CN114875016B - Formulated carrier suitable for pseudomonas fluorescens and microbial inoculum thereof - Google Patents
Formulated carrier suitable for pseudomonas fluorescens and microbial inoculum thereof Download PDFInfo
- Publication number
- CN114875016B CN114875016B CN202210491642.0A CN202210491642A CN114875016B CN 114875016 B CN114875016 B CN 114875016B CN 202210491642 A CN202210491642 A CN 202210491642A CN 114875016 B CN114875016 B CN 114875016B
- Authority
- CN
- China
- Prior art keywords
- lsw
- bacterial
- pseudomonas fluorescens
- carrier
- tobacco
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N11/00—Carrier-bound or immobilised enzymes; Carrier-bound or immobilised microbial cells; Preparation thereof
- C12N11/02—Enzymes or microbial cells immobilised on or in an organic carrier
- C12N11/04—Enzymes or microbial cells immobilised on or in an organic carrier entrapped within the carrier, e.g. gel or hollow fibres
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01G—HORTICULTURE; CULTIVATION OF VEGETABLES, FLOWERS, RICE, FRUIT, VINES, HOPS OR SEAWEED; FORESTRY; WATERING
- A01G13/00—Protecting plants
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01N—PRESERVATION OF BODIES OF HUMANS OR ANIMALS OR PLANTS OR PARTS THEREOF; BIOCIDES, e.g. AS DISINFECTANTS, AS PESTICIDES OR AS HERBICIDES; PEST REPELLANTS OR ATTRACTANTS; PLANT GROWTH REGULATORS
- A01N25/00—Biocides, pest repellants or attractants, or plant growth regulators, characterised by their forms, or by their non-active ingredients or by their methods of application, e.g. seed treatment or sequential application; Substances for reducing the noxious effect of the active ingredients to organisms other than pests
- A01N25/08—Biocides, pest repellants or attractants, or plant growth regulators, characterised by their forms, or by their non-active ingredients or by their methods of application, e.g. seed treatment or sequential application; Substances for reducing the noxious effect of the active ingredients to organisms other than pests containing solids as carriers or diluents
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01N—PRESERVATION OF BODIES OF HUMANS OR ANIMALS OR PLANTS OR PARTS THEREOF; BIOCIDES, e.g. AS DISINFECTANTS, AS PESTICIDES OR AS HERBICIDES; PEST REPELLANTS OR ATTRACTANTS; PLANT GROWTH REGULATORS
- A01N63/00—Biocides, pest repellants or attractants, or plant growth regulators containing microorganisms, viruses, microbial fungi, animals or substances produced by, or obtained from, microorganisms, viruses, microbial fungi or animals, e.g. enzymes or fermentates
- A01N63/20—Bacteria; Substances produced thereby or obtained therefrom
- A01N63/27—Pseudomonas
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/20—Bacteria; Culture media therefor
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02W—CLIMATE CHANGE MITIGATION TECHNOLOGIES RELATED TO WASTEWATER TREATMENT OR WASTE MANAGEMENT
- Y02W30/00—Technologies for solid waste management
- Y02W30/40—Bio-organic fraction processing; Production of fertilisers from the organic fraction of waste or refuse
Abstract
Based on separation and obtaining of pseudomonas fluorescens LSW-4 with tobacco bacterial wilt resistance, the invention further researches and develops a preparation carrier suitable for the pseudomonas fluorescens, wherein the carrier is bran, straw powder or diatomite. The microbial agent culture medium obtained by compounding the carrier can prepare the solid microbial agent with high viable count and long storage time from the pseudomonas fluorescens LSW-4, solves the problems of transportation and storage of the pseudomonas fluorescens LSW-4, has a simple method for preparing the solid microbial agent, is convenient for further industrialization application of the separated pseudomonas fluorescens LSW-4 with the biocontrol effect in fields for preventing and treating tobacco bacterial wilt, and fully plays the actual effect and effect thereof.
Description
Technical Field
The invention belongs to the technical field of agricultural microbial control, and relates to a formulated carrier suitable for pseudomonas fluorescens and a microbial inoculum thereof.
Background
Bacterial wilt of tobacco is a destructive soil-borne disease caused by ralstonia solanacearum (Ralstonia solanacearum). In severe cases, higher economic losses are incurred. Aiming at the prevention and control technology of tobacco bacterial wilt, students at home and abroad research and control in terms of chemical, biological, agricultural measures and the like, although the occurrence of the tobacco bacterial wilt can be reduced to a certain extent, certain limitations still exist. In recent years, the use of biocontrol bacteria for preventing and treating tobacco bacterial wilt is an effective prevention and treatment measure, has the advantages of environmental friendliness, long-acting effect and the like, and has wide application prospect. The biocontrol bacteria which are separated from the soil at present and can be used for preventing and treating the tobacco bacterial wilt mainly comprise bacillus subtilis, arbuscular mycorrhizal fungi, streptomycete, pseudomonas and the like. These isolated strains can be further developed into the potential of microbial pesticides.
However, since Pseudomonas fluorescens is a proprietary aerobic living, it can grow in an environment with pH5-8 and 7% NaCl, the optimum growth temperature is about 25-30 ℃, most strains can grow at low temperature of 4 ℃ or below, not resist high temperature, not grow beyond 41 ℃, and not produce dormancy such as spores, and the application has a certain limitation. In order to be further applied to microbial pesticides, the research and development of microbial agents and the selection of carriers of microbial agents are important, and the carriers and other auxiliary components in microbial agents are key factors influencing the number of viable bacteria in microbial agents. The liquid bacterial preparation has simple preparation process, bacterial in suspension and homogeneous state in liquid condition, and is favorable to the diffusion of bacterial and product and the control and detection of fermented bacterial liquid. The solid microbial preparation has the advantages of low packaging cost, convenient transportation, high bacterial content, storage at normal temperature, difficult inactivation, multiple types of bacteria which can be contained, better combination effect with the compound enzyme preparation, more convenient use, high-temperature granulation, large-scale application of an automatic feeding system and the like; the disadvantage is that in a state of low activity, a certain time is required for activation to produce an effect when used.
Disclosure of Invention
In view of the above, the present invention aims to provide a formulated carrier suitable for Pseudomonas fluorescens, and a microbial inoculum medium prepared by compounding the carrier. The invention also aims to provide a bacterial agent of pseudomonas fluorescens LSW-4.
In order to achieve the above purpose, the present invention provides the following technical solutions:
1. a formulated carrier suitable for Pseudomonas fluorescens, wherein the carrier is bran, straw powder or diatomite.
Further, a formulated carrier bran suitable for Pseudomonas fluorescens is preferred.
Further, in the preparation carrier suitable for the pseudomonas fluorescens, the pseudomonas fluorescens is pseudomonas fluorescens (Pseudomonas fluorescens) LSW-4, and is preserved in China general microbiological culture Collection center, address: beijing city, chaoyang district, north Chen Xili No. 1, 3, date of preservation: 2022, 4, 11, deposit number: CGMCC 24668.
2. The invention also provides a microbial agent for preventing and treating tobacco bacterial wilt, which comprises pseudomonas fluorescens LSW-4 and a carrier, wherein the preservation number of the pseudomonas fluorescens LSW-4 is as follows: CGMCC 24668.
Further, the microbial agent for preventing and treating tobacco bacterial wilt also comprises a microbial agent culture medium: 1% of tryptone, 0.5% of yeast extract, 1% of sodium chloride, 0.01% -0.02% of sodium carboxymethyl cellulose, 0.5% -1.5% of dextrin and 2% -3% of sodium caseinate.
Further, in the microbial agent for preventing and treating tobacco bacterial wilt, the ratio of the pseudomonas fluorescens LSW-4 bacterial liquid to the carrier is 0.5-3 ml:1g.
Preferably, in the microbial agent for preventing and treating tobacco bacterial wilt, the ratio of the pseudomonas fluorescens LSW-4 bacterial liquid to the carrier is 0.5-1.5 ml:1g.
3. The invention also provides a preparation method of the microbial agent for preventing and treating tobacco bacterial wilt, which comprises the following specific steps:
(1) Inoculating Pseudomonas fluorescens LSW-4 into an LB liquid culture medium, placing the LB liquid culture medium into a shaking table at the constant temperature of 28-30 ℃ for culturing for 24-48 hours, centrifuging the cultured bacterial fermentation liquid, suspending the centrifuged bacterial cells by using a microbial inoculum culture medium, and gently shaking and uniformly mixing;
(2) Adding the suspended bacterial liquid into a carrier, carrying out shaking culture at the constant temperature of 28-30 ℃ for 30-40min, and finally drying to constant weight.
Further, in the preparation method of the microbial agent, the carrier is bran, straw powder or diatomite; the microbial inoculum culture medium is tryptone 1%, yeast extract 0.5%, sodium chloride 1%, sodium carboxymethylcellulose 0.01% -0.02%, dextrin 0.5% -1.5%, and sodium caseinate 2% -3%.
Further, in the preparation method of the microbial agent, the ratio of the bacterial liquid to the carrier in the step (2) is 0.5-3 ml:1g.
Preferably, in the preparation method of the microbial agent, the ratio of the bacterial liquid to the carrier in the step (2) is 1-1.5 ml:1g.
Further, in the preparation method of the microbial agent, the concentration of the fluorescent pseudomonas LSW-4 in the bacterial liquid is 1 multiplied by 10 10 cfu/ml～1×10 12 cfu/ml。
4. The application of any microbial agent in preventing and treating tobacco bacterial wilt is also within the scope of the invention.
The invention has the beneficial effects that: the fluorescent pseudomonas LSW-4 used in the invention has better inhibition and antagonism on the bacterial wilt, the inhibition zone of the bacterial wilt can reach 12.30mm-33.76mm under different concentrations, the potted plant preliminary test shows that the fluorescent pseudomonas LSW-4 has good direct disease control effect on tobacco wilt, in further field experiments, the fluorescent pseudomonas LSW-4 also shows excellent resistance on tobacco wilt, the morbidity is only 10.00%, the disease index is 5.78, the control effect is 79.97%, and the fluorescent pseudomonas LSW-4 can be fully proved to be capable of effectively controlling tobacco plant wilt in the field and has a certain growth promoting effect. The method can be fully applied to the practical tobacco planting production, in order to further solve the problems of transportation and storage of the pseudomonas fluorescens LSW-4, 5 carriers suitable for the growth of the pseudomonas fluorescens LSW-4, such as talcum powder, diatomite, oyster shell powder, chaff, straw powder and the like, are screened from different carriers, and the carrier most suitable for the loading of the pseudomonas fluorescens is selected from the carriers. The solid microbial agent prepared by further utilizing the carrier and compounding the obtained microbial agent culture medium can be used for preparing the fluorescent pseudomonas LSW-4 into a solid microbial agent, is suitable for long-time preservation, has a relative prevention effect of 54.65% through a microbial agent viable count test and a potting experiment test, has a simple method for preparing the solid microbial agent and high bacterial strain activity, is suitable for industrial production, and is beneficial to preservation and transportation of bacterial strains. The separated pseudomonas fluorescens LSW-4 with the biocontrol effect can be further applied to the field prevention and treatment of tobacco bacterial wilt in an industrialized way.
Preservation of biological materials
Pseudomonas fluorescens (Pseudomonas fluorescens) LSW-4 of the invention is deposited at China general microbiological culture Collection center, address: beijing city, chaoyang district, north Chen Xili No. 1, 3, date of preservation: 2022, 4, 11, deposit number: CGMCC 24668.
Drawings
In order to make the objects, technical solutions and advantageous effects of the present invention more clear, the present invention provides the following drawings for description:
FIG. 1 is a partial planogram showing the bacteriostatic effect of rescreening antagonistic bacteria on bacterial wilt.
FIG. 2 shows the results of a pre-test screening section of a pot.
FIG. 3 shows the effect of rhizosphere regulation of different microbial agents on tobacco plant bacterial wilt resistance.
FIG. 4 shows the effect of rhizosphere regulation of different microbial agents on tobacco plant bacterial wilt resistance index.
FIG. 5 is a morphology of LSW-4 single colonies.
FIG. 6 is a view showing the morphology of LSW-4 transmission electron microscope bacteria.
FIG. 7 is a schematic representation of the creation of an LSW-4 phylogenetic tree based on 16S rDNA.
FIG. 8 shows the growth curve of Pseudomonas fluorescens LSW-4.
FIGS. 9-13 are graphs showing the number of live bacteria sampled at different time points for the microbial inoculum prepared from different carriers; wherein the carrier of fig. 9 is diatomite, the carrier of fig. 10 is straw powder, the carrier of fig. 11 is bran, the carrier of fig. 12 is talcum powder, and the carrier of fig. 13 is oyster shell powder.
FIGS. 14 to 16 are sequentially showing the culture charts of the number of viable bacteria sampled at different time points of the microbial inoculum obtained in each microbial inoculum medium of example 7.
FIG. 17 shows the results of potting experiments with different solid Pseudomonas fluorescens LSW-4 bacteria.
Detailed Description
Preferred embodiments of the present invention will be described in detail below with reference to the accompanying drawings. The experimental methods for which specific conditions are not specified in the examples are generally conducted under conventional conditions or under conditions recommended by the manufacturer.
Example 1
1. Soil sample collection: soil samples were collected on day 29, 8 in 2019, and the soil sample collection information is shown in table 1. Pulling off the soil on the surface of the healthy tobacco plants, collecting soil layers 5-25cm below the ground surface, digging out tobacco roots, uniformly mixing the soil of the tobacco roots with rhizosphere soil of 3 healthy tobacco plants in a collection bag, repeating for 3 times, and sealing to make marks.
Table 1 soil sample collection information table
2. Test pathogen activation: pathogenic bacterial wilt's isolated from pathogenic tobacco plants of Chongqing peng water tobacco bacterial wiltBacteria (Ralstonia solanacearum) CQPS-1, the pathogenic bacteria have been studied for identification and characterization. Activating tobacco bacterial wilt CQPS-1, and propagating in liquid culture medium B under the conditions of constant temperature shaking table 30deg.C, 180rpm/min for about 12 hr, and spectrophotometry to detect OD value=0.8-1.0, wherein the tobacco bacterial wilt concentration is about 1×10 9 cfu/mL. The culture medium used in this example and its specific formulation are as follows:
NA medium: 5.0g of bactopeptone, 1.0g of yeast powder, 10.0g of glucose, 3.0g of beef powder, 20.0g of agar powder, 1000mL of distilled water and pH of 6.8-7.2; sterilizing at 121deg.C for 20min.
LB medium: 5.0g of yeast extract, 10.0g of sodium chloride, 10.0g of tryptone and 1000mL of distilled water; sterilizing at 121deg.C for 20min.
Liquid medium B: 1.0g of casein amino acid, 5.0g of glucose, 10.0g of bactopeptone, 1.0g of yeast extract and 1000mL of distilled water; sterilizing at 121deg.C for 20min.
3. Isolation and purification of strains
The test adopts a dilution flat plate coating method to separate and purify bacteria in a soil sample, and comprises the following specific operations: weighing 10g of soil sample, adding 90mL of sterile water, slightly vibrating, fully mixing, vibrating for 30min on a constant-temperature shaking table of 220r/min, and standing for 10min; taking supernatant of the soil fungus suspension after standing, and preparing 10 by adopting a gradient dilution method -2 、10 -3 、10 -4 And 10 -5 Is a diluent of (a); taking 100 mu L of the diluent with each concentration gradient, adding the diluent onto a NA plate with coating beads, and uniformly oscillating back and forth to uniformly coat bacterial suspension, wherein each concentration gradient is repeated for 3 times; culturing the coated NA plate in an inverted manner in a constant temperature incubator at 30 ℃; taking out the NA plate after 2d, observing the growth condition of the bacterial colony in an ultra-clean workbench, taking the shape and the color of the bacterial colony as judging basis, picking out different single bacterial colonies in an LB liquid culture medium, placing the bacterial colonies at 30 ℃, culturing at 170r/min for 12h, adopting a flat plate lineation method, culturing at 30 ℃ for 48h, repeating 3 times of each lineation plate, purifying the separated bacteria, and repeating the step of picking the single bacterial colony on the NA plate for three times until all bacterial colonies on the NA plate are consistent, thus finishing the purification.
After separating and purifying bacteria in the soil sample, intuitively judging the shape and color difference of the bacteria, separating 184 strains of bacteria altogether, and further evaluating antagonism of the separated 184 strains of bacteria on tobacco bacterial wilt by adopting a flat plate counter method for primary screening, wherein the specific operation method comprises the following steps: taking bacterial suspension (10) of activated tobacco bacterial wilt 6 cfu/mL) of 100 mu L, adding the mixture to an NA plate of the sterilized coated beads, and uniformly coating; placing a 6mm filter paper sheet in the center of the NA plate coated with the tobacco bacterial wilt; each purified test bacteria was taken in 5. Mu.L and attached to a filter paper sheet, and each treatment was repeated 3 times. After being placed in a constant temperature incubator at 30 ℃ for inverted culture for 48 hours, the bacteria inhibition zone is observed to be formed.
The 49 bacteria with antagonism to tobacco bacterial wilt are separated by primary screening, obvious inhibition zones are formed, but the inhibition effects are different, and the diameters of the inhibition zones are different, and the results are shown in table 2.
Table 2 diameter meter of primary screening bacteriostasis ring
The antagonistic bacteria of the primary screening are further screened again, and the specific operation method comprises the following steps: taking a bacterial suspension (10) of activated tobacco bacterial wilt in advance 6 cfu/mL) of 100 mu L, adding the mixture to an NA plate of the sterilized coated beads, and uniformly coating; placing a 6mm filter paper sheet in the center of the NA plate coated with the tobacco bacterial wilt; transferring the bacteria with antagonism to tobacco bacterial wilt in the primary screening result to LB liquid culture medium to culture until the bacterial wilt is 10 9 cfu/mL (OD=0.8-1), ensuring the consistency of the concentration of the bacteria to be detected, taking 5 mu L of the bacteria to be detected, and connecting the bacteria to be detected on a filter paper sheet, wherein each treatment is repeated for 3 times. After the culture is placed in a constant temperature incubator at 30 ℃ for inverted culture for 48 hours, the size of each inhibition zone is measured by adopting a crisscross method except for observing the formation of the inhibition zone. 24 bacteria still having antagonism to the bacterial wilt are re-screened from the 49 antagonistic bacteria of the primary screening, fig. 1 is a partial planogram of the antibacterial effect of the re-screened antagonistic bacteria to the bacterial wilt, and fig. 3 is a diameter table of the re-screened antibacterial zone.
Table 3 diameter meter of re-screening bacteriostasis ring
Example 2
In order to effectively prevent and control the tobacco bacterial wilt, screening of the tobacco bacterial wilt antagonistic bacteria is not limited to evaluating the direct inhibition effect of the antagonistic bacteria on the tobacco bacterial wilt, but also confirms the direct disease control effect of the antagonistic bacteria on the tobacco bacterial wilt through a potting pre-test.
Selecting four-leaf and one-heart tobacco seedlings with consistent and healthy sizes for potting test, transferring the activated antagonistic bacteria to LB liquid culture medium for culture, placing the culture medium at 30 ℃, culturing at 170r/min for 12 hours, detecting the OD=0.8-1 by a spectrogradiometer, inoculating 10mL of bacterial liquid to each tobacco seedling, treating 10 tobacco seedlings, and inoculating 10mL of sterile water to blank control. The cultivation conditions of the greenhouse were set as follows: the mixture is irradiated for 12 hours at the temperature of 28 ℃ and the humidity of 85 percent. During the growth of tobacco seedlings, the tobacco seedlings are regularly irrigated by sterile water to ensure the normal growth of the tobacco seedlings, the incidence rate of the tobacco bacterial wilt is investigated according to national standard GB/T2322-2008 of the bacterial wilt and indoor grading standards from the beginning of the tobacco bacterial wilt, the screening part results of a potted plant pre-test are shown in fig. 2, and the influence of antagonistic bacteria on the tobacco bacterial wilt is shown in table 4.
TABLE 4 Table 4
Example 3
In order to clearly determine the influence of the concentration of LSW-4 and the inoculation time on tobacco bacterial wilt, four-leaf and one-core Yunyan 87 tobacco seedlings are selected for laboratory experiments by adopting a common seedling tray seedling culture mode, and the concentrations are respectively 1 multiplied by 10 8 cfu/mL、1×10 7 cfu/mL、1×10 6 Root irrigation was performed at cfu/mL antagonistic bacteria concentration.
Inoculating antagonistic bacteria LSW-4 with each tobacco strain according to different treatment concentration of 10mL, and irrigating root of each tobacco strain to inoculate bacterial wilt after inoculating antagonistic bacteria LSW-4 for 3dBacteria CQPS-1 (1×10) 7 cfu/mL 10 mL). 10 tobacco seedlings are treated each time, the tobacco seedlings are repeated for 3 times, the greenhouse culture condition is that the illumination is carried out for 12 hours, the temperature is 28 ℃, the humidity is 85%, the investigation is carried out according to national standard GB/T2322-2008 and indoor grading standards from the occurrence of the tobacco bacterial wilt, and the occurrence of the bacterial wilt is recorded once every 24 hours. The antagonistic bacteria LSW-4 is found to have concentration effect on prevention and control of tobacco bacterial wilt, namely the higher the concentration of the antagonistic bacteria LSW-4 is, the better the prevention and control effect on tobacco bacterial wilt is. When the incidence rate of the blank control is 66.66%, 1×10 8 cfu/mL、1×10 7 cfu/mL、1×10 6 The morbidity of cfu/mL is 11.11%,25.00%,44.45%, the disease indexes are 11.11, 23.61 and 44.45 respectively, and the relative prevention effect of different concentrations is 83.33%, 64.58% and 33.32%.
Further, by the potting pre-test of example 2, several antagonistic bacteria LSW-4, LSW-32 and PSG-26 which did not attack the disease were selected, and a field test was performed in Chongqing unitary Yang Cangling Zhen-Xa dam village in 2019 (the village of Qing mountain city, qing Ling Qing Cheng village with the altitude 1143m, the longitude and latitude of which is east longitude E108 degrees 34 '22.99', north latitude N29 degrees 0 '42.83', and the average transplanted tobacco seedling per mu was about 1200 strains), the test variety was Yunyan 87, and the test material: (1) Self-extracting antagonistic bacteria (LSW-4, PSG-26, LSW-32); (2) trichoderma harzianum; (3) bacillus subtilis; (4) Miao Jiangzhuang; (5) Paenibacillus polymyxa. And (2) to (5) are purchased in the market, and each microbial inoculum is root-irrigated and applied. Treatment 1: paenibacillus polymyxa; treatment 2: trichoderma harzianum agent; treatment 3: a seedling strengthening compound microbial inoculum; treatment 4: a bacillus subtilis agent; treatment 5: LSW-4; treatment 6: PSG-26; treatment 7: LSW-32; treatment 8 (CK): clear water control, each microbial inoculum concentration is 1×10 8 cfu/mL. After the antagonistic bacteria of the re-screening are activated, transferring to LB liquid medium for culture, placing at 30 ℃ and 170r/min for culture for 12 hours, detecting the OD=0.8-1 by a spectrogradiometer, and adopting a root irrigation mode.
Cultivation conditions: in the early stage, floating seedling raising is adopted for cultivation of tobacco seedlings, unified field management is carried out on tobacco plant growth management according to relevant technical standards, transplanting time is 4 months and 30 days, axillary buds are controlled by 12.5% flumetralin EC when central flowers bloom, topping is carried out 7 months and 7 days, and harvesting is carried out 7 months and 18 days. The effect of rhizosphere regulation of different microbial agents on agronomic traits of tobacco plants is shown in table 5. As can be seen from Table 5, the antagonistic bacteria LSW-4, LSW-32 and PSG-26 isolated in the present invention have good effects on agronomic traits in the tobacco plant group (according to YC/T142-1998, standard of investigation of agronomic traits of tobacco).
TABLE 5
The plot selected in the test is a perennial bacterial wilt high-incidence plot, the effect result of rhizosphere regulation of different microbial agents on tobacco plant resistance to tobacco bacterial wilt is shown in fig. 3 (morbidity) and fig. 4 (disease index), the morbidity and all of rhizosphere regulation treatment of different microbial agents are lower than those of control treatment, and significant difference exists between the rhizosphere regulation treatment and clear water control, so that the resistance of tobacco plants to tobacco bacterial wilt can be affected to a certain extent through the rhizosphere regulation mode. The results show that: the best disease control effect is antagonizing bacteria LSW-4, the later disease rate is only 10.00 percent, the later disease rate is 15.00 percent, the disease rates of Paenibacillus polymyxa, strong seedlings, PSG-26 and LSW-32 are 43.33 percent, 38.33 percent and 41.67 percent respectively, and the disease rate of blank control is 61.67 percent. The disease index is consistent with the trend of the incidence, LSW-4 is 5.78, the disease index of bacillus subtilis is 7.22, the disease indexes of paenibacillus polymyxa, strong seedlings, PSG-26 and LSW-32 are 16.13, 18.44, 20.46 and 17.96 respectively, the disease index of blank control is 28.85, the control effect of LSW-4 is 79.97%, the LSW-4 is fully proved to be capable of effectively controlling tobacco plant bacterial wilt in a field, the tobacco plants irrigated by LSW-4 enter a mass period 2d earlier than the control, and the tobacco plants irrigated by LSW-4 are superior to the control in plant height, effective leaf number, leaf length, leaf width and leaf area.
Example 4
Identification of antagonistic bacteria LSW-4, FIG. 5 is a single colony morphology of LSW-4, and FIG. 6 is a morphology observation of LSW-4 transmission electron microscope bacteria. After the LSW-4 was cultured in TSA medium for 48 hours, the morphology of single colony was observed and gram-stained, and it was observed that LSW-4 was gram-negative bacteria, the morphology of single colony was colony-circular, the color was milky white, the surface was smooth, the edges were clean, and the middle was slightly raised. The result of the transmission electron microscope shows that the bacterial form is rod-shaped and has terminal flagella.
Bacterial DNA (DNA extraction kit of Beijing Soxhlet technology Co., ltd.) was extracted and PCR amplification was performed on the 27F/1492R region of the bacterial DNA according to amplification primers (27F and 1492R). 27F: agagttttgatcctggcttag; 1492R: ggttacttgttacgactt. Sequencing PCR amplified products by Hua big gene company, BLAST comparing sequencing results in GenBank, selecting a 16S rDNA sequence with higher homology as a reference object, constructing a phylogenetic tree by adopting a neighbor-joining method, and establishing an LSW-4 phylogenetic tree based on the 16S rDNA in FIG. 7. The strain LSW-4 was identified as Pseudomonas fluorescens (Pseudomonas fluorescens). The growth condition of antagonistic bacteria LSW-4 is clarified by measuring the OD value of the antagonistic bacteria LSW-4 by a spectrophotometer, the growth rule is known, the antagonistic bacteria LSW-4 is totally measured for 72 hours, the obvious decline trend of the OD value is observed, and the LSW-4 reaches the growth log phase between 10 hours and 12 hours. FIG. 8 shows the growth curve of Pseudomonas fluorescens LSW-4.
The strain LSW-4 is preserved in China general microbiological culture Collection center, address: beijing city, chaoyang district, north Chen Xili No. 1, 3, date of preservation: 2022, 4, 11, deposit number: CGMCC 24668.
Example 5
Soil after application of antagonistic bacteria LSW-4 was collected in two times, the period of collection was 6 months 23 days (Wanglong period), 7 months 18 days (topping late period) was compared before and after the two data, 3 replicates, and changes in the soil microbial community after application of antagonistic bacteria LSW-4 were analyzed.
The following conclusion was reached by high throughput sequencing from DNA samples of soil treated with LSW-4 at different times and analysis by means of the american Ji Yun platform:
(1) By analyzing the composition of the collected soil samples of 6 months 23 and 7 months 18, comparing the soil samples of 6 months 23 and 7 months 18, after antagonistic bacteria LSW-4 treatment, the proportion of the green curved fungus door (chlorflexi) in the bacterial community shows a growing trend, the Ascomycota (Ascomycota) in the fungal community is reduced by 11.41%, the Mortierella (Mortierella) is increased by 3.54%, and the Basidiomycota (Basidiomycota) is increased by 3.76%.
(2) Statistical analysis of β diversity revealed that at OTU level, the difference between the treated LSW-4 and the blank control was not very significant in the soil at day 6 months 23, whether bacterial or fungal. In the soil of 7 months and 18 days, the effect on bacterial communities is large after LSW-4 treatment, and obvious difference appears.
(3) By discriminant analysis of the soil sample LEfSe after LSW-4 treatment, the soil sample collected on day 6 and 23 shows that the soil sample is significantly enriched as Luo He bacillus (Rhodanobacter) after LSW-4 treatment at the level of bacterial community genus; the fungi treated by LSW-4 are obviously enriched to Becky Eurotium (Pseudomonas) and Setophoma, rickenella, cotylidia. The soil sample was significantly enriched in bacterial communities after LSW-4 treatment for 7 months and on fungus levels was significantly enriched for obscurbibateralles, and was predominantly Codinaea, scytalidium after LSW-4 treatment.
LSW-4 is used as a biocontrol strain, can directly inhibit the proliferation of pathogenic bacteria, induces plants to generate disease resistance, and can play a role in regulating and controlling the micro-ecological structure of soil in soil. Soil is an environment in which plants directly grow, and is also an important medium for pathogenic bacteria and plant interaction. Whether soil is healthy or not directly affects the health of plants. The growing severity of soil-borne diseases is often caused by the disruption of the microecological balance of soil caused by continuous cropping throughout the year. Soil microorganisms are considered to be an important component of the soil ecosystem and also an important indicator of whether soil is healthy. The change of the microbial composition of soil and the occurrence of soil-borne diseases are closely related to plant health. After antagonistic bacteria LSW-4 are applied to Pseudomonas fluorescens (Pseudomonas fluorescens), the microbial community structure of tobacco rhizosphere soil is affected, and the fluorescent Pseudomonas fluorescens LSW-4 can regulate and control the abundance of certain specific microbial populations in the microbial community composition, so that the occurrence of soil-borne disease bacterial wilt is reduced. The soil samples collected on day 6 and 23 showed that, at the level of the bacterial community, they were significantly enriched in Luo He bacillus (rhodobacter) after LSW-4 treatment; the fungi treated by LSW-4 are obviously enriched to Becky Eurotium (Pseudomonas) and Setophoma, rickenella, cotylidia. The soil sample was significantly enriched in bacterial communities after LSW-4 treatment for 7 months and on fungus levels was significantly enriched for obscurbibateralles, and was predominantly Codinaea, scytalidium after LSW-4 treatment.
Example 6
In order to further apply the strain LSW-4 to commercial products, on the basis of earlier research, the preparation carrier and the solid microbial agent suitable for the pseudomonas fluorescens are continuously examined so as to solve the problems of transportation and storage of the pseudomonas fluorescens and facilitate application to field prevention and treatment of tobacco bacterial wilt.
1. Preparation of liquid culture Medium
LB liquid medium: 10.0g of tryptone, 5.0g of yeast extract, 10.0g of sodium chloride, 1000ml of constant volume and natural pH;
LB solid medium: 15% -20% (w/v) of agar is added into LB liquid culture medium.
2. Carrier body
Carrier material: oyster shell powder (500 g/bag of the beginner flower electronic commerce Limited company in the millizhou city), diatomite (500 g/bag of the fine chemical industry of the deng peak), talcum powder (500 g/bottle of the fine chemical industry of the Fuchen), corn straw powder (250 g/20 meshes of the deep processing of the agricultural products of the Lifeng) and Gu Kangfen (250 g/20 meshes of the deep processing of the agricultural products of the Lifeng).
Respectively taking oyster shell powder, diatomite, talcum powder, straw powder and bran powder, sterilizing with high-pressure steam at 121 ℃ for 30 minutes, and then drying in a constant-temperature oven at 60 ℃ to a constant state. Table 6 shows the pH of the different carriers.
TABLE 6 pH of different Carriers
3. Bacterial culture
Inoculating Pseudomonas fluorescens LSW-4 into LB liquid medium according to 1% -1.5% of inoculation amount, placing in a 30 ℃ constant temperature shaking table for 180r/min, and culturing for 24-48 h.
4. Centrifuging
The cultured bacterial fermentation broth was centrifuged at 8000r for 5min with a 50ml centrifuge tube previously sterilized.
5. Suspending
The centrifuged bacteria were added to LB liquid medium of about one tenth of the original bacteria volume to suspend and mix gently. The concentration of the mixed bacterial liquid is about 1 multiplied by 10 12 cfu/ml。
6. Mixing
Adding the suspended bacterial liquid into carriers such as sterile oyster shell powder, diatomite, talcum powder, straw powder, chaff and the like according to the volume-to-mass ratio (ml: g), uniformly mixing for 30-40min under the condition of 180r/min of a constant temperature shaking table at 30 ℃, finally ventilating and airing in a sterile workbench to constant weight, respectively filling into a sterilized glass bottle, and uniformly stirring by using a sterile glass rod.
7. Preservation of
Sealing with sealing film, storing at normal temperature, sampling for 10d, 30d and 90d, measuring viable cell number, and screening out carrier with maximum viable cell number. Samples were taken for gradient dilution coating and the viable count was counted (LB solid medium, 3 samples were taken each time, 1g was weighed, 3 concentrations per sample, 3 plates per concentration).
The ratio of the bacterial liquid to the carrier is tested according to 0.5:1, 1:1, 1.5:1, 2:1, 2.5:1 and 3:1 (ml: g), when the ratio of the bacterial agent to the carrier is more than 1.5:1, the viable count of the solid bacterial agent prepared by the same carrier is not greatly changed when the ratio of the bacterial agent to the carrier is more than 1.5:1, and when the ratio of the solid bacterial agent prepared by diatomite is more than 2.5:1, the viable count is not greatly changed when the test is carried out on the 10 th day. As proved by experiments, the carrier suitable for preparing the Pseudomonas fluorescens LSW-4 is bran, straw powder and diatomite, and the bran is preferred. The bran is a raw material, so the bran is a more convenient and cheap source, and the number is large, so the bran is selected as an optimal carrier for further testing and research.
Fig. 9-13 show the number of viable bacteria at different time points when the ratio of the bacterial liquid to the carrier is 1:1, wherein the carrier of fig. 9 is diatomite, the carrier of fig. 10 is straw powder, the carrier of fig. 11 is bran, the carrier of fig. 12 is talcum powder, and the carrier of fig. 13 is oyster shell powder. Table 7 shows the number of viable bacteria obtained by sampling at different time points when the ratio of the bacterial liquid to the carrier was 1:1.
Table 7 viable count (cfu/g) was measured for each vector at different time points
| Carrier body | 10d | 30d | 90d |
| Chaff | 2.1×10 11 | 5.7×10 10 | 1.3×10 9 |
| Straw powder | 1.3×10 9 | 9.0×10 7 | 1.2×10 8 |
| Talc powder | 2.5×10 10 | 4.7×10 7 | \ |
| Diatomite | 7.7×10 11 | 5.2×10 7 | 9.6×10 6 |
| Oyster shell powder | 5.1×10 10 | 2.1×10 8 | \ |
Example 7
Inoculating Pseudomonas fluorescens LSW-4 into an LB liquid culture medium according to an inoculum size of 1% -1.5%, placing the LB liquid culture medium in a shaking table at a constant temperature of 30 ℃ for 180r/min, culturing for 24h-48h, and centrifuging the cultured bacterial fermentation liquor with a sterilizing centrifuge tube for 8000r and 5min; the centrifuged thalli is suspended by a microbial inoculum culture medium with the volume of 1/8-1/12 of the original bacterial liquid, and is gently mixed by shaking.
Microbial inoculum medium 1: 10.0g of tryptone, 5.0g of yeast extract, 10.0g of sodium chloride, 0.1-0.2 g of sodium carboxymethylcellulose, 5-15g of dextrin, 20-30 g of sodium caseinate, 1000ml of constant volume and natural pH.
Microbial inoculum medium 2: the carrier is chaff, the microbial inoculum culture medium: 10.0g of tryptone, 5.0g of yeast extract, 10.0g of sodium chloride, 0.1-0.2 g of sodium carboxymethylcellulose, 20-30 g of sodium caseinate, 1000ml of constant volume and natural pH.
Microbial inoculum medium 3: the carrier is chaff, the microbial inoculum culture medium: 10.0g of tryptone, 5.0g of yeast extract, 10.0g of sodium chloride, 0.1-0.2 g of sodium carboxymethylcellulose, 1000ml of constant volume and natural pH.
Adding bacterial solutions suspended by using culture mediums of different bacterial agents into carriers with the volume-mass ratio of 0.5-1.5:1 (ml: g), respectively adding the bacterial solutions into the carriers subjected to aseptic treatment, uniformly mixing for 30-40min under the condition of 180r/min of a constant temperature shaking table at 30 ℃, and finally ventilating and airing in an aseptic workbench to constant weight. In order to accelerate the drying speed, the pseudomonas fluorescens LSW-4 solid microbial inoculum can be obtained by uniformly mixing, sterile filtering and then ventilating and drying under the sterile condition to constant weight. It may also be freeze-dried or spray-dried.
The microbial inoculum culture medium of the invention is tested by a plurality of component combinations and different concentrations, cereal bran is used as a carrier, the effective viable bacteria number of 10 days, 30 days and 90 days is inspected under the condition that the ratio of microbial inoculum to the carrier is 1:1, the optimal microbial inoculum culture medium is confirmed, the viable bacteria count statistics are obtained by sampling the microbial inoculum obtained by each microbial inoculum culture medium at different time points, and fig. 14-16 are sequentially and respectively obtained by sampling the viable bacteria count culture diagrams of the microbial inoculum obtained by each microbial inoculum culture medium at different time points. Finally, using bran as a carrier, screening LB liquid culture medium under the conditions of bacterial liquid and carrier 1:1, adding 0.01-0.02% of sodium carboxymethylcellulose, 0.5-1.5% of dextrin and 2-3% (w/v) of sodium caseinate into the microbial inoculum culture medium, and improving the loading rate and effective viable bacteria quantity of pseudomonas fluorescens LSW-4 on the bran carrier, wherein the rest data are more, and only the content and data related to the invention are shown.
TABLE 8 viable count statistics (cfu/g)
| Carrier+microbial inoculum culture medium | 10d | 30d | 90d |
| Chaff + microbial inoculum 1 | 4.8×10 11 | 1.9×10 11 | 5.7×10 10 |
| Chaff + microbial inoculum 2 | 9.7×10 10 | 1.3×10 10 | 7.3×10 9 |
| Chaff + microbial inoculum 3 | 7.5×10 9 | 3.6×10 8 | 8.3×10 7 |
Example 8
Through screening the carrier and the microbial inoculum culture medium, the Pseudomonas fluorescens LSW-4 solid microbial inoculum prepared by different methods is subjected to an indoor potting test, and further comparison and confirmation are carried out. Four-leaf and one-core Yunyan 87 tobacco seedlings are selected for laboratory experiments in a mode of common seedling tray seedling culture, three replicates are arranged for each treatment, and 12 plants are repeated for each treatment. And (3) applying 2g of microbial inoculum to each plant of tobacco substrate at about 60g during transplanting, culturing the transplanted tobacco plants at 30 ℃, illuminating for 16 hours and 8 hours at night, and watering in time under the constant temperature greenhouse condition with the air humidity of 85%. After 3 days of seedling recovery, the bacterial concentration is 1 multiplied by 10 7 cfu/ml of bacterial wilt root irrigation, 10ml of root irrigation per plant of tobacco. Disease investigation was performed from the initial stage of onset, and data were recorded and analyzed.
The following preparation methods of different Pseudomonas fluorescens LSW-4 solid microbial agents are the same as in example 2, and the carrier and microbial agent culture medium are examined under the same conditions that the ratio of the microbial liquid to the carrier is 1:1.
Microbial inoculum 1: the carrier is straw powder, the microbial inoculum culture medium: 10.0g of tryptone, 5.0g of yeast extract, 10.0g of sodium chloride, 1000ml of constant volume and natural pH.
Microbial inoculum 2: the carrier is bran powder, and the microbial inoculum culture medium: 10.0g of tryptone, 5.0g of yeast extract, 10.0g of sodium chloride, 1000ml of constant volume and natural pH.
Microbial inoculum 3: the carrier is straw powder, the microbial inoculum culture medium: 10.0g of tryptone, 5.0g of yeast extract, 10.0g of sodium chloride, 0.1-0.2 g of sodium carboxymethylcellulose, 5-15g of dextrin, 20-30 g of sodium caseinate, 1000ml of constant volume and natural pH.
Microbial inoculum 4: the carrier is straw powder, the microbial inoculum culture medium: 10.0g of tryptone, 5.0g of yeast extract, 10.0g of sodium chloride, 0.1-0.2 g of sodium carboxymethylcellulose, 1000ml of constant volume and natural pH.
Microbial inoculum 5: the carrier is bran powder, and the microbial inoculum culture medium: 10.0g of tryptone, 5.0g of yeast extract, 10.0g of sodium chloride, 0.1-0.2 g of sodium carboxymethylcellulose, 1000ml of constant volume and natural pH.
Microbial inoculum 6: the carrier is bran powder, and the microbial inoculum culture medium: 10.0g of tryptone, 5.0g of yeast extract, 10.0g of sodium chloride, 0.1-0.2 g of sodium carboxymethylcellulose, 20-30 g of sodium caseinate, 1000ml of constant volume and natural pH.
Microbial inoculum 7: the carrier is bran powder, and the microbial inoculum culture medium: 10.0g of tryptone, 5.0g of yeast extract, 10.0g of sodium chloride, 0.1-0.2 g of sodium carboxymethylcellulose, 5-15g of dextrin, 20-30 g of sodium caseinate, 1000ml of constant volume and natural pH.
CK: and (5) comparing with clear water.
As a result, FIG. 17 shows that A1 to A7 correspond to the same numbers of microbial agents, respectively.
A1: the morbidity is 66.67 percent, the disease index is 52.08, and the relative control effect is 12.79 percent;
a2: the morbidity is 58.33 percent, the disease index is 49.31, and the relative control effect is 17.44 percent;
a3: the morbidity is 52.78 percent, the disease index is 42.36, and the relative control effect is 29.07 percent;
a4: the morbidity is 66.67 percent, and the disease index 51.04 is 14.53 percent relative to the control effect;
a5: the morbidity is 58.33 percent, the disease index is 50.00, and the relative control effect is 16.28 percent;
a6: the morbidity is 44.44 percent, the disease index is 38.89, and the relative control effect is 34.88 percent;
a7: the incidence rate is 29.17 percent, the disease index is 27.08, and the relative prevention effect is 54.65 percent;
CK: the incidence rate is 69.44% and the disease index is 59.72.
The living bacteria number and the indoor potting test data show that the effect of taking chaff as a carrier of the bacterial strain LSW-4 is better than that of other carriers, the chaff is taken as the carrier, 0.01-0.02% of sodium carboxymethyl cellulose and 0.5-1.5% of dextrin are added, the bacterial activity of the fluorescent pseudomonas LSW-4 solid bacterial agent prepared by a bacterial agent culture medium with 2-3% (w/v) of sodium caseinate is highest, the long-time normal-temperature preservation condition can be met, the storage and transportation of the bacterial strain are facilitated, the effect of relative prevention effect on tobacco bacterial wilt is best, the bacterial strain is suitable for industrial production, and the separated bacterial strain can be fully applied to field prevention and treatment of the tobacco bacterial wilt and fully plays the actual effect and effect.
Finally, it is noted that the above-mentioned preferred embodiments are only intended to illustrate rather than limit the invention, and that, although the invention has been described in detail by means of the above-mentioned preferred embodiments, it will be understood by those skilled in the art that various changes in form and details may be made therein without departing from the scope of the invention as defined by the appended claims.
Claims (7)
1. A microbial agent for preventing and treating tobacco bacterial wilt is characterized by comprising pseudomonas fluorescensPseudomonas fluorescens) LSW-4 and vector, pseudomonas fluorescens LSW-4 accession number: CGMCC No.24668; the method also comprises the following steps of: 1% of tryptone, 0.5% of yeast extract, 1% of sodium chloride, 0.01% -0.02% of sodium carboxymethyl cellulose, 0.5% -1.5% of dextrin and 2% -3% of sodium caseinate.
2. The microbial agent for preventing and treating tobacco bacterial wilt according to claim 1, wherein the ratio of pseudomonas fluorescens LSW-4 bacterial liquid to carrier is 0.5-3 ml:1g.
3. The method for preparing the microbial agent for preventing and treating tobacco bacterial wilt according to any one of claims 1 to 2, which is characterized by comprising the following specific steps:
(1) Inoculating Pseudomonas fluorescens LSW-4 into an LB liquid culture medium, placing the LB liquid culture medium into a shaking table at the constant temperature of 28-30 ℃ for culturing for 24-h-48 hours, centrifuging the cultured bacterial fermentation liquid, suspending the centrifuged bacterial cells with a microbial inoculum culture medium, and gently shaking and uniformly mixing;
(2) Adding the suspended bacterial liquid into a carrier, carrying out shaking culture at a constant temperature of 28-30 ℃ for 30-40min, and finally drying to constant weight.
4. The method for preparing a microbial agent according to claim 3, wherein the carrier is bran, straw powder or diatomaceous earth; the microbial inoculum culture medium is 1% of tryptone, 0.5% of yeast extract, 1% of sodium chloride, 0.01% -0.02% of sodium carboxymethyl cellulose, 0.5% -1.5% of dextrin and 2% -3% of sodium caseinate.
5. The method for preparing a microbial agent according to claim 3, wherein the ratio of the bacterial liquid to the carrier in the step (2) is 0.5-3 ml:1g.
6. The method for producing a microbial agent according to claim 3, wherein the concentration of Pseudomonas fluorescens LSW-4 in the bacterial liquid is 1X 10 10 cfu/ml~1×10 12 cfu/ml。
7. Use of a microbial agent according to any one of claims 1-2 for controlling bacterial wilt of tobacco.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210491642.0A CN114875016B (en) | 2022-04-29 | 2022-04-29 | Formulated carrier suitable for pseudomonas fluorescens and microbial inoculum thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210491642.0A CN114875016B (en) | 2022-04-29 | 2022-04-29 | Formulated carrier suitable for pseudomonas fluorescens and microbial inoculum thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN114875016A CN114875016A (en) | 2022-08-09 |
| CN114875016B true CN114875016B (en) | 2023-10-13 |
Family
ID=82674297
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202210491642.0A Active CN114875016B (en) | 2022-04-29 | 2022-04-29 | Formulated carrier suitable for pseudomonas fluorescens and microbial inoculum thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN114875016B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114854627B (en) * | 2022-04-29 | 2023-10-13 | 重庆西农植物保护科技开发有限公司 | Pseudomonas fluorescens for preventing and treating bacterial wilt and application thereof |
| CN117363527A (en) * | 2023-10-13 | 2024-01-09 | 有铭生物科技(山东)有限公司 | Microbial agent containing pseudomonas fluorescens, and preparation method and application thereof |
Citations (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1415737A (en) * | 2002-12-04 | 2003-05-07 | 上海泽元海洋生物技术有限公司 | Microbe preparation for curing bacteroidal grancille wilt of plant and its method as well as usage |
| CN101864376A (en) * | 2010-02-10 | 2010-10-20 | 浙江省农业科学院 | Pseudomonas fluorescens strain, microbial inoculum and use thereof as seedling culture medium for controlling tomato bacterial wilt |
| CN102919275A (en) * | 2012-11-12 | 2013-02-13 | 上海师范大学 | Orange pseudomonas microbial pesticide and preparation method thereof |
| WO2013121248A1 (en) * | 2012-02-15 | 2013-08-22 | Alma Mater Studiorum - Universita' Di Bologna | Novel pseudomonas fluorescens strain and uses thereof in the biological control of bacterial or fungal diseases |
| CN104371924A (en) * | 2014-10-20 | 2015-02-25 | 黑龙江省科学院高技术研究院 | Preparation method of disease-resistant production-increasing complex microbial inoculant |
| CN107162804A (en) * | 2017-07-12 | 2017-09-15 | 合肥雅克丽新型建材有限公司 | A kind of soil conditioner for flower planting |
| CN107873704A (en) * | 2017-11-03 | 2018-04-06 | 华东理工大学 | A kind of microcapsule formulations for controlling plant diseases and preparation method and application |
| WO2020076888A1 (en) * | 2018-10-10 | 2020-04-16 | Pioneer Hi-Bred International, Inc. | Plant growth-promoting microbes, compositions, and uses |
| CN111792952A (en) * | 2020-07-09 | 2020-10-20 | 北京锦绣新技术发展有限公司 | Active coal gangue micro powder, active coal gangue mineral fertilizer and preparation method |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP5201818B2 (en) * | 2006-11-10 | 2013-06-05 | キヤノン株式会社 | Probe set, probe fixing carrier, and genetic testing method |
-
2022
- 2022-04-29 CN CN202210491642.0A patent/CN114875016B/en active Active
Patent Citations (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1415737A (en) * | 2002-12-04 | 2003-05-07 | 上海泽元海洋生物技术有限公司 | Microbe preparation for curing bacteroidal grancille wilt of plant and its method as well as usage |
| CN101864376A (en) * | 2010-02-10 | 2010-10-20 | 浙江省农业科学院 | Pseudomonas fluorescens strain, microbial inoculum and use thereof as seedling culture medium for controlling tomato bacterial wilt |
| WO2013121248A1 (en) * | 2012-02-15 | 2013-08-22 | Alma Mater Studiorum - Universita' Di Bologna | Novel pseudomonas fluorescens strain and uses thereof in the biological control of bacterial or fungal diseases |
| CN102919275A (en) * | 2012-11-12 | 2013-02-13 | 上海师范大学 | Orange pseudomonas microbial pesticide and preparation method thereof |
| CN104371924A (en) * | 2014-10-20 | 2015-02-25 | 黑龙江省科学院高技术研究院 | Preparation method of disease-resistant production-increasing complex microbial inoculant |
| CN107162804A (en) * | 2017-07-12 | 2017-09-15 | 合肥雅克丽新型建材有限公司 | A kind of soil conditioner for flower planting |
| CN107873704A (en) * | 2017-11-03 | 2018-04-06 | 华东理工大学 | A kind of microcapsule formulations for controlling plant diseases and preparation method and application |
| WO2020076888A1 (en) * | 2018-10-10 | 2020-04-16 | Pioneer Hi-Bred International, Inc. | Plant growth-promoting microbes, compositions, and uses |
| CN111792952A (en) * | 2020-07-09 | 2020-10-20 | 北京锦绣新技术发展有限公司 | Active coal gangue micro powder, active coal gangue mineral fertilizer and preparation method |
Non-Patent Citations (3)
| Title |
|---|
| Siderophores produced by Pseudomonas fluorescens P13 against Sclerotinia sclerotiorum;WANG Ping 等;《Journal of shanghai normal univemity(Natural sciences)》;全文 * |
| 一株高效苯酚降解真菌的分离鉴定及其菌剂的制备;张安龙;王晔;王雪青;赵呈馨;黄昱杰;;微生物学通报(07);全文 * |
| 张安龙 ; 王晔 ; 王雪青 ; 赵呈馨 ; 黄昱杰 ; .一株高效苯酚降解真菌的分离鉴定及其菌剂的制备.微生物学通报.2018,(07),全文. * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN114875016A (en) | 2022-08-09 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN114854627B (en) | Pseudomonas fluorescens for preventing and treating bacterial wilt and application thereof | |
| CN114875016B (en) | Formulated carrier suitable for pseudomonas fluorescens and microbial inoculum thereof | |
| CN113755382B (en) | Bacillus aryabhattai NDFY-1 and application thereof | |
| CN113789274B (en) | Grape rhizosphere antagonistic growth-promoting streptomyces F2 and application thereof | |
| CN113621532B (en) | Composite microbial agent containing saline-alkali tolerant side bacillus licheniformis and preparation method thereof | |
| CN113801818B (en) | Bacillus and application thereof | |
| CN111944716B (en) | Special compound microbial agent for tobacco seedling culture and preparation method and application thereof | |
| CN115820461B (en) | High-yield indoleacetic acid strain JB0319 and application thereof | |
| CN114214245B (en) | Bacillus cereus SS1, microbial agent and application thereof | |
| CN114934000B (en) | Salt-tolerant bacillus amyloliquefaciens and screening and application thereof | |
| CN113832071B (en) | Brevibacillus halotolerans strain and application thereof in preparation of biocontrol microbial inoculum | |
| CN115960766A (en) | Microorganism for preventing and treating bacterial wilt and application thereof | |
| CN114934001A (en) | Endogenous antagonistic bacterium of tobacco seeds and application thereof | |
| CN105349454B (en) | One plant of stratosphere bacillus and its application | |
| CN107586748B (en) | A kind of China's sporangium and its application | |
| CN116179640B (en) | Method for efficiently screening antagonistic bacteria of banana vascular wilt | |
| CN116121144B (en) | Atractylodes macrocephala growth promoting bacterium BZ-29 and application thereof | |
| CN117431194B (en) | Bacillus amyloliquefaciens, composition and application thereof in cut-flower Paeonia lactiflora | |
| CN117229985B (en) | Biocontrol strain bacillus atrophaeus BGB-98R and application thereof | |
| CN116515673B (en) | Pseudomonas and application of chrysanthemum straw fermentation product thereof in promoting plant growth | |
| CN114940962B (en) | Tobacco seed endophyte with growth promoting effect and application thereof | |
| CN116426445B (en) | Pseudomonas bacteria NJAU-T102 and application thereof | |
| CN111748485A (en) | Screening method of silicate bacteria with high potassium-decomposing capacity suitable for low-temperature slightly-acidic environment and potassium-decomposing bacterial fertilizer | |
| CN115433696A (en) | Microbial inoculum for relieving replant disorder and preparation method thereof | |
| CN104894023A (en) | Antagonistic bacterium of walnut-based dry rot disease, and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |