LU103184B1

LU103184B1 - A strain of bacillus amyloliquefaciens and applications thereof

Info

Publication number: LU103184B1
Application number: LU103184A
Authority: LU
Inventors: Zheng Lu; Birun Lin; Haibin Deng; Weiying Yao; Feizhao Wang; Qiyuan Yang; Ju Liu; Huifang Shen; Yongqiang Zhang
Original assignee: Plant Protection Res Inst Guangdong Academy Agricultural Sciences; Guangdong Tianhe Agricultural Means Of Production Co Ltd; Guangdong Branch China Tobacco General Co Ltd
Priority date: 2022-08-16
Filing date: 2023-08-16
Publication date: 2024-02-19
Also published as: CN116064284A

Abstract

The present invention discloses a strain of Bacillus amyloliquefaciens and applications thereof. The name of the Bacillus amyloliquefaciens is Bacillus amyloliquefaciens GDNXIJ-5, the deposit number is GDMCC No. 62051, and the strain was deposited on November 11, 2021 in the Guangdong Microbial Culture Collection Center, which is located at Guangdong Institute of Microbiology, 5th Floor, Building 59, No. 100 Xianliezhong Road, Guangzhou City, Guangdong Province. The strain GDNXIJ-5 in the present invention can inhibit Pathogenic Fusarium of many crops, and is especially effective in preventing Fusarium root rot of tobacco, which provides an effective way to explore the biological control of fusarium wilt (root rot) of plants.

Description

Description HU108184

A STRAIN OF BACILLUS AMYLOLIQUEFACIENS AND APPLICATIONS

THEREOF

Technical field

[0001] The present invention belongs to the field of biological control of crop diseases, and particularly relates to a strain of Bacillus amyloliquefaciens and applications thereof.

Background

[0002] Bacillus amyloliquefaciens widely exists in various ecological environments.

During its growth, it produces a variety of antibacterial substances, such as lipopeptides, polypeptides, antibacterial proteins, etc., which hace inhibition effect on fungi, bacteria, viruses, mycoplasmas, and so on, and is an important part of the biological control function of plant diseases. Bacillus amyloliquefaciens produces endophytic spores with strong heat resistance and stress resistance, fast growth rate, simple nutritional requirements, easy colonization and reproduction in soil, and is harmless to humans and animals, environmentally friendly, with simple preparation process, stable preparation, convenient application, and long storage period. It is an ideal biocontrol microorganism.

[0003] Plant wilt (root rot) is a soil borne disease caused by pathogenic Fusarium infection. The pathogen damages plants from the root, causing vascular bundle necrosis, causing plant wilt, causing serious harm and is extremely difficult to control.

Fusarium root rot of Tobacco is a common disease in tobacco growing areas of the world. Fusarium can be infected alone or mixed with black shank fungus, bacterial wilt, root knot nematode, etc., resulting in significant yield reduction of tobacco leaves, or even crop failure, becoming one of the diseases of root and stem, that seriously harms tobacco. The disease is a soil borne disease, and chemical control is not ideal.

[0004] At present, the research and application of biopesticides have become a 1 hotspot. In terms of biocontrol bacteria, Fan Bingjun and others have screened HU108184

Bacillus tequilosis, which has different degrees of inhibitory effects on four pathogens of tobacco root rot (Fusarium solani, Fusarium graminearum, Fusarium oxysporum and Fusarium sporotrichioides), but its pot and field experiments are still unclear.

Chen Changging et al. studied the field control effect of existing biological agents on tobacco Fusarium root rot, and found that the field control effect of four kinds of

Bacillus reached 42.97 to 70.19%, and the control effect was not outstanding.

Therefore, it is necessary to screen biocontrol bacteria with better control effect.

Summary

[0005] A primary object of the present invention is to overcome the shortcomings of the prior art and provide a strain of Bacillus amyloliquefaciens.

[0006] Another object of the present invention is to provide the application of the

Bacillus amyloliquefaciens.

[0007] The objects of the present invention are realized by the following technical solutions:

[0008] A strain of Bacillus amyloliquefaciens, the name of which is Bacillus amyloliquefaciens GDNXIJ-5 with a deposit number of GDMCC No. 62051, was deposited on November 11, 2021 in the Guangdong Microbial Culture Collection

Center, which is located at Guangdong Institute of Microbiology, 5th Floor, Building 59, No. 100 Xianliezhong Road, Guangzhou City, Guangdong Province..

[0009] A method for culturing the Bacillus amyloliquefaciens comprises the following steps: inoculating the Bacillus amyloliquefaciens into a seed culture medium, and culturing it at a condition of 30 °C to 37 °C.

[0010] The seed culture medium contains the following components by mass percentage: beef extract 0.3%, yeast extract 0.1%, peptone 0.5%, glucose 1%, pH=7.0 to 7.2.

[0011] A rotation speed of the culturing is 150 to 200 rpm, and is preferably 180 to 190 rpm.

[0012] A temperature of the culturing is preferably 33 °C to 35 °C. 2

[0013] Time of the culturing is 12 to 16h, and is preferably 15 h. HU108184

[0014] An inoculation amount of the Bacillus amyloliquefaciens is 3 to 8% by volume, and is preferably 5% by volume.

[0015] A fermentation method of Bacillus amyloliquefaciens, which comprises the following steps: inoculating the above Bacillus amyloliquefaciens in a fermentation medium, and fermenting and culturing for 24 to 48 hours at 30 °C to 37 °C.

[0016] An inoculation amount of the Bacillus amyloliquefaciens is 4 to 8% by volume , and is preferably 5% by volume.

[0017] The fermentation medium can be selected in any of the following:

[0018] (1) It contains the following components by mass percentage: corn starch 0.3%, soybean protein powder 1.5%, corn starch 2.5%, K:HPO4 0.3%, KH2PO4 0.15%, 30.8mg/L MnSO4 0.1%, MgSO4 0.05%, FeSO4 0.01%, CaCOs3 0.01%, pH=7.0 to 7.2.

[0019] (2) It contains the following components by mass percentage: corn starch 0.2%, soybean protein powder 1.5%, yeast extract 0.5%, beef extract 0.15%, K:HPO4 0.3%,

KHz:PO4 0.15%, 30.8 mg/L MnSO4 0.1%, MgSO4 0.05%, FeSO4 0.01%, CaCO3 0.01%, pH=7.0 to 7.2.

[0020] A temperature of the fermenting and culturing is preferably 33 °C to 35 °C.

[0021] Time of the fermenting and culturing is 36 to 40h.

[0022] A ventilation volume of the the fermenting and culturing is 10 to 14 L/min, and is preferably 13L/min.

[0023] A biological bacterial agent of Bacillus amyloliquefaciens, which contains the above Bacillus amyloliquefaciens.

[0024] The Bacillus amyloliquefaciens accounts for 4% to 8% of the mass of the biological bacterial agent, and preferably accounts for 6% of the mass of biological bacterial agent.

[0025] The Bacillus amyloliquefaciens is preferably obtained by the following method: centrifuging the fermentation broth obtained by the above fermentation method at °C to 30 °C and 15000-20000 rpm to obtain the Bacillus amyloliquefaciens cells.

[0026] The biological bacterial agent of Bacillus amyloliquefaciens also contains a carrier and a protective agent. 3

[0027] The carrier is at least one of diatomite, kaolin, light calcium carbonate, LUT03184 bentonite, vermiculite and straw charcoal, and is preferably diatomite and kaolin.

[0028] The carrier accounts for 86% to 93.2% of the mass of the biological bacterial agent, and preferably accounts for 90% of the quality of biological bacterial agent.

[0029] The protective agent is at least one of soluble starch, dextrin, corn flour, sucrose and sodium glutamate and is preferably corn flour, dextrin and sucrose.

[0030] The protective agent accounts for 2.8% to 6% of the mass of the biological bacterial agent, and preferably accounts for 4% of the mass of biological bacterial agent.

[0031] A water content of the biological bacterial agent of Bacillus amyloliquefaciens is lower than 10%, and a cell content is higher than 2x10''cfu/g (preferably higher than 3.2x10"cfu/g)

[0032] A preparation method of the biological bacterial agent of Bacillus amyloliquefaciens comprises the following steps: mixing the Bacillus amyloliquefaciens, the carrier and the protective agent evenly, drying them at 50 °C to 60 °C until the moisture content is less than 10%, crushing them to obtain the biological bacterial agent of Bacillus amyloliquefaciens.

[0033] The method for using the biological bacterial agent of Bacillus amyloliquefaciens is diluting the biological bacterial agent of Bacillus amyloliquefaciens 400 to 500 times, and then mixing with seeds at the seed stage, dipping roots or spraying at the seedling stage, or spraying at the adult plant stage.

[0034] An application of the Bacillus amyloliquefaciens and/or the biological bacterial agent of Bacillus amyloliquefaciens in the prevention and the control of Fusarium root rot of crops and/or Fusarium wilt of crops.

[0035] The Fusarium root rot of crops includes Fusarium root rot of tobacco.

[0036] The Fusarium wilt of crops includes at least one of Fusarium wilt of water melon, Fusarium wilt of cucumber, Fusarium wilt of balsam pear, Fusarium wilt of winter melon and Fusarium wilt of banana.

[0037] The Bacillus amyloliquefaciens in the present invention is isolated from the tobacco rhizosphere soil in Mashi Town, Shixing County, Shaoguan City, Guangdong 4

Province. Its morphological and biochemical characteristics are: on the LB medium, HU108184 the colonies are milky white, round to oval, the edges of the colonies are uneven, serrated, the colonies are flat, slightly concave in the middle, and the surface is rough and dry. The cell is short and straight rod, with the size of 0.7 to 0.9umx1.8 to 3.0um, is Gram-positive, and can produce spores. It is nitric acid reduction positive, can hydrolyze starch, liquefy gelatin and casein. A suitable growth temperature is 30 °C to 37 °C, and a suitable growth pH is 5.7 to 7.8.

[0038] Compared with the prior art, the invention has the following advantages and effects:

[0039] 1. The present invention uses Fusarium oxysporum in Guangdong Province as the target to screen Bacillus amyloliquefaciens GDNXJ-5 with obvious biocontrol effect against the pathogen. The GDNXJ-5 strains can obviously inhibit the pathogenic Fusarium of many crops, and can be used to control the Fusarium wilt (root rot) of many crops, especially Fusarium root rot of tobacco.

[0040] 2. The Bacillus amyloliquefaciens GDNXIJ-5 with biocontrol effect provided by the present invention Biological agents are environmentally friendly, with no pesticide residues, low fermentation cost, and simple production process, which provide an effective way to explore the biological control of fusarium wilt (root rot) of plants.

[0041] 3. In the present invention, liquid fermentation of Bacillus amyloliquefaciens

GDNXJ-5 and centrifugation are carried out to obtain cells, and then the cells is mixed with a carrier and a protective agent, dried and crushed to produce the biological bacterial agent; The biological agent can be used in the seed stage, seedling stage and adult plant stage, that is, seed dressing, seedling spraying or root dipping, and field spraying can be used to prevent and control fusarium wilt (root rot) of crops, and the biological bacterial agent can effectively proliferate in the soil to continuously control diseases; In addition, the biological bacterial agent has outstanding control effect on Fusarium root rot of tobacco. After being diluted 400 to 500 times and applied for 21 days, the control effect of the biological agent on the disease reached more than 80%, which can provide a new reserve biological agent for the control of the disease. HU109184

Description of drawings

[0042] Figure 1 shows the culture morphology of Bacillus amyloliquefaciens

GDNXIJ-5 on LB medium.

[0043] Figure 2 shows the inhibitory effect of Bacillus amyloliquefaciens GDNXJ-5 on Fusarium oxysporum.

[0044] Figure 3 shows the statistical results of cell contents and spore rates of Bacillus amyloliquefaciens GDNXIJ-5 at different fermentation temperatures.

[0045] Figure 4 shows the statistical results of cell contents and spore rates of Bacillus amyloliquefaciens GDNXJ-5 at different fermentation time.

[0046] Figure 5 shows control effect of biological bacterial agent of Bacillus amyloliquefaciens GDNXJ-5 on Fusarium oxysporum.

Detailed description of embodiments

[0047] The invention will be further described in detail below in combination with the embodiment, but the embodiment of the invention is not limited to this. Unless otherwise specified, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in the technical field.

The test method without specific experimental conditions specified in the following examples is usually based on conventional experimental conditions. Unless otherwise specified, the reagents and raw materials used in the invention can be commercially available.

[0048] The invention relates to Fusarium oxysporum, Fusarium oxysporum f. sp. niveum, F. oxysporum f. sp. cucumerium, F. oxysporum f. sp. momdicae, F. oxysporum f sp. Benincase, F. oxysporum f. sp. cubense race 1 and F. oxysporum f. sp. cubense race 4 are all common pathogens in the field. The pathogens used in the examples are stored in the Institute of Plant Protection Research Institute Guangdong Academy of

Agricultural Sciences (which has been tested for pathogenicity and classified identification). 6

[0049] Example 1: Screening and identification of biocontrol bacteria HU108184

[0050] (1) Isolation of bacteria at tobacco rhizosphere

[0051] Soil samples were collected from the rhizosphere of tobacco growing areas in

Shaoguan, Meizhou and Qingyuan city in Guangdong, 1g of samples was separately weighed, 50 mL of sterile water was added to shake for 10 min, and then let them stand. The supernatant was take and diluted with sterile water to 10°, 10* and 10° gradient concentrations. 0.1 mL of diluents was taken to inoculate to LB (tryptone 10g, yeast extract 5g, NaCl 10g, agar 20g, water 1L, pH=7) plates, and was evenly spread, each treatment was repeated in 5 culture dishes, and the dishes were incubated at 32 °C for 48h. A single colony was picked and inoculated to a LB slope, was incubated at 32 °C for 48h, and was stored at 4 °C for standby.

[0052] (2) Screening of biocontrol bacteria

[0053] Screening was carried out by means of confrontation culture, with Fusarium oxysporum as the target. the bacterial mycelium block with a diameter of 6mm was inoculated to the center of the PDA plate (200g potatoes were peeled, washed and chopped, boiled for 30min and filtered; the liquid was taken and 20g glucose and 20g agar was added into the liquid, water was added to bring to the volume of 1L, and the mixture was poured into the culture dish after sterilization), and was cultured at 26 °C for 24h. Round filter paper pieces (6mm in diameter) of the bacteria obtained in step (1) were inoculated to a place 4cm away from the bacterial mycelium block, four filter paper pieces were inoculated to each dish, and each treatment was repeated in three culture dishes, and the dishes were incubated for 96 hours at 28 °C. The growth of the bacteria was observed, and the bacteria that produced obvious bacteriostatic zones were selected for storage. The width of inhibition zone (inhibition circle) of 6 strains is more than 10mm, as shown in Table 1. The strain with the number of

GDNXJ-S has the strongest inhibitory effect, with an average width of 18.23 mm, and the inhibitory effect on Fusarium oxysporum was shown in Figure 2.The strain

GDNXJ-5 was isolated from the tobacco rhizosphere soil in Mashi Town, Shixing

County, Shaoguan City, Guangdong Province.

[0054] Table 1Inhibitory effect of biocontrol bacteria on Fusarium oxysporum 7

[0056] (3) Inhibitory effect of strain GDNXJ-5 on different pathogens causing

Fusarium wilt (root rot) of crops.

[0057] The research method is the same as the screening of biocontrol bacteria in step (2). The pathogenic Fusarium are respectively Fusarium oxysporum f. sp. niveum, EF oxysporum f. sp. cucumerium, F. oxysporum f. sp. momdicae, F. oxysporum f sp.

Benincase, F. oxysporum f. sp. cubense race 1 and F. oxysporum f. sp. cubense race 4.

The bacteriostatic effect of strain GDNXJ-5 on Fusarium in different crops was tested, and the result was shown in Table 2.

[0058] Strain GDNXJ-5 had obvious inhibitory effect on seven pathogens causing

Fusarium wilt (root rot) of crops, and had the strongest inhibitory effect on Fusarium. oxysporum, with the inhibitory zone of 18.33 mm, followed by the inhibitory effect on

FE. oxysporum f. sp. cubense race 1 and F. oxysporum f. sp. cubense race 4, with the inhibitory zone of 18.25 mm and 17.58 mm, respectively.

[0059] Table 2 The inhibitory effect of strain GDNXJ-5 on seven kinds of pathogens causing fusarium wilt (root rot) of crops. zone (mm) 8

[0061] (4) Morphological characteristics and physiological and biochemical characteristics of Strain GDNXJ-5

[0062] Strain GDNXJ-5 was streak-inoculated on LB medium, cultured at 32 °C for 48h, and its morphological characteristics were observed, and carry out physiological and biochemical characteristics tests such as Gram staining according to Fang

Zhongda (Beijing: Science Press, 1996. Fang Zhongda. Plant disease research methods (second edition)), spore staining, temperature, pH, aerobic test, nitric acid reduction test, hydrolysis of macromolecular compounds, etc.

[0063] The results were as shown in Figure 1: the results showed that on LB medium, the colonies were milky white, round to oval, the edges of colonies are uneven, serrated, flat, dry, wrinkled, slightly sunken in the middle, rough, and free of soluble pigments. The cell is short and straight, and can produce spores, with the size of 0.7 to 0.9umx1.8 to 3.0um, is a Gram-positive bacteria, with suitable growth temperature of °C to 37 °C, suitable growth pH of 5.7 to 7.8, is nitric acid reduction positive, and can hydrolyze starch, liquefy gelatin and casein.

[0064] (5) 16s IDNA sequence analysis of strain GDNXJ-5.

[0065] The genome DNA of strain GDNXJ-5 was used as template, the 16s rDNA sequence was selected by primer F27 (5S'-AGAGTTTGATCATGGCTCAG-3") and

R1492 (5 -TACGGTTACCTTGTTACGA CTT-3 ') as primer, and the 16s rDNA gene fragment was amplified by PCR. The PCR products were recovered with DNA gel, purified with the purification kit, and then entrusted to Shanghai Biological

Engineering Co., Ltd. for sequencing. The sequence is shown in SEQ ID NO. 1. The obtained sequence was analyzed for Blast homology through NCBI database, and a phylogenetic tree was constructed using MEGAS5.0 software to obtain the phylogenetic status of strain GDNXJ-5.

[0066] The similarity analysis and construction of phylogenetic tree of the 16s rDNA sequence of the strain GDNXJ-The of 5 were carried out. It was found that the strain had the closest genetic relationship with the published B. amyloliquefaciences (GenBank accession number NR_041455.1), with a homology rate of 99.65%.The 9 phylogenetic tree and the B. amyloliquefaciences are clustered into one branch. HU108184

[0067] The 16s IDNA sequence is as follows (SEQ ID NO. 1):

[0068] ctaatacatgcaagtcgagcggacagatgggagcettgetcectgatgttagcggeggacgggtgagta acacgtgggtaacctgcctgtaagactgggataactccgggaaaccggggctaataccggatggttgtctgaaccg catggttcagacataaaaggtggcttcggetaccacttacagatggaccegeggegceattagetagttggtgagst aacggctcaccaaggcgacgatgegtageccgacctgagagggtgatcggecacactgggactgagacacggeccag actcctacgggaggcagcagtagggaatcttccgcaatggacgaaagtctgacggageaacgecgegtgagtgatg aaggttttcggatcgtaaagetctgttgttagggaagaacaagtgcecgticaaatagggeggeaccttgacggta cctaaccagaaagccacggctaactacgtgccageagecgeggtaatacgtaggtggcaagegttgtcecggaatta ttgggcgtaaagggctcgecaggeggtttcttaagtctgatgtgaaageceeccggetcaaccggggagggteattgg aaactggggaacttgagtgcagaagaggagagtggaattccacgtgtageggtgaaatgcgtagagatgtggagga acaccagtggcgaaggcgactctctggtctgtaactgacgetgaggagegaaagegtggggagegaacaggattag ataccctggtagtccacgeccgtaaacgatgagtgetaagtgttagggggtttccgececttagtgetgeagetaac gcattaagcactccgectggggagtacggtcgcaagactgaaactcaaaggaattgacgggggcccgecacaagegg tggagcatgtggtttaattcgaagcaacgecgaagaaccttaccaggtcttgacatcctctgacaatcctagagata ggacgtceecttcgggggcagagtgacaggtggtgcatggttgtegtcagetegtgtegtgagatgttgggttaag teccgcaacgagcgcaaccettgatcttagttgccagcattcagttgggcactctaagetgactgccgetgacaaa ccggaggaagetggegatgacgtcaaatcatcatgceccttatgacctggectacacacgtectacaatggacaga acaaagggcagegaaaccgcgaggttaagccaateccacaaatctettetcagttcggatcgcagtctgcaactcg actgcgtgaagctggaatcgctagtaatcgeggatcageatgeegeggtgaatacgttccecgggecttgtacacac cecccgtcacaccacgagagtttgtaacacccgaagtcggtgaggtaacctttatggagccagccgccgaao

[0069] (6) Determination of classification status of strain GDNXJ-5.

[0070] According to colony phenotype, physiological and biochemical characteristics of strain GDNXJ-5, combined with 16s rDNA sequence analysis results, strain

GDNXJ-5 was identified as Bacillus amyloliquefaciens GDNXJ-5. The strain was deposited in Guangdong Microbial Culture Collection Center on November 11, 2021, with the deposit number of GDMCC No. 62051.

[0071] Example 2: Fermentation technology research of Bacillus amyloliquefaciens

GDNXJ-5.

[0072] (1) Selection of fermentation medium

[0073] Six kinds of fermentation medium for Bacillus amyloliquefaciens were HU108184 prepared according to the references. Each 1L triangular flask was filled with 200 mL of fermentation medium. After sterilization, 10 mL bacterial solution of GDNXJ-5 (concentration: 109 cfu/mL) was added. Each treatment was repeated in five groups, and the flasks were put into the shaking table for culture, the culture temperature was 34 °C, the rotation speed was 180 rpm, and after 40 hours of culture, the bacterial amount was measured by plate counting method, and the spore rate was measured by malachite green staining method. Among them,

[0074] Six fermentation media are as follows:

[0075] © Glucose 2%, soluble starch 1%, peptone 0.5%, beef extract 1%, K;HPO4 0.3%, KH2PO4 0.15%, 30.8mg/L MnSO4 0.1%, MgSO4 0.05%, FeSO4 0.01%, CaCO3 0.01%, pH=7.0.

[0076] @ Glucose 1.5%, soluble starch 1%, soybean pulp 3%, K2HPO40.3%,

KHz:PO4 0.15%, 30.8 mg/L. MnSO4 0.1%, MgSO4 0.05%, FeSO4 0.01%, CaCO; 0.01%, pH=7.0.

[0077] @ Glucose 1.5%, soluble starch 1%, corn starch (solid content: 50%) 2.5%,

K,HPO40.3%, KH2PO4 0.15%, 30.8 mg/L MnSOs 0.1%, MgSO4 0.05%, FeSO4 0.01%, CaCO4 0.01%, pH=7.0.

[0078] @ Soluble starch 3%, bean cake powder 2%, KoHPO4 0.3%, KH2PO4 0.15%, 30.8 mg/L. MnSO4 0.1%, MgSO4 0.05%, FeSO4 0.01%, CaCO3 0.01%, pH=7.0.

[0079] © Corn starch 0.3%, soybean protein powder 1.5%, corn syrup (solid content: 50%) 2.5%, K2HPO4 0.3%, KH2PO4 0.15%, 30.8 mg/L. MnSO4 0.1%, MgSO4 0.05%,

FeSO4 0.01%, CaCOz 0.01%, pH=7.0.

[0080] @ Corn starch 0.2%, soybean protein powder 1.5%, yeast extract 0.5%, beef extract 0.15%, K2HPO40.3%, KH:PO4 0.15%, 30.8 mg/L MnSO4 0.1%, MgSO4 0.05%, FeSO4 0.01%, CaCO3 0.01%, pH=7.0.

[0081] Note: The above percentages are mass percentages.

[0082] After 40 hours of fermentation and culture, the bacterial amount and spore rate of different fermentation media were shown in Table 3. Among them, the bacterial 11 count of fermentation culture medium No. © is the highest after 40 hours of HU103184 culture, reaching 6.48x10° cfu/mL, followed by culture medium No. ©, with a bacterial count of 6.20x10° cfu/mL, the difference of spore rate between the two mediums was not significant, both were above 93%. Considering that the production cost of culture medium No. © is relatively low, culture medium No. © is selected as the fermentation culture medium for Bacillus amyloliquefaciensGDNXIJ-5.

[0083] Table 3 Bacillus amyloliquefaciens GDNXIJ-5. The amount of bacteria and the spore rate in different fermentation media.

[0085] Note: Different figures after the same column indicate significant differences

Note: Different letters after numbers in the same column indicate significant differences at the level of p=0.05.

[0086] (2) Determination of fermentation temperature

The fermentation culture medium No. © was prepared. Each 1L triangular flask was filled with 200 mL of fermentation medium. After sterilization, 10 mL bacterial solution of GDNXJ-5 (concentration: 109 cfu/mL) was added. The flasks were put into a shaker for culture. The culture temperature was set at 31 °C, 32 °C, 33 °C, 34 °C, 35 °C, 36 °C, 37 °C, a total of 7 temperatures. The rotation speed was 180 rpm.

Each treatment is repeated in 5 groups. After 40 hours of culture, the flasks were taken out. The plate counting method was used to determine the amount of bacteria, and the malachite green staining method was used to determine the spore rate.

[0088] After 40 hours of culture, the bacterial count and spore rate are shown in

Figure 3: at 33 °C, 34 °C and 35 °C, the bacterial count is relatively large, respectively reaching 6.24x10° cfu/mL, 6 .46x10° cfu/mL and 6.22x10° cfu/mL, and 12 there is no significant difference in the amount of bacteria, and the spore rate at three HU108184 temperatures is more than 93%, so 33 °C to 35 °C is the suitable fermentation temperature.

[0089] (3) Determination of fermentation cycle

[0090] Fermentation culture medium No. © was prepared. Each 1L triangular flask was filled with 200 mL of culture medium. After sterilization, 10 mL bacterial solution of GDNXIJ-5 (concentration: 109 cfu/mL)is inoculated. The flasks were put into a shaker for culture, the culture temperature was set at 34 °C, The rotation speed was 180 rpm. After culture for 24, 28, 32, 36, 40, 44, 48 hours respectively, the flasks were taken out. Each treatment was repeated in 5 groups, The plate counting method was used to determine the amount of bacteria, and the malachite green staining method was used to determine the spore rate.

[0091] Bacterial count and spore rate of different fermentation time were shown in

Figure 4: Bacillus amyloliquefaciens grew rapidly in 24 to 36h. After the logarithmic growth period, it was close to the equilibrium period after 40h, and the increase of bacterial count slowed down significantly. When the fermentation time is 36h, the bacteria count reaches 5.84x10° cfu/mL, the bacterial count reaches 6.24x10° cfu/mL at 40h, the amount of bacteria will not increase significantly after that. From the perspective of practical economy, the fermentation time of 36 to 40h is suitable.

Additionally, the spore rate of 36 to 40 h was above 92%.

[0092] Example 3: Fermentation of Bacillus amyloliquefaciens GDNXJ-5

[0093] (1) Seed culture: 10 mL of bacterial solution of strain GDNXJ-5 (concentration: 10° cfu/mL) was inoculated into a 1L triangular flask filled with 200 mL of seed culture medium (beef extract 0.3%, yeast extract 0.1%, peptone 0.5%, glucose 1%, pH=7.0.the percentages were all mass percentages), and was then put into a shaker for culture. The temperature was 34 °C, the rotational speed was 190 rpm, and the culture time was 15h.

[0094] (2) Fermentation culture: 100L fermentation tank was filled with 70L fermentation medium (corn starch 0.3%, soybean protein powder 1.5%, corn syrup 2.5%, K2HPO4 0.3%, KH2PO4 0.15%, 30.8mg/L MnSO4 0.1%, MgSO4 0.05%, FeSO4 13

0.01%, CaCOs3 0.01%, Paodi (defoaming agent) 0.06%, pH=7.0; The percentage is all HU108184 the mass percentage). After sterilization, the seed was inoculated into the fermentation tank according to 8%, and was cultured at the temperature of 34 °C and the ventilation volume of 13 L/min.

[0095] (3) End of fermentation: after 24 hours of culture, samples were taken every 4 hours, and the bacterial count and spore rate were observed under the microscope.

After 38 hours of fermentation, the spore formation rate is 93%, and the bacterial count reaches 5.40x10° cfu/mL, fermentation was ended.

[0096] Example 4: Preparation of a biological bacterial agent of Bacillus amyloliquefaciens GDNXJ-5.

[0097] Bacillus amyloliquefaciens GDNXIJ obtained from example 3 to 5 was centrifuged at 28 °C and 18000 rpm to obtain the cells. The bacteria cells were mixed with the carrier and the protective agent to prepare the biological bacteria agent;

Among them, the proportion of carrier and protectant is as follows: 6% of fermented dry matter (i.e. bacteria cells), 20% of diatomite, 70% of kaolin, 1.5% of corn flour, 1.5% of dextrin, and 1% of sucrose (all mass fractions). After evenly mixed, the mixture was dried at 55 °C until the relative humidity of water is less than 10%, and was crushed to obtain a biological bacterial agent of Bacillus amyloliquefaciens

GDNXJ-5, and the amount of bacteria in the biological bacteria agent is 3.2x10Mcfu/g.

[0098] Example 5: Prevention and control Effect of the biological bacterial agent of

Bacillus amyloliquefaciens GDNXJ-5 on Several Fusarium Wilt (Root Rot) diseases of crops in Pot

[0099] (1) Biological bacterial agent: the biological bacterial agent was prepared according to the method of Example 4, with a bacterial amount of 3.2x10!!cfu/g.

[0100] (2) Preparation of Fusarium spore suspension: Fusarium oxysporum,

Fusarium oxysporum f. sp. niveum, F. oxysporum f. sp. cucumerium, F. oxysporum f. sp. momdicae, F. oxysporum f sp. Benincase, F. oxysporum f. sp. cubense race 1 and EF. oxysporum f. sp. cubense race 4 were respectively inoculated into PDA culture solution (200g potatoes are peeled, washed and chopped, boiled for 30min, filtered, 14

20g glucose is added to the liquid, water is added to bring to the volume of 1L, HU108184 sterilized), and the mixture was put into a shaker at 26 °C, was cultured for 96h at 150 rpm, was filtered to removed hyphae to obtain spore suspension, and the spore suspension was diluted to 10° cfu/mL with sterile water containing 0.05% (w/v) sucrose.

[0101] (3) Prevention and control test: the method of inoculating bacteria on injured roots first and then spraying biological agents was used to study the prevention and control effect of the biological bacterial agent on fusarium wilt (root rot). Tobacco, watermelon, cucumber, balsam pear, winter melon and banana seedlings were selected with basically the same growth period, and each seedling has 4 to 5 leaves. Parts of the roots were cut off with scissors to cause root trauma. The roots were dipped into the above Fusarium spore suspension respectively. After soaking and inoculation for 6 hours, seedlings were taken out and transplanted into a pot, and then were cultured in a greenhouse at 26 °C to 28 °C. The pots were Sprayed every day to wet the soil, which was conducive to disease occurrence. After 5 days of culture, the biological bacterial agent was diluted with water respectively 400 times and 500 times, and 10 mL of the dilute was sprayed on the root soil of crop seedlings of each plant, and the control was sprayed with sterile water, and then they were cultured in the greenhouse.

Each treatment was repeated in 30 seedlings. The occurrence of diseases was observed and recorded on 7, 14 and 21 days after spraying biological bacterial agents, the disease index and control effect were calculated, taking the mean value of three replicates; among them,

[0102] the disease grading standard and calculation formula are as follows:

[0103] Grading investigation standard of Fusarium wilt: Level 0: no symptoms of plants; Level 1: cotyledons were slightly chlorotic or withering; Level 2: cotyledons were chlorotic or withering; Grade 3: seedlings plants were slightly chlorotic or withering; Level 4: seedling plants were moderately chlorotic or withering ;Grade 5: the whole plants were withering or chlorotic.

[0104] Disease index=) (disease grade valuexNumber of plants of the disease grade)/(number of the highest gradexNumber of investigated plants)x100%.

[0105] Control effect=(control disease index - treatment disease index)/control HU103184 disease indexx100% .

[0106] (4) Result

[0107] The control effect of the potted plants was shown in Table 4. When the bacterial agent of Bacillus amyloliquefaciens GDNXJ-5 was diluted 500 times, the control effect on Fusarium wilt (root rot) diseases of tobacco, watermelon, cucumber, balsam pear, winter melon and banana was respectively 80.20%, 63.71%, 61.94%, 57.29%, 64.61% and 52.77% 21 days after application; When diluted 400 times, the control effect on Fusarium wilt (root rot) diseases of tobacco, watermelon, cucumber, balsam pear, winter melon and banana was respectively 81.25%, 71.78%, 70.79%, 66.67%, 70.00% and 56.93% 21 days after application. The results showed that the biological agent was particularly effective in the control of Fusarium root rot of tobacco. The control effect reached 80% 21 days after the application of the biological agent, which was higher than the control effect of other five Fusarium wilt diseases of other crops. Because the biological agent came from tobacco root soil, it had obvious competition and inhibition effect on tobacco rhizome pathogen in order to expand the living space. Although the biocontrol bacterial has a strong inhibitory effect on F oxysporum f. sp. cubense race 4 with an inhibitory zone of 18.25mm, pot experiments show that the biocontrol bacterial has a poor control effect on Fusarium wilt disease of banana. When diluted 400 times, the control effect on Fusarium wilt disease of banana is only 56.93% 21 days after application.

[0108] When the biological bacterial agent of Bacillus amyloliquefaciens GDNXJ-5 was diluted 500 times, the control effects on Fusarium Root Rot of tobacco in potted plants were respectively 71.16%, 78.21% and 80.20% after 7, 14 and 21 days of application; When that was diluted 400 times, the control effects in potted plants were respectively 74.99%, 80.77% and 81.25% after 7, 14 and 21 days of application. It can be seen that the control effect of Bacillus amyloliquefaciens GDNXJ on Fusarium root rot of tobacco is continuously improved with the extension of the application time of the bacterial agent, which indicates that Bacillus amyloliquefaciens GDNXJ-5 can colonize and multiply in the soil, so as to continuously control the spread of 16 disease. LU103184

[0109] Table 4 Control effect of the biological bacterial agent of Bacillus amyloliquefaciens GDNXJ-5 on six fusarium wilt (root rot) diseases of crops in potted plants. 17

Preventio 7 days after Mr Mr n and 14 days after application | 21 days after application control Control targets Diluti ffect no Disease | Control Disease cree Disease Control index effect index index effect (%) (%) (%) (%) (%) (%)

Fusarium 74.99 10.00 80.77 12.00 81.25 root rot of 10.00 | 71.16 11.33 78.21 12.00 81.25 tobacco CK (sterile 34.67 52.00 64.00 water)

Fusarium 1533 | 58.93 19.33 69.48 23.33 71.78 wilt 1733 | 53.58 24.67 61.04 30.00 63.71 diseases of CK (sterile | 37.33 63.33 82.67 watermel water) on

Fusarium 1333 | 60.79 17.33 69.77 22.00 70.79 wilt 16.67 | 50.97 24.00 58.14 28.67 61.94 diseases CK of (sterile | 34.00 57.33 75.33 cucumber | water)

Fusarium 1333 | 56.53 18.67 62.66 21.33 66.67 wilt 16.00 | 47.83 22.67 54.66 27.33 57.29 diseases CK of balsam | (sterile | 30.67 50.00 64.00 pear water)

Fusarium 18.00 | 55.74 21.33 67.35 26.00 70.00 wilt 2133 | 4755 26.00 60.21 30.67 64.61 diseases CK of winter | (sterile | 40.67 65.33 86.67 melon water)

Fusarium 12.67 | 4241 17.33 53.58 20.67 56.93 wilt 1400 | 36.36 19.33 48.22 22.67 52.77 diseases CK of banana | (sterile | 22.00 37.33 48.00 water) 18

[0111] Example 6: The protective effect of the biological bacterial agent of Bacillus HU108184 amyloliquefaciens GDNXJ-5 on tobacco.

[0112] (1) Biological bacterial agent: the biological bacterial agent was prepared according to the method of Example 4, with a bacterial amount of 3.2x10!!cfu/g.

[0113] (2) Preparation of Fusarium spore suspension: the spore suspension of

Fusarium oxysporum was prepared by the method in step (2) of Example 5, with a concentration of 108 cfu/mL.

[0114] (3) Pot experiment: The method of spraying biological agents first and then inoculating pathogenic bacteria was used to study the protective effect of biological agents on plants. Tobacco seedlings with basically the same growth period were selected, and each seedling had 4 to 5 leaves. The biological bacterial agent was diluted 400 times and 500 times with water, sprayed towards tobacco root soil, 10 mL for each plant, and in the control group sterile water was sprayed instead. The seedlings were cultured in a greenhouse at 26 °C 28 °C for 5d.The sterilized slender bamboo stick was randomly and deeply inserted into the soil of the root of tobacco seedlings for 20 times, causing serious damage to the root of tobacco seedlings. Then mL of bacterial spore suspension with a concentration of 10% cfu/mL was poured into the soil of the root of each tobacco plant, and continued to be placed in the greenhouse for moisture culture. Each treatment was repeated in 30 tobacco seedlings.7, 14 and 21 days after inoculation, the disease occurrence was observed and recorded, the disease index and control effect were calculated; the disease classification and calculation formula are the same as that in Example 5.

[0115] (4) The protection effects on potted plants were shown in Figure 5 (21 days after inoculation) and Table 5. When the biological agent was diluted 500 times, the protection effects of potted plants were respectively 77.77%, 82.42%, and 85.05%, 7, 14, and 21 days after application; When that was diluted 400 times, the protection effects of potted plants were respectively 82.23%, 86.48%, and 86.21% after 7, 14, and 21 days of application. It can be seen that biological agents can continuously protect tobacco plants and reduce the infection and damage of Fusarium, and their effect on disease control is higher than that of inoculating bacteria first and then 19 applying biological agents. Therefore, it is suggested that biological agents can be applied in advance to prevent disease occurrence in the high disease incidence period.

[0116] Table 5 Protective effect of biological bacterial agents of Bacillus amyloliquefaciens GDNXJ-5 on tobacco 14 days aft 7 days after application 21 days after application application

Diluti Control ae Disease Control Disease toot Disease Control index effect index index effect (%) (%) (%) (%) (%) (%) 82.23 86.48 86.21 71.77 82.42 85.05

CK 30.00 49.33 58.00 (water)

[0118] The above embodiment is a preferred embodiment of the invention, but the embodiment of the invention is not limited by the above embodiment. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principle of the invention should be equivalent replacement methods, and are included in the protection scope of the invention.

Claims

1. À strain of Bacillus amyloliguefaciens, characterized in that: its name is Bacillus amvioliquefaciens GDNXI-S, is deposit number is GDMCC No, 62051, and if was deposited on November 11, 2021 in the Guangdong Microbial Culture Collection Center, which is located at Guangdong Institute of Microbiology, 5th Floor, Building 39, No. 100 Xianliezhong Road, Guangzhou City, Guangdong Province.

2. À method for culturing the Bacillus amyloliguefaciens as claimed in claim |, characterized in that it comprises the following steps: inoculating the Bacillus amyloliquefaciens into a seed culture medium, and culturing it al a condition of 30 °C to 37 °C; and the seed culture medium contains the following components by mass percentage: beef extract 0.3%, veast extract 0.19, peptone 0,5%, glucose 1%, pH=7.0 to 7.2; and time of the culturing is 12 to 16h,

3. À fermentation method of Bacillus emvioliquefaciens, characterized in that it comprises the following steps: inoculating the Bacillus amvioliquefaciens as claimed in claim 1 into a fermentation medium, and fermenting and culturing at 30 °C to 37 °C for 24 to 48h; and the fermentation medium can be selected in any of the following: {Dit contains the following components by mass percentage: corn starch 0,3%, soybean protein powder 1.5%, com syrup 2.5%, KHPO4 0.3%, KH:PO 0.15%,

30.8mge/L MnS O4 0.19%, MO. 0.05%, FeSO 0.01%, Calls 001%, pH=7,0 to 7.2; and (Z)it contains the following components by mass percentage: com starch 0.2%, soybean protein powder 1.5%, yeast extract 0,5%, beef extract 0.15%, Ko HPO, 8.3%, KH; PO, 0.15%, 30.8mg/l Mas 0.1%, MgiG 4 0.05%, FelQ, 0.01%, Call

0.01%, pH=70 to 7.2.

4. The fermentation method of Bucillus amvloliquefaciens according to claim 3, characterized in that: 21 an inoculation amount of the Bacillus amyioliguefaciens is 4 to 8% by volume: HU108184 time of the fermenting and colturing is 36 to 40h; and a ventilation volume of the fermenting and culturing is 10 to 14L/min.

5. A biological bacterial agent of Bacillus amvlnliquefaciens, characterized in that it contains the Bacillus amyloliquefaciens as claimed in claim 1,

6. The biological bacterial agent of Bacillus amvioliguefaciens according to claim 5, characterized in that: the Bacillus emviolique{aciens accounts for 4% to 8% of the mass of the biological bacterial agent; the water content of the Bacillus amyiloliquefaciens biological agent is lower than 10%, and the cell content is higher than 2x10 fue; the biological bacterial agent of Bacillus empyloliguefaciens also coantains a carrier and a protective agent; the carrier is at least one of diatomite, kaolin, light calcium carbonate, bentonite, vermiculite and grass carbon; the carrier accounts for 86% to 93.2% of the mass of the biological bacterial agent: the protective agent is at least one of soluble starch, dextrin, com flour, sucrose and sodium glotamate; and the protective agent accounts for 2.8% to 6% of the mass of the biological bacterial agent.

7. À preparation method of the biological bacterial agent of Bacillus amviolique{aciens as claimed in claun 5 or 6, characterized in that, it comprises the following steps: mixing the Bacillus amyloliguefociens, carrier and protective agent evenly, then drying them at 30 °C to 60 °C until the moisture content is less than 10%, and crushing them to obtain the biological bacterial agent of Bacillus amvioliquefaciens.

8. À method for using the biological bacterial agent of Bacillus amyloliquefaciens as claimed in claim 5 or 6, characterized in diluting the biological bacterial agent of Bacillus emvioliquefaciens ADD to 500 times, and mixing with seeds ai the seed stage, dipping roots or spraying at the seedling stage, or spraying at the adult stage. 22

9. An application of the Bacillus amyloliquefaciens claimed in claim 1 and/or the HU108184 biological bacterial agent of Bacillus amyloliguefaciens claimed in any one of claims to & in the prevention and the control of Fusarium root rot of crops and/or fusarium wilt of crops.

10. The application according to claim 9, characterized in that: the Fusarium root rot of crops is Fusarium root rot of tobacco; and the fusariion wilt of crops is at least one of Fusarium will of water melon, Fusarium wilt of cucumber, Fusariion wilt of balsam pear, Fusarium wilt of winter melon and Fusarhon wilt of banana. 23