CN115029277A

CN115029277A - Acid-resistant and bacterial wilt-resistant bacillus pseudomycoides

Info

Publication number: CN115029277A
Application number: CN202210723296.4A
Authority: CN
Inventors: 丁伟; 梁辉; 张淑婷; 江其朋; 邓力元; 江连强; 刘东阳; 王勇
Original assignee: SICHUAN TOBACCO Corp LIANGSHANZHOU BRANCH; Southwest University
Current assignee: SICHUAN TOBACCO Corp LIANGSHANZHOU BRANCH; Southwest University
Priority date: 2022-06-24
Filing date: 2022-06-24
Publication date: 2022-09-09
Anticipated expiration: 2042-06-24
Also published as: CN115029277B

Abstract

The invention relates to acid-resistant and bacterial wilt-resistant bacillus pseudomycoides DW44, which is named in classification: bacillus pseudomycoides, accession number: CCTCC NO: m2022676. The bacterial colony is white and round, has smooth and convex edge, is glossy, moist and semitransparent. The Bacillus pseudomycoides DW44 has good acid resistance, and has a growth rate higher than that of Ralstonia solanacearum at pH 4.5-6.0. The growth rate of the bacillus pseudofungoides DW44 at pH4.5 and the aluminum ion concentration of 2.4mmol/L is obviously higher than that of the ralstonia solanacearum, the diameters of inhibition zones for the ralstonia solanacearum are respectively 10.72mm, and the highest prevention effect on tobacco bacterial wilt in acid soil can reach 75.00 percent. Can be fully used for antagonizing ralstonia solanacearum in acidified soil and effectively preventing and treating the occurrence of tobacco bacterial wilt.

Description

Acid-resistant and bacterial wilt-resistant bacillus pseudomycoides

Technical Field

The invention belongs to the technical field of agricultural microbial control, and relates to an acid-resistant bacterial wilt-resistant bacillus pseudomycoides and application thereof.

Background

Soil acidification is a major cause of soil degradation worldwide, and is increasingly prominent and severe in intensive agricultural production models. Currently, soil acidification has become a serious global problem, and the sustainable development of modern agriculture is severely restricted. In recent decades, the main farmlands, grasslands and forests in China also have obvious soil acidification phenomena, the land affected by acidification is about 2 hundred million hectares and occupies about 23 percent of the total area of the land in China, and the land is mainly distributed in the south of the Yangtze river to seriously affect the agricultural production in the south of China. Internationally, soil acidification is usually rated as follows: slightly acidic (pH 6.0-6.5), moderately acidic (pH 5.5-6.0), strongly acidic (pH 5.0-5.5), very strongly acidic (pH 4.5-5.0), and very acidic (pH < 4.5). When the pH of the soil is lower than 5.5, active aluminum ions in the soil begin to be dissolved and released from the soil, and particularly when the pH of the soil is lower than 5.0, the content of the aluminum ions in the soil rises exponentially, and the normal healthy growth of plants is influenced.

Bacterial wilt is a typical soil-borne disease caused by Ralstonia solanacearum, and can cause destructive loss to various economic crops such as tomatoes, peppers and the like besides tobaccos. According to field data investigation, the strong-acid soil can aggravate the occurrence of tobacco bacterial wilt, the tobacco bacterial wilt is closely related to the community composition of soil microorganisms, and the activity and community structure of the soil microorganisms can be strongly influenced by the change of the pH value of the soil. However, the pathogenesis of the tobacco bacterial wilt under different acidification levels is not systematically researched, and the mechanism of influencing the tobacco bacterial wilt by soil acidification and aluminum ions is not systematically and deeply researched. Therefore, the research system evaluates the influence of different soil acidification levels on the occurrence of the tobacco bacterial wilt, explores the community characteristics of rhizosphere soil microorganisms under different acidification levels, and analyzes the relationship between the change of the rhizosphere microorganisms and the occurrence of the tobacco bacterial wilt; and then, the relation between aluminum ions and the occurrence of the tobacco bacterial wilt and the influence of different aluminum stress levels in the soil on the composition of tobacco bacterial communities are explored so as to break down the mechanism that the different acidification levels influence the occurrence of the tobacco bacterial wilt.

Disclosure of Invention

In view of the above, the present invention aims to provide an acid-resistant bacterial wilt-resistant bacillus pseudomycoides strain, and also provides the relevant agricultural industrial applications of the strain.

In order to achieve the purpose, the invention provides the following technical scheme:

1. acid-resistant and bacterial wilt-resistant bacillus pseudomycoides, wherein the bacillus pseudomycoides is DW44 and is classified and named as follows: bacillus pseudomycoides, deposited in China center for type culture Collection, address: wuhan, date of preservation: 2022, 5/19, accession No.: CCTCC NO: m2022676.

Furthermore, the colony of the pseudomycosis fungoides is white and round, and has smooth and convex edges, luster, wetness and translucency.

Further, the growth rate of the pseudomycoides bacillus is higher than that of the ralstonia solanacearum at the pH value of 4.5-6.0, and the pseudomycoides bacillus has acid resistance.

2. The application of the bacillus pseudomycoides in any one of the technical schemes as a microbial agent in antagonism and/or prevention and control of ralstonia solanacearum.

Further, the soil environment in use is an acid soil of pH4.5 to pH 6.0.

Further, the concentration of Bacillus pseudomycoides used in the microbial agent was 1X 10 ⁶ cfu/mL-1×10 ¹² cfu/mL。

Further, the concentration of Bacillus pseudomycoides used in the microbial agent is 1X 10 ⁸ cfu/mL。

3. The application of the bacillus pseudomycoides in any one of the above technical schemes as a microbial agent for promoting the growth of tobacco plant plants.

4. Also provides a microbial agent, the active component of the microbial agent comprises bacillus pseudomycoides DW 44.

Further, in the microbial agent, Bacillus pseudomycoides is cultured as DW44 to obtain a bacterial suspension which is a liquid microbial agent.

The invention has the beneficial effects that: the invention separates 110 strains from tobacco rhizosphere soil under the condition of high aluminum stress, extracts and separates bacteria DNA for sequencing, analyzes the bacterial community composition of the tobacco rhizosphere soil in combination with the early stage, finally selects 7 strains of aluminum-resistant bacillus, further evaluates the aluminum-resistant and acid-resistant activities of the 7 strains and the antagonistic activity of ralstonia solanacearum, and the research on the control effect of the tobacco bacterial wilt is carried out, two strains which have strong acid resistance and aluminum resistance activity and good control effect on the tobacco bacterial wilt, namely the pseudomycosis fungoides DW44 and the Bacillus paniculata DW68 are screened, the growth rate of the two strains at the pH value of 4.5-6.0 and the aluminum ion concentration of 2.4mmol/L is obviously higher than that of the ralstonia solanacearum, the diameters of the inhibition zones for the Ralstonia solanacearum are respectively 10.72mm and 13.12mm, the highest control efficiency on tobacco bacterial wilt in acid soil can reach 75.00 percent and 83.33 percent respectively. The Bacillus pseudomycoides DW44 and the Bacillus panacirerae DW68 bacterial strains can effectively proliferate in an acidification environment, and provide a new biological material for improving the biological prevention and control effect in acid soil; it also has growth promoting effect on tobacco. The invention also screens an aluminum-resistant strain of Bacillus pseudomycoides DW105, which has significant growth promotion effect on tobacco growth and certain tobacco bacterial wilt prevention effect, and compared with blank control, the fresh weight, the dry weight and the dry weight of the root of tobacco processed by the strain DW105 are respectively increased by 128.36%, 83.42%, 136.77% and 97.90%. The composite microbial inoculum prepared by the community synthesized by the three strains can be used cooperatively, so that the synthesized community has the comprehensive characteristics of acid resistance, aluminum resistance, disease resistance and growth promotion, and a new thought is provided for the prevention and treatment of the bacterial wilt of the acid soil and/or the growth of tobacco plants.

Preservation information

The strain name: DW44, classification name: bacillus pseudomycoides, deposited in China center for type culture Collection, address: wuhan, date of preservation: 2022, 5/19, accession No.: CCTCC NO: m2022676.

The strain name: DW68, classification nomenclature: bacillus panacitreae, deposited in the chinese collection of cultures, address: wuhan, preservation date: 2022, 5/19, accession No.: CCTCC NO: m2022677.

The strain name: DW105, class name: bacillus pseudomycoides, deposited in China center for type culture Collection, address: wuhan, date of preservation: 2022, 5/19, accession No.: CCTCC NO: m2022678.

Drawings

In order to make the object, technical scheme and beneficial effect of the invention more clear, the invention provides the following drawings for explanation:

FIG. 1 is a schematic view of the experimental process.

FIG. 2 shows the effect of different aluminum ion concentrations on the occurrence of tobacco bacterial wilt.

FIG. 3 shows the incidence of bacterial wilt disease under different aluminum ion concentration treatments.

FIG. 4 shows the content of ralstonia solanacearum in tobacco rhizosphere soil treated with different concentrations of aluminum ions.

FIG. 5 shows the effect of each Bacillus on the growth of Ralstonia solanacearum.

FIG. 6 shows the aluminum resistance activity of each of the isolated Bacillus strains.

FIG. 7 is an acid tolerance of each of the isolated Bacillus strains.

FIG. 8 is a graph showing the growth promoting ability of each isolated Bacillus strain on tobacco.

FIG. 9 shows the effect of the isolated Bacillus strains on the occurrence of tobacco bacterial wilt.

FIG. 10 shows a 16S rDNA clade of each strain.

FIG. 11 shows the colony morphology and the cell morphology of the A44 strain.

FIG. 12 shows the colony morphology and the cell morphology of the A68 strain.

FIG. 13 shows the colony morphology and the cell morphology of the A105 strain.

Detailed Description

Preferred embodiments of the present invention will be described in detail below with reference to the accompanying drawings. The experimental procedures, in which specific conditions are not specified in the examples, are generally carried out under conventional conditions or under conditions recommended by the manufacturers.

Example 1

1. The soil to be tested is collected from Pengshuimian soil family of Chongqing city in 5 months in 2019, is continuously planted in Runxi county cherry pit (longitude: 107 degrees 57.913 ', latitude: 29 degrees 10.008', altitude: 1315m) for more than 5 years, and does not have bacterial wilt, and the soil type is silt loam. The method comprises the steps of collecting soil of a 10-20 cm soil layer, filtering a soil sample through a 2mm screen to remove large soil particles, plant root tissues and other impurities, and storing the sieved soil in a refrigerator at 4 ℃ for subsequent tests.

2. Test strains and tobacco varieties: the test used a CQPS-1 Ralstonia solanacearum (R.solanacearum) strain isolated from a Pectinophora ginko in Pengshui, Chongqing, which is a highly pathogenic strain. The tobacco tested was Nicotiana benthamiana.

3. Test medium:

S-LB medium: for the separation culture of the strain, 0.5g/L of peptone, 0.2g/L of yeast powder and 10g/L of sodium chloride are added into soil leaching liquor with the pH of 7.0, the pH is adjusted to 4.5, and the mixture is sterilized for later use.

Preparing a soil leaching solution: 200g of neutral soil collected in a plant protection garden of southwest university is added into 1000mL of distilled water, shaken for 30min at 150rpm, centrifuged for 10min at 10000rpm, and the supernatant is filtered through a 0.45-micron filter membrane.

B, liquid culture medium: 10g/L of bacterial peptone, 1g/L of yeast powder and 1g/L of casein hydrolysate, and sterilizing at 121 ℃ for 20min for later use.

B, solid culture medium: 10g/L of bactopeptone, 1g/L of yeast powder, 1g/L of casein hydrolysate and 15g/L of agar powder, and sterilizing at 121 ℃ for 20min for later use.

Averagely dividing the collected Penghua tobacco-planting healthy soil into 4 parts, adding 1L of 2.5mmol/L, 5mmol/L and 10mmol/L aluminum sulfate solutions into 10kg of each part respectively to enable the aluminum ion concentration of the soil to be LAl of low aluminum ion concentration, MAL of medium aluminum ion concentration and HAl of high aluminum ion concentration, taking 30mmol/L sodium sulfate solution as a reference, keeping the water holding capacity of the soil to be about 60% by adding deionized water, treating every other month once, and after continuous treatment is carried out for 6 times, taking 500g of soil for air drying and storing in each treatment for soil physical and chemical property detection.

Transplanting cleaned root matrix of Benshi tobacco cultured in seedling tray for 1 month into the treated soil, repeating for 4 times and 8 tobacco plants, placing in greenhouse at 25 + -2 deg.C, humidity of 75%, lighting for 14h, and culturing in dark for 10 h. After 14 days of culture, removing tobacco plants, taking rhizosphere soil of the tobacco plants, repeating the treatment for 4 times, storing the collected soil at-20 ℃ until the soil is used for extracting soil microorganism DNA, and detecting the content of ralstonia solanacearum in the soil.

Transplanting tobacco seedlings in the residual soil, processing for 3 times, repeating for 8 tobacco plants, inoculating 10mL of tobacco plants after 7 days, and inoculating 1 × 10 tobacco plants ⁸ CFU/mL of ralstonia solanacearum, and the occurrence of the bacterial wilt of the tobacco treated differently after 14 days. The experimental treatment flow is shown in fig. 1. The influence of different aluminum ion concentrations on the occurrence of tobacco bacterial wilt is shown in figure 2, and the high aluminum stress has no significant influence on the growth of tobaccoThe highest incidence of bacterial wilt in tobacco treated with medium aluminum concentration stress (MAl), significantly higher than other treatments, increased the incidence of bacterial wilt by 69.80%, 77.95% and 52.15%, respectively, compared to control, LAl and hai (shown in fig. 3). Consistent with the incidence change rule of bacterial wilt, the content of ralstonia solanacearum in the tobacco rhizosphere soil treated by MAL is obviously higher than that of a control (P)<0.001), LAl (P ═ 0.0005) and hai (P)<0.001), the average content of ralstonia solanacearum in the root soil of MAl-treated tobacco was 1.15 times, 1.11 times and 1.14 times that of control, LAl and hai, respectively (fig. 4).

Collecting rhizosphere soil of healthy tobacco plants planted in HAl treatment soil, and storing at a low temperature of 4 ℃ until the strain separation is completed. Adding 1g rhizosphere soil into 50mL S-LB liquid culture medium to prepare suspension, adding 0.5mL 0.1mol/L aluminum sulfate mother liquor to make the final concentration 1mmol/L, shaking and culturing at 180rpm and 28 ℃ for 12h, standing for 30min, taking 1mL of bacteria-containing supernatant, and diluting to 10mL ^-3 、10 ^-4 Coating the mixture on a B solid culture medium containing aluminum sulfate with the final concentration of 1mmol/L, and culturing at 28 ℃ for 3-7 days until obvious colony formation occurs. Selecting single colony, separating and purifying by plate streaking method, and preserving the separated strain in 25% glycerol at-80 deg.C after 4 times of separation streaking.

Separating 110 strains from healthy tobacco strain rhizosphere soil subjected to high-aluminum stress treatment, extracting and separating bacterial DNA by using a bacterial genome extraction kit, amplifying bacterial 16S rRNA genes by using 27F (AGAGTTTGATCCTGGCTCAG) and 1492R (CTACGGCTACTTGCGA), and performing PCR amplification for 5min at 94 ℃; denaturation at 94 deg.C for 1min, annealing at 51 deg.C for 1min, extension at 72 deg.C for 3min, and 30 cycles; extension for 10min at 72 ℃. The PCR product was sent to Huada Gene sequencing company for sequencing. The sequencing results were compared for homology to sequences in the GenBank database using BLAST software. In the early stage, the analysis on the bacterial community composition of the rhizosphere soil of the tobacco plant discovers that the bacillus plays an important role in controlling the occurrence of the tobacco bacterial wilt and is obviously enriched in the tobacco rhizosphere soil with high aluminum stress.

Example 2 molecular characterization of isolated strains

Selecting a 16S rRNA gene sequence of a related strain, adopting MEGA4.0 software to carry out phylogenetic relationship analysis, and constructing a phylogenetic tree according to a Neighbor-join method.

Amplifying a 16SrDNA fragment by using genome DNA of a strain separated from a rhizosphere soil sample of a healthy tobacco strain treated by high aluminum concentration as a template, sequencing the amplified PCR fragment, performing Blast comparison on the sequencing result and sequences in GenBank in NCBI to obtain 7 strains of bacillus with different colony morphologies, wherein the comparison result is shown in Table 1, the 16S rDNA sequence comparison homology of A44, A68 and A73 reaches 100%, the homology of A64 reaches 99.72%, the homology of A75, A97 and A105 reaches 99.93%, and the 16S rDNA sequence comparison homology of all strains reaches more than 99%. Combined with phylogenetic tree analysis fig. 10, finally a44, a64, a97 and a105 were identified as Bacillus pseudomycoides (Bacillus pseudomycoides), a68 as Bacillus paniculatus, a73 as Bacillus proteoliticus, a75 as Bacillus mycoides (Bacillus mycoides).

TABLE 1 alignment of the 16S rDNA sequences of the isolates

FIG. 11 shows colony morphology and cell morphology of strain A44, and on solid B medium, the colony of strain A44 is white, round, glossy, moist and translucent. The scanning electron microscope observation shows that the A44 strain is short rod-shaped, has flagella and is gram-positive.

FIG. 12 shows the colony morphology and cell morphology of the A68 strain, and it can be seen from FIG. 12 that the colony of the A68 strain on the solid B medium is white, round, glossy, moist, and opaque with smooth and convex edges. The scanning electron microscope observation shows that the A68 strain is thin rod-shaped, has flagella and is gram-positive.

FIG. 13 shows the colony morphology and cell morphology of the A105 strain, and it can be seen from FIG. 13 that the colony of the A105 strain appears white, round, flat, smooth and glossy with smooth edges, moist and opaque on the solid B medium. The scanning electron microscope observation shows that the A105 strain is in a thin rod shape, has flagella and is gram-positive.

Strain a44 was named DW44, taxonomic nomenclature: bacillus pseudomycoides, deposited in China center for type culture Collection, address: wuhan, preservation date: 2022, 5/19, accession No.: CCTCC NO: m2022676.

Strain a68 was named DW68, taxonomic nomenclature: bacillus panacitreae, deposited in the chinese collection of cultures, address: wuhan, date of preservation: 2022, 5/19, accession No.: CCTCC NO: m2022677.

Strain a105 was named DW105, taxonomic nomenclature: bacillus pseudomycoides, deposited in China center for type culture Collection, address: wuhan, preservation date: 2022, 5/19, accession No.: CCTCC NO: m2022678.

Example 3 Effect of Bacillus strains on the inhibition of the growth of Ralstonia solanacearum

The influence of the aluminum-resistant bacillus on the growth inhibition of ralstonia solanacearum is evaluated by adopting a plate antagonism method: diluting Ralstonia solanacearum to 1 × 10 ⁷ And (3) CFU/mL, uniformly coating 200 mu L of the mixture on a B solid culture medium plate, dripping 2 mu L of different bacillus bacteria in the center of the plate, taking sterile water as a negative control, taking 0.5mg/mL Gentamicin (GM) as a positive control, repeating the treatment for 3 times, culturing the plate in a 30 ℃ constant temperature incubator for 24 hours, and observing the sizes of inhibition zones of different treatments.

The results of analyzing the influence of the bacillus on the growth of ralstonia solanacearum by using a plate antagonism method are shown in table 2 and fig. 5, and the results show that the separated 7 strains of bacillus have certain inhibition effect on the growth of ralstonia solanacearum, the diameter of the inhibition zone of the A73 strain is the largest and is 16.24mm, the A68 strain (13.12mm) is arranged next, and the diameter of the inhibition zone is obviously higher than that of the A44, the A64, the A75 and the A105 strains.

TABLE 2 bacteriostatic effect of Bacillus on Ralstonia solanacearum CQPS-1

Example 4 evaluation of aluminum-resistant Activity and acid-resistant Activity of Bacillus

Respectively adding Bacillus strain and Ralstonia solanacearum CQPS-1 strain into liquid culture medium containing aluminum sulfate with final concentration of 1.2mmol/L and sodium sulfate B with final concentration of 3.6mmol/L, treating with sterile water as negative control, repeating each treatment for 3 times, shake culturing at 30 deg.C and 180rpm, taking 1mL of mixed bacterial liquid every 2h to detect OD _600nm And (5) detecting the absorbance value for 24 hours, and drawing growth curves of different strains under different aluminum concentrations.

The aluminum-resistant activity of the different isolated bacillus strains is shown in fig. 6 and table 3, and the time for the isolated bacillus to enter the log phase is earlier than that of the ralstonia solanacearum in both clear water Control 1(Control 1) and sodium sulfate Control 2(Control 2), which indicates that the adaptation period of the isolated bacillus in the culture medium is earlier than that of the ralstonia solanacearum. In 2.4mmol/L aluminum ion treatment (2.4mmol/L Al) ³⁺ ) The growth of ralstonia solanacearum is obviously inhibited, the aluminum resistance of the separated bacillus is stronger than that of ralstonia solanacearum, wherein the aluminum resistance of the A73 strain is strongest, and the A64 strain and the A105 strain are the second strain, and the A68 times.

TABLE 3 aluminium resistance Activity of different strains in liquid B Medium for 24h

Adjusting pH of the liquid culture medium B to 4.5, 5.0 and 6.0 with hydrochloric acid, sterilizing, inoculating separated Bacillus strain and Ralstonia solanacearum CQPS-1 strain, repeating each treatment for 3 times, shake culturing at 30 deg.C and 180rpm, taking 1mL of mixed bacteria liquid every 2h to detect OD _600nm And (5) detecting the absorbance value for 24 hours, and drawing growth curves of different strains under different pH values.

Acid resistance of the different bacillus strains isolated as shown in fig. 7 and table 4, the growth rates of a44, a64, a73 and a75 were faster than ralstonia solanacearum under the condition of pH6.0, the growth rates of a97 were consistent, and the time for a68 to enter log phase was 4 hours later than ralstonia solanacearum; under the condition of pH5.0, the growth rate of the bacillus is faster than that of the ralstonia solanacearum, and the final biomass strains A68 and A73 have no significant difference from the ralstonia solanacearum; under the condition of pH4.5, except that the growth of the A73 bacterium is completely inhibited, the acid resistance of the A73 bacterium is the worst, and the growth rate of other spore strains under the environment of pH4.5 is obviously higher than that of the ralstonia solanacearum, so that the spore strains have certain acid resistance. The pH value of acidified soil is 5.0-5.5, and the selected strain can survive under the condition of pH value of 4.5-6.0, can colonize in acidified soil and can exert biological effect.

TABLE 4 acid-resistant Activity of different strains in liquid B Medium for 24h

Example 5 Effect of Bacillus strains on tobacco growth

Cleaning tobacco seedling 87 cultured in seedling substrate for 30 days with deionized water, transplanting into soil without bacterial wilt, illuminating at 25 + -2 deg.C for 12 hr, and culturing at 20 + -2 deg.C in dark for 12 hr under 75% humidity in greenhouse condition, and inoculating into 10mL of 1 × 10 tobacco seedling after one week ⁸ cfu/mL, continuously culturing for 14 days, cleaning soil at the root, sucking water by using absorbent paper, respectively detecting the root fresh weight and the root upper fresh weight of the tobacco plants subjected to different treatments, drying for 6 hours in a constant-temperature drying oven at 105 ℃, and weighing the root dry weight and the root upper dry weight of the tobacco plants subjected to different treatments.

Adding an isolated bacillus strain exogenously into soil, and evaluating whether the isolated bacillus strain has growth promotion effect on the growth of tobacco, wherein the results are shown in table 5 and fig. 8, and the results show that the A105 bacterium can obviously increase the root fresh weight (A in fig. 8) and the dry weight (C in fig. 8) and the root upper fresh weight (B in fig. 8) and the dry weight (D in fig. 8) of the tobacco compared with a control; the A64 bacterium remarkably increases the fresh weight and dry weight of the upper root part of the tobacco and the dry weight of the root; bacterium a68 significantly increased root dry weight. Comprehensive evaluation shows that the A105 bacterium can obviously promote the growth of tobacco. The fresh root weight, fresh upper root weight, dry root weight and dry upper root weight of tobacco treated with strain a105 were increased by 128.36%, 83.42%, 136.77% and 97.90%, respectively, compared to the blank control.

TABLE 5 plant biomass after each treatment

Example 6 Effect of Bacillus strains on the occurrence of tobacco bacterial wilt disease

Picking a single colony of bacillus activated on a solid B culture medium, inoculating the single colony into 20mL of sterile liquid B culture medium, and performing shake culture on a constant-temperature shaking table at 30 ℃ and 180rpm until OD _600nm ＝1.0(1×10 ⁹ CFU/mL) for use.

Cleaning tobacco seedling 87 cultured in seedling substrate for 30 days with deionized water, transplanting into soil (pH 5.68) without bacterial wilt, illuminating at 25 + -2 deg.C for 12h, dark at 20 + -2 deg.C for 12h, and culturing at 75% humidity in greenhouse, and inoculating 10mL OD after one week _600nm ＝0.1(1×10 ⁸ CFU/mL), 3 replicates per treatment, 7 tobacco per replicate, and after 24h 10mL OD was inoculated to each tobacco separately _600nm ＝0.01(1×10 ⁷ CFU/mL), then placing the bacterial suspension in a greenhouse with the temperature of 30 +/-2 ℃ for 12h in light, the temperature of 25 +/-2 ℃ for 12h in dark and the humidity of 80% for continuous culture, investigating the disease condition of bacterial wilt every day, and recording the disease grade investigation, disease index and disease incidence.

Disease investigation is carried out according to the disease classification standard of the indoor tobacco bacterial wilt:

level 0: the tobacco plant has no disease symptoms;

level 1: 1-2 leaf wilting of the tobacco plant, or the chlorosis strip spots at the stem base of the tobacco plant account for less than 1/3 of the whole plant;

and 2, stage: 2-3 leaf wilting of the tobacco plant, or the chlorosis strip spots at the stem base of the tobacco plant account for 1/3-1/2 of the whole plant;

and 3, level: 1-2 healthy leaves of the tobacco plant or the chlorotic streak at the stem base of the tobacco plant accounts for 1/2-2/3 of the whole plant;

4, level: the wilting of the whole plant is withered, or the chlorosis of the base of the stem of the tobacco plant is more than 2/3 of the whole plant.

The severity of the disease is classified according to the disease condition to calculate the disease index, and the disease incidence is calculated according to the number of the plants with the disease, and the formula is as follows:

table 6 shows the incidence of tobacco bacterial wilt by each strain, table 7 shows the disease index of each strain for tobacco bacterial wilt, and the effect of different bacillus strains on tobacco bacterial wilt is shown in fig. 9, wherein the left graph shows the incidence and the right graph shows the disease index. Research results show that the A68 bacteria and the A44 bacteria can obviously delay the occurrence of tobacco bacterial wilt, the A68 bacteria begin to attack on the 25 th day after inoculation, and compared with a control, the occurrence of the bacterial wilt is delayed by 12 days; the onset of A44 was delayed by 13 days compared to the control bacterial wilt disease onset at day 26. The A68 bacterium has the best prevention and control effect on tobacco bacterial wilt, and the A44 bacterium has the following detection result that the morbidity of the tobacco bacterial wilt of the A68 bacterium and the A44 bacterium is 6.67 percent and 10.00 percent respectively when the detection result is 40 days, and the relative prevention effect is 83.33 percent and 75.00 percent respectively. The A105 strain can promote the growth of tobacco, has a slightly weaker control effect on tobacco bacterial wilt compared with the A68 strain and the A44 strain, can be independently used as a biological microbial inoculum for promoting the growth of tobacco, and can also be used as a compound microbial inoculum with other strains with an inhibiting effect on bacterial wilt for promoting the growth of tobacco and protecting the tobacco bacterial wilt.

TABLE 6 incidence of bacterial wilt of tobacco by each strain

Table 7 shows the disease index of each strain for the occurrence of tobacco bacterial wilt

The acid-resistant and aluminum-resistant Bacillus separated by the invention mainly comprises four types of pseudomycosis fungoides (Bacillus pseudomycoides), Bacillus panaciterrae, Bacillus proteoliticus and Bacillus mycosis fungoides (Bacillus mycoides), and researches show that the pseudomycosis fungoides can activate combined potassium in soil and can be used as a potassium-dissolving bio-fertilizer, and meanwhile, the pseudomycosis fungoides and a mica fertilizer are mixed and applied to replace a potassium chloride fertilizer to improve the effectiveness of potassium in the soil and increase the absorption of potassium elements by plants. In addition, research also shows that the bacillus pseudomycoides (B. pseudomycoides C6) can effectively remove copper ions in water and prevent a large amount of copper from entering plants to cause copper poisoning. The identified Bacillus pseudomycoides A105(Bacillus pseudomycoides A105) strain screened by the invention has growth promoting effect on tobacco, and is possibly related to promoting the absorption of potassium in tobacco plants. In addition to the pro-growth effect, it was also found that Bacillus pseudomycoides DSM 12442 has a gene cluster for the synthesis of the antibiotic lantibiotic and that the production of an antibacterial substance with activity against gram-positive bacteria, identified as a lantibiotic peptide, can be detected in cell wash extracts of this strain. The pseudomycosis fungoides strain which is researched, separated and identified by the invention is found to have a certain antagonistic effect on bacterial wilt for the first time, and the pseudomycosis fungoides A44 strain has a good control effect on tobacco bacterial wilt and strong acid resistance and aluminum resistance, and can be used as biocontrol bacteria for tobacco bacterial wilt for intensive research.

Although the growth rate of the Bacillus panacilerae A68 strain researched and analyzed by the invention is slower than that of other Bacillus strains under acidic (pH 4.5) and aluminum stress conditions, the Bacillus panacilerae A68 strain shows good control effect on tobacco bacterial wilt. Research shows that Bacillus proteoliticus GT2 has the function of dissolving phosphorus and can promote the growth of rice.

The development of high-throughput sequencing technology provides a solution for the research of interaction between plants and soil microorganisms, community composition of the soil microorganisms can be preliminarily determined according to sequencing data, but community composition of microorganisms achieved by high-throughput sequencing is a relative result, and in order to verify functions of the microorganisms, functional communities need to be separated, and the functions of the microorganisms need to be verified through interaction with the plants. In Liu Y.X., Qin Y., Bai Y.Reduciton synthetic community in microbial research [ J ] Current Opinion in Microbiology,2019,49:97-102, it is shown that synthetic community (SynCom) methods can functionally and mechanistically gain insight into how plants regulate their microbial communities and how microbial communities in turn affect plant growth and health, and the reproducibility of synthetic communities makes future establishment and functional studies of bacterial communities possible under laboratory conditions. Berendsen et al (Berendsen R.L., Vismans G., Yu K., Song Y., de Joger R., Burgman W.P., Burmolle M., Herschen J., Bakker Pahm, Pietes C.M.J.disease-induced analysis of a plant-bacterial consortium [ J ] ISME Journal,2018,12(6):1496-1507.) study found that isolated beneficial microorganisms, individual strains had no significant effect on the growth of plants and the number of pathogenic bacteria, and that when three strains having synergistic effects were mixed, the number of pathogenic bacteria in plants was significantly reduced, and plants showed significant growth promotion. Similarly, Lee et al (Lee S.M., Kong H.G., Song G.C., Ryu C.M.Dispersion of fungi and Actinobacillus absentogene in tomato rhizosphere use of the inhibition of bacterial wilt [ J ] ISME Journal,2020,15(1): 330-. In conclusion, the invention researches and screens 7 strains of Bacillus, particularly strains of Bacillus pseudomycoides A44(Bacillus pseudomycoides A44) and Bacillus paniculatus A68 which have strong acid-resistant and aluminum-resistant activities and good control effects on tobacco bacterial wilt, and a strain of aluminium-resistant strains of Bacillus pseudomycoides (Bacillus pseudomycoides A105) which have growth promoting effects on tobacco growth, and can synthesize communities according to the characteristics of the strains to prepare the composite microbial inoculum for use, so that the synthesized communities have comprehensive characteristics of acid resistance, aluminum resistance, disease resistance and growth promotion, and a new idea is provided for control of acid soil bacterial wilt and/or growth of tobacco plants.

Finally, it is noted that the above-mentioned preferred embodiments illustrate rather than limit the invention, and that, while the invention has been described in detail with reference to the above-mentioned preferred embodiments, it will be understood by those skilled in the art that various changes in form and detail may be made therein without departing from the scope of the invention as defined by the appended claims.

Claims

1. The acid-resistant and bacterial wilt-resistant bacillus pseudomycoides is DW44 and is classified and named as follows: bacillus pseudomycoides, deposited in China center for type culture Collection, address: wuhan, date of preservation: 2022, 5/19, accession No.: CCTCC NO: m2022676.

2. The Bacillus pseudomycoides of claim 1, wherein said Bacillus pseudomycoides colony is white, round, glossy, moist, translucent with smooth and raised edges.

3. The Bacillus pseudomycoides according to claim 1, wherein said Bacillus pseudomycoides has a higher growth rate than Ralstonia solanacearum at pH4.5-6.0 and is acid-tolerant.

4. Use of the Bacillus pseudomycoides of any one of claims 1 to 3 as a microbial agent for antagonism and/or control of Ralstonia solanacearum.

5. The use according to claim 4, characterized in that the soil environment in the use is acid soil of pH4.5-pH 6.0.

6. The use of claim 4, wherein the microbial agent comprises Bacillus pseudomycoides at a concentration of 1 x 10 ⁶ cfu/mL-1×10 ¹² cfu/mL。

7. The use of claim 4, wherein the microbial agent comprises Bacillus pseudomycoides at a concentration of 1 x 10 ⁸ cfu/mL。

8. Use of the Bacillus pseudomycoides of any one of claims 1-3 as a microbial agent for promoting growth of tobacco plants.

9. A microbial agent, characterized in that an active ingredient of the microbial agent comprises the Bacillus pseudomycoides of any one of claims 1-3.

10. The microbial agent according to claim 9, wherein the Bacillus pseudomycoides of any one of claims 1-3 is cultured to obtain a bacterial suspension, and the bacterial suspension is a liquid microbial agent.