mu.g/mL ampicillin, pH 7.0;

upper medium: 0.1% MgSO ₄ ，1%KH ₂ PO ₄ ，0.6%(NH ₄ ) ₂ SO ₄ 1% glucose, 18.3% sorbitol, 0.35% agarose;

lower medium plate: 2% glucose, 0.5% (NH) ₄ ) ₂ SO ₄ ，1.5%KH ₂ PO ₄ ，0.06%MgSO ₄ ，0.06%CaCl ₂ 1.5% agar.

The invention is further illustrated by the following examples:

EXAMPLE 1 construction of recombinant plasmid

Derived from paecilomyces (A), (B), (C)Paecilomyces. sp) The xylanase gene (GeneBank ACS 26244.1) is optimized according to the codon preference of Pichia pastoris, and 6 bases of GAATTC (EcoR I cleavage site) are added before the initiation codon ATG of the xylanase, and GCGGCCGC (Not I cleavage site) is added after the termination codon TAA of the xylanase. The optimized nucleotide sequence was synthesized by the Shanghai Czeri bioengineering company Limited. The xylanase is named as H1, and the amino acid sequence of the xylanase is SEQ ID NO:1, the coding nucleotide sequence is SEQ ID NO: 2.

digesting the xylanase gene by using restriction enzymes EcoR I and Not I (Fermentas); meanwhile, plasmid pPIC9K was digested with restriction enzymes EcoR I and Not I. The cleavage products were purified using a gel purification kit, and the two cleavage products were ligated using T4 DNA ligase (Fermentas). The ligation product was transformed into DH 5. alpha. E.coli (Invitrogen) and selected with ampicillin. To ensure accuracy, several clones were sequenced (Invitrogen).

Plasmids were purified from E.coli clones with correct sequencing using a plasmid miniprep kit (Omega) to obtain 1 recombinant plasmid, which was designated pPIC 9K-H1.

Example 2 screening of high specific Activity xylanase mutants

To further increase the enzymatic activity of xylanase H1, applicants performed a protein structure analysis. The protein is GH11 family xylanase, and the structure of the protein is that of beta-jelly roll. The applicant screened the enzyme for a number of mutations by directed evolution techniques.

1.1 design of PCR primers H1-F1, H1-R1:

H1-F1：GGCGAATTCATGATGATTGGTATCACTTCTTTTGC (restriction enzyme EcoRI recognition site underlined);

H1-R1：ATAGCGGCCGCTTAACCGACGTCTGCAACGGTAATTC (restriction endonuclease NotI recognition site underlined).

H1 gene (SEQ ID NO: 1) is used as a template, the primers are used for carrying out PCR amplification by using a GeneMorph II random mutation PCR kit ((Bomeis)), PCR products are recovered by glue, EcoRI and NotI are connected with pET21a carriers which are cut by the same enzyme after enzyme cutting treatment, the products are transformed into escherichia coli BL21 (DE 3), the products are coated on an LB + Amp flat plate and are inversely cultured at 37 ℃, after transformants appear, toothpicks are used for selecting the products to a 96-well plate one by one, 150 mu l of LB + Amp culture medium containing 0.1mM IPTG is added into each well, the products are cultured at 37 ℃ and 220rpm for about 6H, supernatant is centrifuged, thalli is resuspended by using buffer solution, and freeze thawing and wall breaking are carried out repeatedly, thus obtaining the escherichia coli cell lysate containing xylanase.

Respectively taking out 30 mul of lysate to two new 96-well plates; adding 30 mu l of substrate into one 96-well plate, reacting at 37 ℃ for 30 min, measuring the generated reducing sugar by using a DNS method, adding 150 mu l of Coomassie brilliant blue solution into the other plate, standing for 10min, measuring the protein content by using a Coomassie brilliant blue (Bradford) combination method, and respectively calculating the enzyme activity level and the protein content of different mutagens. Finally, the applicant screened single-point mutants I37V, A59S, D63E, D104Y, T107M, T107K, N167G and D192E which can obviously improve the specific activity of the xylanase from more than twenty thousand transformants.

On the basis of the wild-type xylanase H1, the invention provides mutants containing single mutation sites of I37V, A59S, D63E, D104Y, T107M/K, N167G and D192E.

Example 3 expression of xylanase in Pichia pastoris

3.1 construction of expression vectors

The gene sequences of xylanase H1 and a mutant thereof are respectively optimized according to the codon preference of pichia pastoris, synthesized by Shanghai Czeri bioengineering GmbH, and two enzyme cutting sites of EcoRI and NotI are respectively added at the two ends of the 5 'and 3' of the synthetic sequence.

The synthetic xylanase H1 and its mutant were digested separately with EcoRI and NotI, ligated with the same digested pPIC-9K vector overnight at 16 ℃ and transformed into E.coli DH5a, spread on LB + Amp plates, inverted cultured at 37 ℃ and, after the transformants appeared, colony PCR (reaction system: single clone picked up from template, rTaqDNA polymerase 0.5. mu.l, 10 XBuffer 2.0. mu.L, dNTPs (2.5mM) 2.0. mu.L, 5 'AOX primer (10 mM) 0.5. mu.L, 3' AOX primer 0.5. mu.L, ddH primer ₂ O14.5 μ L, reaction procedure: pre-denaturation at 95 ℃ for 5min, 30 cycles: 94 ℃ 30sec, 55 ℃ 30sec, 72 ℃ 2min, 72 ℃ 10 min). And (5) verifying positive clones, and obtaining correct recombinant expression plasmids after sequencing verification.

3.2 construction of Pichia engineering Strain

3.2.1 Yeast competent preparation

YPD plate activation is carried out on a Pichia pastoris GS115 strain, the strain is cultured at 30 ℃ for 48 h, then the activated GS115 is inoculated to be monoclonal in 6 mL of YPD liquid culture medium, the strain is transferred to a bacteria liquid after being cultured at 30 ℃ for about 12 h, the strain liquid is cultured at 30 ℃ for about 5h at 220rpm, the density of the strain is detected by an ultraviolet spectrophotometer, after the OD600 value is in the range of 1.1-1.3, 4mL of the strain is respectively collected into a sterilized EP tube after being centrifuged at 4 ℃ and 9000rpm for 2min, the supernatant is lightly discarded, the residual supernatant is sucked by sterilized filter paper and then is re-suspended by 1mL of sterilized water, the strain is centrifuged at 4 ℃ and 9000rpm for 2min, the supernatant is re-suspended and re-suspended by 1mL of sterilized water, the supernatant is centrifuged at 4 ℃ and 9000rpm for 2min, and the pre-cooled 1mL of sorbitol (1 mol/L) strain is lightly discarded; centrifugation was carried out at 9000rpm for 2min at 4 ℃ and the supernatant was discarded, and the cells were gently resuspended in 100. mu.l of precooled sorbitol (1 mol/L).

3.2.2 transformation and selection

The recombinant expression plasmids obtained by 3.1 construction are linearized by Sac I, the linearized fragments are purified and recovered, and then are transformed into pichia pastoris GS115 by an electroporation method, pichia pastoris recombinant strains are obtained by screening on MD plates, and then multi-copy transformants are screened on YPD plates (0.5 mg/mL-8 mg/mL) containing different concentrations of geneticin.

The obtained transformants were transferred to BMGY medium, respectively, and shake-cultured at 30 ℃ and 250rpm for 1 day; then transferring the culture medium into a BMMY culture medium, and performing shaking culture at 30 ℃ and 250 rpm; adding 0.5% methanol every day to induce expression for 4 d; centrifuging at 9000rpm for 10min to remove thallus, and obtaining fermentation supernatant respectively containing xylanase H1 and xylanase mutant.

1. Xylanase enzyme activity determination method

(1) Definition of xylanase Activity units

The amount of enzyme required for the release of 1. mu. mol of reducing sugars by degradation per minute from a xylan solution having a concentration of 5mg/ml at a temperature of 50 ℃ and a pH of 8.0 is one unit of enzyme activity, expressed in U.

(2) Xylanase enzyme activity determination method

10.0 ml of xylan solution was aspirated and equilibrated at 50 ℃ for 20 min.

10.0 ml of the appropriately diluted enzyme solution was aspirated and equilibrated at 50 ℃ for 5 min.

Blank sample determination: 2.00 ml of the enzyme solution (equilibrated at 50 ℃) diluted appropriately is aspirated and added to a graduated tube, and 5ml of DNS reagent is added thereto, followed by electromagnetic oscillation for 3 seconds. Then 2.0 ml xylan solution was added, equilibrated at 50 ℃ for 30 min and heated in boiling water bath for 5 min. Cooling to room temperature by using tap water, adding water to a constant volume of 25 ml, and electromagnetically oscillating for 3-5 s. Measuring absorbance A at 540 nm with standard blank as blank _B 。

Sample assay: 2.00 ml of the enzyme solution (equilibrated at 50 ℃) diluted appropriately is taken, added into a graduated test tube, and then 2.0 ml of xylan solution (equilibrated at 50 ℃) is added, electromagnetically oscillated for 3 seconds, and the temperature is accurately preserved at 50 ℃ for 30 minutes. 5.0 ml of DNS reagent was added and the reaction was magnetically shaken for 3 seconds to stop the enzymatic reaction. Heating in boiling water bath for 5min, cooling to room temperature with tap water, adding water to desired volume of 25 ml, and electromagnetically oscillating for 3 s. Measuring absorbance A at 540 nm with standard blank as blank _E 。

XD=

。

In the formula:

XD-xylanase Activity in sample dilutions, U/ml;

AE represents the absorbance of the enzyme reaction solution;

AB — absorbance of enzyme blank;

k-the slope of the standard curve;

CO-intercept of the standard curve;

m — molar mass of xylose M (C5 XYN110O 5) = 150.2 g/mol;

t-enzymolysis reaction time, min;

n-dilution times of enzyme solution;

1000-conversion factor, 1 mmol = 1000 μmol.

(3) Measurement results

Enzyme activity detection is carried out according to the method, and the result shows that: the enzyme activity of the fermentation supernatant of the recombinant Pichia pastoris strain for recombinant expression of xylanase H1 and the mutant thereof obtained by the construction is 420-750U/mL.

2. Protein content determination method

The Coomassie brilliant blue (Bradford) binding method for determining protein content is a combined method of a colorimetric method and a pigment method. Coomassie Brilliant blue G-250 is reddish brown in acidic solution, turns blue when combined with protein, conforms to beer's law in a certain concentration range of protein, and can be measured colorimetrically at 595 nm. Absorbing a large amount of the active ingredients within 3-5 minutes, and stabilizing for at least 1 hour. Within the range of 10-1000 mug/mL, the light absorption value is in direct proportion to the protein concentration.

According to the volume ratio of the enzyme solution to the Coomassie brilliant blue solution of 1: 5, standing for 10mm, and measuring the protein content by Coomassie brilliant blue (Bradford) binding method

Protein content was determined as described above. The results show that: the protein content of the fermentation supernatant of the recombinant Pichia pastoris strain of the recombinant expression xylanase H1 and the mutant thereof obtained by the construction is 0.34-0.5 mg/mL.

3. Calculation of specific Activity

"Specific Activity" means: the number of units of enzyme activity per weight of protein is generally expressed as U/mg protein.

Specific activity calculation formula: specific activity (U/mg) = enzyme activity (U/mL)/protein content (mg/mL).

Specific results are shown in table 1.

TABLE 1 comparison of specific Activity of alkaline xylanase mutants

Xylanase and single-point mutant thereof	Specific activity (U/mg)
		Wild type H1	1223.00
I37V	1328.92
		A59S	1615.01
D63E	1395.12
		D104Y	1397.25
T107M	1319.89
		T107K	1379.92
N167G	1462.18
		D192E	1625.11

As can be seen from the results in Table 1, compared with the wild xylanase H1, the alkaline xylanase mutant provided by the invention has the specific activity which is generally improved by 8.5-32.8%; the alkaline xylanase mutant containing the D192E single-point mutation has the highest specific activity which reaches 1625.11U/mg, and obtains unexpected technical effects.

In conclusion, the specific activity of the alkaline xylanase mutant provided by the invention is obviously improved, so that the production cost of the alkaline xylanase mutant is reduced, and the alkaline xylanase mutant is promoted to be widely applied in the industrial field, especially the papermaking field.

Sequence listing

<110> Islands blue biological group Co Ltd

<120> high specific activity alkaline xylanase mutant

<160> 2

<170> SIPOSequenceListing 1.0

<210> 1

<211> 194

<212> PRT

<213> Paecilomyces (Paecilomyces. sp)

<400> 1

Gln Thr Thr Pro Asn Ser Glu Gly Trp His Asp Gly Tyr Tyr Tyr Ser

1 5 10 15

Trp Trp Ser Asp Gly Gly Ala Gln Ala Thr Tyr Thr Asn Leu Glu Gly

20 25 30

Gly Thr Tyr Glu Ile Ser Trp Gly Asp Gly Gly Asn Leu Val Gly Gly

35 40 45

Lys Gly Trp Asn Pro Gly Leu Asn Ala Arg Ala Ile His Phe Asp Gly

50 55 60

Val Tyr Gln Pro Asn Gly Asn Ser Tyr Leu Ala Val Tyr Gly Trp Thr

65 70 75 80

Arg Asn Pro Leu Val Glu Tyr Tyr Ile Val Glu Asn Phe Gly Thr Tyr

85 90 95

Asp Pro Ser Ser Asp Ala Thr Asp Leu Gly Thr Val Glu Cys Asp Gly

100 105 110

Ser Thr Tyr Arg Leu Gly Lys Ser Thr Arg Tyr Asn Ala Pro Ser Ile

115 120 125

Asp Gly Ile Gln Thr Phe Asp Gln Tyr Trp Ser Val Arg Gln Asn Lys

130 135 140

Arg Ser Ser Gly Thr Val Gln Thr Gly Cys His Phe Asp Ala Trp Ala

145 150 155 160

Arg Ala Gly Leu Asn Val Asn Gly Asp His Tyr Tyr Gln Ile Val Ala

165 170 175

Thr Glu Gly Tyr Phe Ser Ser Gly Tyr Ala Arg Ile Thr Val Ala Asp

180 185 190

Val Gly

<210> 2

<211> 585

<212> DNA

<213> Paecilomyces (Paecilomyces. sp)

<400> 2

caaaccactc caaactctga aggttggcat gacggttatt actactcttg gtggtctgac 60

ggtggagccc aggctacata caccaatttg gagggtggaa catacgaaat ctcttggggt 120

gacggaggaa acttggtcgg tggtaaggga tggaacccag gattgaatgc aagagccatt 180

cactttgatg gtgtctatca accaaacgga aactcttact tggcagttta cggttggaca 240

agaaacccat tggtcgagta ttacatcgtc gagaattttg gtacttatga cccttcttct 300

gatgctacag acttgggtac agtcgagtgc gatggatcta catatagatt gggaaagtct 360

accagataca acgcaccttc tatcgacgga atccaaacat tcgatcagta ttggtctgtt 420

agacaaaata agagatcctc tggaaccgtt caaacaggat gccacttcga cgcttgggcc 480

agagctggat tgaacgtcaa cggtgaccac tattatcaaa ttgttgccac tgagggttat 540

ttctcttctg gttatgccag aattaccgtt gcagacgtcg gttaa 585

Claims

1. A xylanase mutant, characterized in that the mutant comprises an amino acid sequence having at least 90% identity to SEQ ID No. 1 and comprises a substitution of an amino acid in at least one position selected from the group consisting of SEQ ID No. 1: 37, 59, 63, 104, 107, 167, 192.

2. The mutant of claim 1, wherein the amino acid sequence of the mutant has at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or at least 99% identity to SEQ ID No. 1.

3. The mutant of claim 1, wherein the amino acid sequence of the mutant has at least 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, or at least 99.9% identity to SEQ ID No. 1.

4. The mutant according to any one of claims 1 to 3, wherein the mutant comprises a substitution of at least one amino acid of the group consisting of: I37V, A59S, D63E, D104Y, T107M/K, N167G and D192E.

5. A DNA molecule encoding a xylanase mutant according to any one of claims 1-4.

6. A recombinant expression plasmid comprising the DNA molecule of claim 5.

7. A host cell comprising the recombinant expression plasmid of claim 6.

8. The host cell of claim 7, wherein the host cell is Pichia pastoris (Pichia pastoris) ((Pichia pastoris))Pichia pastoris) Or Trichoderma reesei (Trichoderma reesei）。

9. Use of a xylanase mutant according to any one of claims 1-4 in the field of papermaking.