CN115029249A - Fungus for antagonizing potato scab germs and application thereof - Google Patents

Abstract

The invention discloses a panus purpureus producing bacterium for antagonizing potato scab pathogen and application thereof, and belongs to the technical field of microorganisms. The invention discloses a panus rudis producing strain, which is preserved in China general microbiological culture Collection center of China Committee for culture Collection of microorganisms (CGMCC) No.40086 at 03.02.2022, and the preservation address is the institute of microbiology of China academy of sciences No.3, North West Lu No.1 Homeh, Chao, Chaoyang, City. Also discloses the application of the panus nivalis and a microbial agent containing the panus nivalis and/or metabolites thereof in preventing and treating potato scab and inhibiting bacteria. The panus mauritianus and the metabolite thereof disclosed by the invention can inhibit bacterial diseases caused by pathogenic streptomycete on hosts, provide a new biocontrol bacterium type for preventing and treating potato scab, and have important significance for solving the bottleneck problem of potato production.

Description

Fungus for antagonizing potato scab germs and application thereof

Technical Field

The invention relates to the technical field of microorganisms, in particular to a fungus for antagonizing potato scab pathogen and application thereof.

Background

The potato is the fourth largest food crop next to wheat, rice and corn in the world, and China is the first big potato producing country in the world. Potatoes contain rich nutrient substances and are often widely planted in China as main grain, vegetable and processing raw material crops. The potato tubers grow in the soil and are often seriously troubled by soil-borne diseases, particularly, the long-term continuous cropping causes the massive accumulation and prevalence of diseases and pests, and the potential of increasing the yield of the potatoes is greatly limited, wherein the potato scab is the most serious, and the economic loss is the greatest.

Potato scab (Potato common scab), a soil-borne bacterial disease that affects the appearance, grade, and quality of Potato tubers. The disease is distributed in most of soil for planting potatoes, and is a very serious world-grade disease. Potato scab is caused by pathogenic Streptomyces spp, more than 20 pathogenic bacteria have been identified and reported so far, and some new Streptomyces pathogenic species are continuously discovered, presenting large diversity and complexity. Among them, s.scabies, s.acidiscabies and s.turgidiscabies are recognized worldwide as the most common pathogenic bacteria causing potato scab, and the incidence rate can reach over 90%. In addition, the above potato scab pathogenic bacteria can not only harm potatoes, but also other root crops such as beet, turnip, sweet potato, carrot, radish, etc.

The pathogenic bacteria of potato scab, which can overwinter in soil or potato tubers as the primary source of infection in the next year, are difficult to eradicate once they colonize in soil. How to control potato scab has long been a troublesome problem, and many control strategies have been used in the control work of potato scab, but the field effect is very limited. The biological control method has the advantages that the biological control effect on potato scab is good, but few biocontrol engineering strains capable of effectively antagonizing pathogenic streptomyces are available, and only bacillus strains, pseudomonas strains and a few trichoderma harzianum strains are reported at present. Therefore, the further development of new biocontrol bacteria types for preventing and treating the stubborn soil-borne bacterial diseases has important significance for solving the bottleneck problem of potato production.

Disclosure of Invention

The invention aims to provide a fungus for antagonizing potato scab germs and an application thereof, and provides a new biocontrol fungus type for preventing and treating potato scab.

In order to achieve the purpose, the invention provides the following scheme:

the invention provides a panus purpureus (Talaromyces purpurogenus) H39, which is preserved in the common microorganism center of China Committee for culture Collection of microorganisms with the preservation number of CGMCC No.40086, the preservation address of No.3 Hospital No.1 of North Chen West Lu in the sunward area of Beijing, and the preservation time of 2022 years 03 months 02 days.

The invention also provides a plant disease control agent, which comprises the panus violaceus H39.

Further, the plant disease control agent comprises fermentation liquor or spore suspension or metabolite of the panus violaceus H39.

Further, the spore suspension has a concentration of 10 ⁸ cfu/ml。

The present invention also provides a method for controlling plant diseases by applying said pachysolen violaceum H39 or said plant disease control agent to plants to prevent the plants from being infected with phytopathogens.

Further, the phytopathogen comprises a pathogenic streptomyces.

Further, the plant disease is potato scab.

The invention also provides application of the panoxanier purpureus H39 or the plant disease control agent in controlling plant diseases caused by pathogenic streptomyces.

Further, the plant diseases caused by pathogenic streptomyces comprise potato scab.

The invention discloses the following technical effects:

(1) the invention discloses a panus violacearum which is a fungus separated from soil and can be well colonized in the soil.

(2) The panus mauritianus is harmless to potatoes, can be used as a new biocontrol bacterium for preventing and treating potato scab, has safety in application, and has important significance for solving the bottleneck problem of potato production.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings needed in the embodiments will be briefly described below, and it is obvious that the drawings in the following description are only some embodiments of the present invention, and it is obvious for those skilled in the art to obtain other drawings without creative efforts.

FIG. 1 is a phylogenetic tree of the H39 ITS gene;

FIG. 2 is a H39 BenA gene phylogenetic tree;

FIG. 3 is a schematic diagram of inoculation in bacteriostasis experiment 1;

FIG. 4 shows results of treatment group facing culture for 6 days in the bacteriostasis experiment 1; wherein the arrow indicates the H39 colony;

FIG. 5 shows the results of control group and treatment culture 6d in bacteriostasis experiment 2;

FIG. 6 shows the effect of inhibiting the onset of the microorganism of the pannier fungus H39 (inoculation 6 d);

FIG. 7 shows the effect of inhibiting the pathogenesis of the metabolite of Talaromyces violaceus H39 (inoculation 6 d);

fig. 8 shows the effect of scraping the s.scabies colonies on H39-ISP6 after inoculation onto potato pieces (inoculation 6 d).

Detailed Description

Reference will now be made in detail to various exemplary embodiments of the invention, the detailed description should not be construed as limiting the invention but as a more detailed description of certain aspects, features and embodiments of the invention.

It is to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention. In addition, for numerical ranges in the present disclosure, it is understood that each intervening value, to the upper and lower limit of that range, is also specifically disclosed. Every smaller range between any stated value or intervening value in a stated range and any other stated or intervening value in a stated range is encompassed within the invention. The upper and lower limits of these smaller ranges may independently be included or excluded in the range.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although only preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated by reference herein for the purpose of disclosing and describing the methods and/or materials associated with the documents. In case of conflict with any incorporated document, the present specification will control.

It will be apparent to those skilled in the art that various modifications and variations can be made in the specific embodiments of the present disclosure without departing from the scope or spirit of the disclosure. Other embodiments will be apparent to those skilled in the art from consideration of the specification. The specification and examples are exemplary only.

As used herein, the terms "comprising," "including," "having," "containing," and the like are open-ended terms that mean including, but not limited to.

Example 1 isolation, purification and characterization of fungi

1. Evenly taking a soil sample from the continuous cropping field of the potatoes in the outer area of the Halbin city of Heilongjiang province, weighing 10g of the collected soil sample, adding 90ml of sterile water, and performing shaking culture at room temperature at 150rpm for 30 min. Then, the supernatant was aspirated and subjected to isolation of biocontrol Isaria Margaritifera by 10-fold gradient dilution on plates of selective media (Bengal culture medium: 5g of peptone, 10g of glucose, 1g of monopotassium phosphate, 0.5g of magnesium sulfate, 20g of agar, 100mL of 1/3000 Bengal solution, 1000mL of distilled water)100. mu.l of the soil dilution was applied uniformly. Then, at 10 ^-3 And (3) picking single colonies on a diluent plate, purifying on a PDA (potato) culture medium (200 g, glucose 20g, agar 15g, and distilled water to a constant volume of 1000ml) for classification and identification. The strain was subjected to morphological determination according to the handbook of fungal identification.

Morphological characteristics:

h39 on PDA medium, the hyphae become yellow at 25 deg.C and produce yellow and red pigments. The spore-producing structure of the Talaromyces is conidiophore, symmetric recurrent broom-shaped branches are generated, and the broom-shaped branches are arranged tightly; the stem is upright, has transverse septum and is transparent. Conidia are dark green and oval.

2. Molecular biological method for identifying the separated strain

(1) Materials and methods

The genome of the isolated strain was extracted using the Plant DNAkit kit of TaKaRa, according to the kit instructions. The extracted DNA is used as a template, and the ITS universal primer (ITS1/ITS4) and the gene primer (Bt2a/Bt2b) are used for carrying out PCR amplification to identify the species.

Wherein each primer sequence is as follows:

ITS1(SEQ ID NO.3) is TCCGTAGGTGAACCTGCGG;

ITS4(SEQ ID NO.4) is TCCTCCGCTTATTGATATGC;

bt2a (SEQ ID NO.5) is GGTAACCAAATCGGTGCTGCTTTC;

bt2b (SEQ ID NO.6) is ACCCTCAGTGTAGTGACCCTTGGC.

The amplification system contained 12.5. mu.l of 2 XStart FastPfu Fly PCR Supermix (TaKaRa), 1. mu.l of each of the forward and reverse primers, 1. mu.l of DNA template, and 25. mu.l of double distilled water in 25. mu.l.

PCR amplification conditions: pre-denaturation at 95 ℃ for 5 min; denaturation at 95 ℃ for 45s, annealing at 55 ℃ for 45s, extension at 72 ℃ for 2min, 35 cycles, extension at 72 ℃ for 7min, and storage at 4 ℃.

The PCR products were sequenced and BLAST (www.ncbi.nlm.nih.gov /) aligned on the NCBI website.

(2) Results and analysis

Using the extracted DNA as a template, performing PCR amplification by using an ITS universal primer, and sequencing to obtain a fragment with the size of 563 bp; and the PCR product of the beta-tubulin (BenA) gene primer is used for sequencing to obtain a fragment with the size of 443 bp. After BLAST, the sequence similarity of the ITS1 fragment and Talaromyces purpurogenus strain Q2(KX432212.1) reaches 100%, and the sequence similarity of the BenA gene fragment and T purpurogenus strain Q2(KY047419.1) reaches 100%. The phylogenetic trees are respectively constructed by applying DNAMAN software and a gene sequence of a T.purprogenonus strain published by NCBI and utilizing a maximum likelihood method. The ITS1 phylogenetic tree showed that H39 is a branch with the t. purpurogenus strain (see fig. 1). Further phylogenetic tree analysis using the BenA gene found that H39 still branches in the same way as t.purpogenesus (see fig. 2). Therefore, the ITS universal primers and the BenA gene housekeeping gene encoding the protein are identified simultaneously, and the result shows that the separated strain belongs to Talaromyces purpurogenus and is named as the panus violaceus H39.

The strain is preserved in the common microorganism center of China Committee for culture Collection of microorganisms, the preservation number is CGMCC No.40086, the preservation address is No.3 of Xilu No.1 of Beijing, Chaoyang, and the preservation time is 2022 years, 03 months and 02 days.

ITS1 gene sequence (563 bp in length, Genbank accession No. ON005142) of H39 described above (SEQ ID NO.1)

CCGCTTATTGATATGCTTAAGTTCAGCGGGTAACTCCTACCTGATCCGAGGTCAACCTTGTAAAAAGATGTGGTGGTGACCAACCCCCGCAGGTCCTTCCCGAGCGAGTGACAGAGCCCCATACGCTCGAGGACCAGACGGACGTCGCCGCTGCCTTTCGGGCAGGTCCCCAGGGGGACCACACCCAACACACAAGCCGTGCTTGAGGGCAGAAATGACGCTCGGACAGGCATGCCCCCCGGAATGCCAGGGGGCGCAATGTGCGTTCAAAGATTCGATGATTCACGGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCCGGAACCAAGAGATCCATTGTTGAAAGTTTTGACAATTTTCATATCACTCAGACAGCCCATCTTCATCAGGGTTCACAGAGCGCCTCGGCGGGCGCGGGCCCGGGGACGGATGTCCCCCGGCGACCGGGTGGCCCCGGTGGGCCCGCCGAAGCAACAGGTGTTGGAGACAAGGGTGGGAGGTTGGGCCGCGAGGGGCCCTCACTCGGTAATGATCCTTCCGCA。

BenA gene sequence of H39 (SEQ ID NO.2)

GGTGCTGCTTTCTGGTGAGGAATGACCACGCTTTCAGTCAATTGTCGCGACGACTCGCTGACTATTTTCAGGCAAATCATCTCTGCTGAGCACGGTCTCGATGGATCCGGCGTGTAAGTGTTGATGGGATTCGAAATCCATCTACAATTCGACCGTATCTGATAATCAACAGTTACAATGGCTCCTCCGACCTCCAGTTGGAGCGTATGAACGTTTACTTCAACGAGGTGCGTCGAACAACCAACCAATAGAAACAAAAACAAAAACTCATATCCAATGCTTAACAGGCTTCCGGCAACAAATATGTTCCTCGTGCTGTCCTCGTCGACTTGGAACCCGGCACCATGGATGCCGTCCGCGCTGGTCCCTTTGGTCAGCTCTTCCGTCCCGACAACTTTGTTTTCGGTCAGTCCGGTGCTGGTAACAACTGGGCCAAGGGTCAC。

EXAMPLE 2 bacteriostatic Effect of panus violet H39

1. Materials and methods

Test pathogenic bacteria: scabies (strain number CGMCC4.1765, available from China general microbiological culture Collection center).

The method comprises the following steps: the identification of the inhibition effect of the pannier fungus H39 on the pathogenic bacteria to be tested is carried out by the plate opposite culture method.

Respectively taking fungus cakes (the diameter of each fungus cake is about 6mm) of panus violet H39 by using a puncher, and using the fungus cakes for opposite culture after the panus violet H39 is cultured on a PDA culture medium for 5 days at 25 ℃.

Preparing pathogenic bacteria S.scabies bacterial liquid: the inoculating loop is streaked on YME culture medium (malt extract powder 10.0g, yeast extract 4.0g, glucose 4.0g, distilled water 1000ml, agar 15-18 g, liquid culture medium without agar), after culturing for 7d at 28 deg.C, the colony on YME plate is scraped, and placed in 50ml YME liquid culture, and cultured for 5d at 200rpm and 28 deg.C with shaking, to obtain pathogenic bacteria liquid.

Bacteriostasis experiment 1 (confrontation culture): inoculating 1 purple basket-like bacterium H39 and 800 μ l of S.scabies bacterial liquid on a potato culture medium (PDA) plate (diameter is 90mm) in opposition, wherein the distance between H39 and the front edge of the bacterial liquid is 20mm (treatment group); taking the non-inoculated strain cake as a positive control; all of the above were cultured at 28 ℃ (FIG. 3). Repeat 3 times, each treatment and control group inoculated 3 plates.

In bacteriostatic experiment 1, it was observed whether H39 growth could inhibit the spread of s.scabies on the surface of the medium, i.e. antagonism of the growth of pathogenic bacteria s.scabies. The colony radius (R) of the S.scabies of the control group was measured after 6 days of counter culture _C ) Colony radius (R) of treatment group s _T ) The inhibition rate was calculated and the coverage level was investigated. The inhibition rate is calculated by the formula: inhibition ratio (%) - (R) _C –R _T )/R _C X 100%. The average inhibition rate is the average of the inhibition rates of 3 repeated experiments.

Bacteriostatic experiment 2 (overlay culture): on a yeast malt extract agar medium (YME) plate (diameter 60mm), 800. mu.l of S.scabies bacterial solution was coated on the YME plate, and after the bacterial solution was dried, 1. mu.l of Talaromyces violaceus H39 cake, i.e., H39 cake, was placed on the S.scabies bacteria (treatment group). S.scabies which is not inoculated with H39 strain cake is used as a positive control and cultured at 28 ℃. Repeat 3 times, each treatment and control group inoculated 3 plates.

Observe whether H39 can be overlaid on the surface of s.scabies strain to represent the parasitic capacity of H39, with the ranking criteria set to 3: stage I: the bacterial colony is not contacted with the pathogenic bacteria colony, and hypha can not cover the pathogenic bacteria colony; and II, stage: the hyphae cover below 1/2 pathogenic bacteria colonies, the pathogenic bacteria colonies are healthy, and the color is unchanged; grade III: the hyphae completely cover the pathogenic bacteria colony, and a large amount of spores are produced on the pathogenic bacteria colony, and the pathogenic bacteria colony is atrophic and darkened in color.

2. Results and analysis

After the culture for 6 days, the diameter of each colony of the control group and the treated group is measured and counted, and the average bacteriostasis rate of the pannier H39 is calculated (see table 1).

TABLE 1 bacteriostasis rate and coverage index of panus violet producing H39 to pathogenic streptomycete S.scabies for 6 days

Table 1 results of the confrontation culture show that panus violaceus H39 has an inhibitory effect on the growth of pathogenic bacteria s.scabies (see fig. 4); meanwhile, the pananiella violacearum H39 can also be parasitized on colonies of pathogenic bacteria S.scabies, and the coverage rate index is grade III, namely the coverage rate can reach 100 percent (as shown in figure 5). The above results indicate that the panus violaceus H39 can inhibit the normal growth of pathogenic bacteria S.

Example 3A microorganism inoculant of Talaromyces violacearum H39 inhibits pathogenic bacterial pathogenesis

1. Preparation of panus violaceus H39 microbial agent

Inoculating purified Pavetia purpurea H39 to PDA culture medium plate, culturing at 25 deg.C for 7d, washing the culture surface with sterile distilled water (containing surfactant Tween80), making into spore suspension, and adjusting spore concentration to 10 ⁸ cfu/ml, thus obtaining the pananiella violacea H39 microbial agent.

2. Bacteriostatic effect of microbial agent for producing panus violaceus H39

2.1 materials and methods

Cutting potato tuber into uniform potato pieces with thickness of 10mm × 10mm by using a dicer, soaking in deionized water to remove starch on the surface, sterilizing the surface with 1% NaClO for 5min, and washing with sterile deionized water for 3 times. Soaking potato blocks in spore suspension of pananiola purpurea H39 for 30min, taking out, and air drying on an ultra-clean bench. And after sterile filter paper is placed in the sterile sealed box, placing the dried potato blocks in the sealed box on the filter paper. 10 mul of pathogenic bacteria S.scabies bacterial liquid (the concentration is 1 multiplied by 10) is dripped into the center of each potato block ⁷ cfu/ml). And (3) taking the potato blocks soaked in the pannier fungus spore suspension as negative control, taking the potato blocks soaked in sterile deionized water and then dripped with pathogenic bacterium liquid as positive control, and repeating for 3 times. The sealed box is placed in a constant temperature incubator and cultured for 6d at 25 ℃.

The disease grade investigation method comprises the following steps: the proportion of the area of the lesion spots to the surface area is observed visually, and then the disease is counted according to the following standard: level 0: no obvious scab is found; level 1: the ratio of the lesion spot area to the surface area is less than or equal to 25 percent; stage 2: the ratio of the area of the disease spots more than 25 percent to the surface area is less than or equal to 50 percent; and 3, level: the ratio of the surface area of the scab surface to the surface area is more than 50 percent and less than or equal to 75 percent; and 4, stage 4: the ratio of the lesion area to the surface area is more than 75 percent.

2.2 results and analysis

As shown in figure 6, after the potato blocks soaked by the purple basket fungus H39 spore suspension are inoculated with the bacterial liquid of scab germs, the visual incidence of the potato blocks is very light and is between 0 grade and 1 grade; while positive control onset has reached grade 3. The results of the in vivo inoculation experiments show that the panus violet producing bacterium H39 can inhibit the disease of scab bacteria in potato pulp.

Meanwhile, the potato blocks soaked by the panus violet producing H39 spore suspension have no abnormal change, namely the panus violet producing H39 can not cause potato diseases.

EXAMPLE 4 bacteriostatic Effect of metabolite of panus violet H39

1. Preparation of metabolite of panus violaceus H39

Inoculating the separated and purified panus violaceus H39 to a PDA culture medium plate, culturing at 25 ℃ for 6d, beating 10 fungus cakes (diameter is 6mm) at the edges of the hyphae, inoculating to a 1LPDA liquid culture medium (potato 200g, glucose 20g, distilled water constant volume is 1000ml), performing shaking culture at 25 ℃ and 150rpm for 5d, filtering out the hyphae by using 3 layers of sterile filter paper, sterilizing the obtained solution at high temperature and high pressure at 120 ℃ for 20min, and cooling at normal temperature to obtain a panus violaceus H39 metabolite solution.

2. Bacteriostatic effect of panus violet producing H39 metabolite

2.1 materials and methods

The metabolic product solution of the panus violacearum H39 prepared above is used for replacing distilled water to prepare an ISP6 (peptone yeast extract iron agar) culture medium (1L culture medium comprises yeast extract 1.0g, iron-containing peptone 8.0g, agar powder 8g, and metabolic product solution with constant volume of 1000mL), and the size of the plate is 60 mm.

And scraping pathogenic bacteria colonies on the YME plate, placing the pathogenic bacteria colonies in 50ml of YME liquid culture medium, and performing shaking culture at 200rpm and 28 ℃ for 5 days to obtain pathogenic bacteria liquid. 800 mul of pathogenic bacteria liquid is coated on a plate prepared by the metabolite solution. ISP6 medium in distilled water was used as a water control and repeated 3 times. Culturing at 28 deg.C for 6 days.

Scabies produced black pigment on ISP6 medium.

2.2 results and analysis

As shown in fig. 7, melanin produced by scab bacteria s.scabies in the water control group had caused the color of the medium to become black and the colonies to grow larger, indicating that the s.scabies of the water control group grew normally. After the bacterial liquid of scab bacteria S.scabies is inoculated on an ISP6 culture medium prepared by using a metabolite of the pachysolen violaceum H39, no black pigment is generated, the color of the culture medium is transparent yellow, and the size of a bacterial colony has no obvious change, which indicates that the S.scabies on the culture medium does not grow; subsequently, the s.scabies colonies on H39-ISP6 and the s.scabies colonies of the water control group were scraped off and inoculated onto potato pieces soaked in sterile deionized water for 30min, respectively, and the results showed that: the potato tuber inoculated with the colony of the water control group has disease symptoms such as tissue necrosis, and the potato tuber inoculated with the colony of the H39-ISP6 treatment group has no disease (see figure 8).

In conclusion, the metabolic product of the panus violet producing bacterium H39 can inhibit the growth and the attack of scab bacteria.

The above-described embodiments are merely illustrative of the preferred embodiments of the present invention, and do not limit the scope of the present invention, and various modifications and improvements of the technical solutions of the present invention can be made by those skilled in the art without departing from the spirit of the present invention, and the technical solutions of the present invention are within the scope of the present invention defined by the claims.

Sequence listing

<110> institute of economic crops of academy of agricultural sciences of Heilongjiang province

<120> fungus for antagonizing potato scab pathogen and application thereof

<160> 6

<170> SIPOSequenceListing 1.0

<210> 1

<211> 563

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

ccgcttattg atatgcttaa gttcagcggg taactcctac ctgatccgag gtcaaccttg 60

taaaaagatg tggtggtgac caacccccgc aggtccttcc cgagcgagtg acagagcccc 120

atacgctcga ggaccagacg gacgtcgccg ctgcctttcg ggcaggtccc cagggggacc 180

acacccaaca cacaagccgt gcttgagggc agaaatgacg ctcggacagg catgcccccc 240

ggaatgccag ggggcgcaat gtgcgttcaa agattcgatg attcacggaa ttctgcaatt 300

cacattactt atcgcatttc gctgcgttct tcatcgatgc cggaaccaag agatccattg 360

ttgaaagttt tgacaatttt catatcactc agacagccca tcttcatcag ggttcacaga 420

gcgcctcggc gggcgcgggc ccggggacgg atgtcccccg gcgaccgggt ggccccggtg 480

ggcccgccga agcaacaggt gttggagaca agggtgggag gttgggccgc gaggggccct 540

cactcggtaa tgatccttcc gca 563

<210> 2

<211> 443

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

ggtgctgctt tctggtgagg aatgaccacg ctttcagtca attgtcgcga cgactcgctg 60

actattttca ggcaaatcat ctctgctgag cacggtctcg atggatccgg cgtgtaagtg 120

ttgatgggat tcgaaatcca tctacaattc gaccgtatct gataatcaac agttacaatg 180

gctcctccga cctccagttg gagcgtatga acgtttactt caacgaggtg cgtcgaacaa 240

ccaaccaata gaaacaaaaa caaaaactca tatccaatgc ttaacaggct tccggcaaca 300

aatatgttcc tcgtgctgtc ctcgtcgact tggaacccgg caccatggat gccgtccgcg 360

ctggtccctt tggtcagctc ttccgtcccg acaactttgt tttcggtcag tccggtgctg 420

gtaacaactg ggccaagggt cac 443

<210> 3

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

tccgtaggtg aacctgcgg 19

<210> 4

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

tcctccgctt attgatatgc 20

<210> 5

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

ggtaaccaaa tcggtgctgc tttc 24

<210> 6

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

accctcagtg tagtgaccct tggc 24

Claims (9)

1. The Talaromyces purpurogenus H39 is deposited in China general microbiological culture Collection center with the preservation number of CGMCC No.40086, the preservation address of No.3 Hospital No.1 Xilu in the morning of the Yangyang district of Beijing, and the preservation time of 2022, 03 and 02 days.

2. A plant disease control agent comprising the Talaromyces violaceus H39 according to claim 1.

3. The agent for controlling plant diseases according to claim 2, which comprises a fermentation broth or a spore suspension or a metabolite of the basket fungus H39 as described in claim 1.

4. The agent for controlling plant diseases according to claim 3, wherein the concentration of the spore suspension is 10 ⁸ cfu/ml。

5. A method for controlling a plant disease, characterized in that the pachysolen violaceous bacterium H39 according to claim 1 or the plant disease controlling agent according to any one of claims 2 to 3 is applied to a plant to prevent the plant from being infected with a phytopathogen.

6. The method for controlling plant diseases according to claim 5, characterized in that the plant pathogenic bacteria include pathogenic streptomyces.

7. The method for controlling a plant disease according to claim 5, wherein the plant disease is potato scab.

8. Use of the panus violaceus H39 according to claim 1 or the plant disease control agent according to claims 2 to 4 for controlling plant diseases caused by pathogenic streptomyces.

9. Use according to claim 8, characterized in that the plant diseases caused by pathogenic streptomyces comprise potato scab.

Images