CN115028744B

CN115028744B - Foot-and-mouth disease virus VP1 chimeric nanoparticle and preparation method and application thereof

Info

Publication number: CN115028744B
Application number: CN202210771918.0A
Authority: CN
Inventors: 郭慧琛; 孙世琪; 白满元; 裴辰辰; 董虎; 张韵; 吴金恩; 尹双辉; 丁耀忠; 何继军; 靳野; 刘在新
Original assignee: Lanzhou Veterinary Research Institute of CAAS
Current assignee: Lanzhou Veterinary Research Institute of CAAS
Priority date: 2022-06-30
Filing date: 2022-06-30
Publication date: 2023-05-09
Anticipated expiration: 2042-06-30
Also published as: CN115028744A

Abstract

The invention provides foot-and-mouth disease virus VP1 chimeric nanoparticle, and a preparation method and application thereof, and relates to the technical field of biological medicine. The VP1 chimeric nanoparticle is obtained by covalently connecting an O-type/A-type foot-and-mouth disease virus structural protein VP1 and a natural protein nano-skeleton protein. When the VP1 chimeric nanoparticle is prepared, the VP1 structural protein is covalently connected through the protein skeleton, the VP1 structural protein is displayed outside the nano cage, and the small ubiquitin-like modified protein prokaryotic expression system is adopted, so that the correct folding of target proteins is promoted, the soluble expression is improved, and the advantages of high expression efficiency, low cost and the like of the prokaryotic expression system are also considered. The O type/A type foot-and-mouth disease virus VP1 chimeric nanoparticle can be applied to the preparation of vaccines for preventing diseases caused by the O type/A type foot-and-mouth disease virus, and also can be applied to the preparation of detection reagents for detecting the O type/A type foot-and-mouth disease virus.

Description

Foot-and-mouth disease virus VP1 chimeric nanoparticle and preparation method and application thereof

Technical Field

The invention belongs to the technical field of biological medicines, and particularly relates to foot-and-mouth disease virus VP1 chimeric nano-particles, and a preparation method and application thereof.

Background

Foot-and-mouth disease (Foot andmouth disease, FMD) is an acute, febrile, highly contagious disease caused by foot-and-mouth disease virus, mainly affecting artiodactyls such as pigs, cows, sheep, etc. Because of its strong infectivity, it occurs almost worldwide, severely affecting the health and sustainable development of animal husbandry, and also limiting the supply and trade of susceptible animals and their related products, thereby producing significant economic impact. The epidemic disease is determined to be the first period immune purification prevention and control in the national animal epidemic disease prevention and control long-term development planning. At present, an inactivated vaccine is mainly used for immune prevention and control at home and abroad, but the biological safety problem of toxin dispersion can be caused in the vaccine production process, and the purification requirement in animal epidemic disease prevention and control can not be met. Therefore, the development of a safe and efficient novel vaccine has important practical significance.

In recent years, with the development of nanoscience, platforms such as virus-like particles and nanoparticles have been developed. With the development of computer technology, more and more self-assembled symmetrical nano-protein frameworks (nano-cages) are designed by utilizing biological information technology. The nano cage structure developed by utilizing the natural protein has higher stability, and has wide application in biomedicine such as vaccine, drug delivery and the like, and has wide development prospect.

As main antigen protein of foot-and-mouth disease virus, VP1 structural protein has better immunogenicity, and researches show that the anti-swine O type/A type foot-and-mouth disease genetic engineering vaccine developed through VP1 structural protein can generate good protection. Although traditional prokaryotic expression is more efficient and less costly, it is often present in insoluble inclusion forms due to the lack of correct modified folding. Foot and mouth disease virus VP1 protein is typically an insoluble protein. How to prepare the corresponding nano-particles by utilizing foot-and-mouth disease virus VP1 protein and improve the soluble expression is a difficult problem which needs to be overcome in establishing nano-particle vaccines and/or detection reagents.

Disclosure of Invention

Therefore, the invention aims to provide foot-and-mouth disease virus VP1 chimeric nanoparticle, and a preparation method and application thereof, which can promote the correct folding of the chimeric nanoparticle, improve the soluble expression, and simultaneously have the advantages of high expression efficiency, low cost and the like of a prokaryotic expression system.

In order to achieve the above object, the present invention provides the following technical solutions:

the invention provides a foot-and-mouth disease virus VP1 chimeric nanoparticle, which comprises VP1 protein and natural protein skeleton protein of O-type/A-type foot-and-mouth disease virus which are covalently connected.

Preferably, the covalent connection is further preceded by codon optimization of VP1 protein and natural protein skeleton protein of the O-type/A-type foot-and-mouth disease virus respectively, and the covalent connection is carried out after the optimization.

Preferably, after the covalent connection, the coding gene sequence of the obtained chimeric nanoparticle of the O-type foot-and-mouth disease virus VP1 is shown as SEQ ID NO. 1; the coding gene sequence of the obtained foot-and-mouth disease virus VP1 chimeric nanoparticle is shown as SEQ ID NO. 2.

The invention also provides a preparation method of the VP1 chimeric nanoparticle, which comprises the following steps: (1) Respectively carrying out codon optimization on VP1 protein and natural protein skeleton protein of the O-type/A-type foot-and-mouth disease virus, respectively carrying out covalent connection on the VP1 protein and the natural protein skeleton protein of the O-type foot-and-mouth disease virus after optimization and the VP1 protein and the natural protein skeleton protein of the A-type foot-and-mouth disease virus after optimization, and then respectively inserting the two proteins into a vector pSMA to obtain recombinant O-pSMA-VP 1 plasmid and recombinant A-pSMA-VP 1 plasmid;

(2) Co-transferring the recombinant O-type pSMA-VP1 plasmid and the recombinant A-type pSMA-VP1 plasmid obtained in the step (1) into competent escherichia coli to obtain recombinant bacteria;

(3) And (3) carrying out prokaryotic expression on the recombinant bacteria in the step (2), purifying and then assembling in vitro to obtain the O type/A type foot-and-mouth disease virus VP1 chimeric nanoparticle.

Preferably, in step (1), the nucleotide sequences shown in SEQ ID NO.1 and SEQ ID NO.2 are inserted between the BsmB I and BamH I cleavage sites of the vector pSMA, respectively.

Preferably, at the time of the cotransformation described in step (2), each 100. Mu.L of E.coli competent is mixed with 100ng of recombinant pSMA-VP1 plasmid and 100ng of recombinant pSMA-VP1 plasmid.

Preferably, the purification in step (3) comprises subjecting the collected bacterial pellet to lysis after the prokaryotic expression, and subjecting the supernatant produced by the lysis to nickel column affinity chromatography purification.

Preferably, the in vitro assembly of step (3) comprises placing the purified recombinant protein in a dialysis bag and assembling in 500mL of an assembly buffer comprising 500mM NaCl and 50mM Tris-HCl, pH8.0.

The invention also provides application of the VP1 chimeric nanoparticle in preparation of a vaccine for preventing diseases caused by O-type/A-type foot-and-mouth disease viruses.

The invention also provides application of the VP1 chimeric nanoparticle in preparation of a detection reagent for detecting O-type/A-type foot-and-mouth disease virus.

The beneficial effects are that: the invention provides foot-and-mouth disease virus VP1 chimeric nano-particles, which are formed by covalently connecting O-type/A-type foot-and-mouth disease virus structural proteins VP1 and natural protein nano-skeleton proteins. According to the invention, the foot-and-mouth disease VP1 structural protein is displayed on the outer surface of the protein skeleton by utilizing the self-assembly characteristic of the protein skeleton and the modifiable property of the N end, so that the foot-and-mouth disease nanoparticle antigen with higher immune efficacy and higher stability is obtained. When the VP1 chimeric nanoparticle is prepared, the VP1 structural protein is covalently connected through the protein skeleton, the VP1 structural protein is displayed outside the nano cage, and the small ubiquitin-like modified protein prokaryotic expression system is adopted, so that the correct folding of target proteins is promoted, the soluble expression is improved, and the advantages of high expression efficiency, low cost and the like of the prokaryotic expression system are also considered. The O type/A type foot-and-mouth disease virus VP1 chimeric nanoparticle can be applied to the preparation of vaccines for preventing diseases caused by the O type/A type foot-and-mouth disease virus, and also can be applied to the preparation of detection reagents for detecting the O type/A type foot-and-mouth disease virus.

Drawings

FIG. 1 SDS-PAGE analysis of VP1 fusion recombinant proteins. In the figure, M: protein molecular mass standard; 1: purified VP1 fusion recombinant protein of O-type; 2: purified VP1 fusion recombinant protein of type A;

FIG. 2 Western-blot detection of VP1 fusion recombinant proteins. In the figure, M: protein molecular mass standard; 1: purified VP1 fusion recombinant protein of O-type; 2: purified VP1 fusion recombinant protein of type A;

FIG. 3VP1 fusion recombinant protein self-assembled nanoparticle transmission electron microscopy images.

FIG. 4VP1 fusion recombinant protein self-assembled nanoparticle size assay.

FIG. 5 results of guinea pig specific antibody level detection.

FIG. 6 results of detection of neutralizing antibody levels in guinea pigs.

FIG. 7 results of pig specific antibody level detection.

FIG. 8 results of detection of neutralizing antibody levels in pigs.

Detailed Description

The invention is based on published sequences of O type/A type foot-and-mouth disease virus (GenBank accession number: JN998085.1; KC 924746.1), and preferably optimizes VP1 genes of O type/A type foot-and-mouth disease virus before covalent connection, optimizes self-assembled protein skeleton gene sequences and then uses Linker to covalently connect two genes. In the invention, after covalent connection, the coding gene sequence of the obtained chimeric nanoparticle of the O-type foot-and-mouth disease virus VP1 is preferably shown as SEQ ID NO. 1; the coding gene sequence of the obtained foot-and-mouth disease virus VP1 chimeric nanoparticle is preferably shown as SEQ ID NO. 2.

The natural protein skeleton protein is preferably a hyperstable protein nano skeleton obtained by calculation and screening and site modification of the natural protein, and is specifically formed by self-assembling 60 subunits, wherein each three subunits form a trimer subunit, and the trimer subunit is assembled into a regular dodecahedron nano cage; the N end of the protein skeleton stretches outwards, so that gene fusion can be flexibly carried out; the nano cage has stable structure and high efficiency of gene fusion; the nano cage has a larger internal volume, and the inlet/outlet channels of the nano cage are controllable; can carry multiple functional proteins. The antigen can be displayed through self-assembled protein skeleton, so that the immunogenicity of the antigen can be enhanced, stronger humoral and cellular immune reactions can be initiated, and the antigen can be used as an ideal vaccine platform. In the invention, the nucleotide sequence of the gene obtained by codon optimization of the natural protein skeleton protein is preferably shown as SEQ ID NO. 3. According to the invention, the foot-and-mouth disease VP1 structural protein is displayed on the outer surface of the protein skeleton by utilizing the self-assembly characteristic of the protein skeleton and the modifiable property of the N end, so that the foot-and-mouth disease nanoparticle antigen with higher immune efficacy and higher stability is obtained.

The invention optimizes codons of VP1 protein and natural protein skeleton protein of O type/A type foot-and-mouth disease virus, and respectively carries out covalent connection on VP1 protein and natural protein skeleton protein of the O type foot-and-mouth disease virus after optimization, VP1 protein and natural protein skeleton protein of the A type foot-and-mouth disease virus after optimization, and then respectively inserts the two proteins into a vector pSMA to obtain recombinant O type pSMA-VP1 plasmid and recombinant A type pSMA-VP1 plasmid.

The method of optimizing and covalently linking is not particularly limited in the present invention, but is preferably the same as described above, and will not be described here again. The recombinant genes formed after covalent ligation are preferably subjected to double cleavage, preferably by BsmB I and BamH I, respectively. The invention preferably carries out double enzyme digestion of the same enzyme digestion site on the vector pSMA, then respectively carries out gel recovery on enzyme digestion products, and connects the recovered gene fragments (SEQ ID NO.1 and SEQ ID NO. 2) by using T4 DNA ligase to obtain recombinant O-type pSMA-VP1 plasmid and recombinant A-type pSMA-VP1 plasmid. The operation and the procedure of double enzyme cutting, glue recovery and connection are not particularly limited, and the conventional operation in the field can be utilized.

After the recombinant O-type pSMA-VP1 plasmid and the recombinant A-type pSMA-VP1 plasmid are obtained, the recombinant O-type pSMA-VP1 plasmid and the recombinant A-type pSMA-VP1 plasmid in the step (1) are co-transferred into the competence of escherichia coli to obtain recombinant bacteria. In the present invention, 100. Mu.L of E.coli competent was mixed with 100ng of recombinant pSMA-VP1 plasmid and 100ng of recombinant pSMA-VP1 plasmid per 100. Mu.L of E.coli competent. The E.coli competent cells of the invention preferably comprise E.coli TOP10 competent cells, and in the embodiment, the connection products are preferably 100ng each, and are added into 100 mu L of TOP10 competent cells, and after being gently mixed, the E.coli competent cells are subjected to ice bath 30min, heat shock at 42 ℃ for 90sec, and immediately subjected to ice bath 5min. After the cotransformation, the bacteria after cotransformation are preferably added into LB liquid medium preheated at 37 ℃ for shake culture at 37 ℃ for 1h, the culture is uniformly coated on LB agar plates containing 50 mug/mL ampicillin, and the culture is subjected to static culture at 37 ℃ for about 16h.

After the stationary culture, single bacterial colony is preferably selected and inoculated in LB liquid culture medium, shake culture is carried out for 16 hours at 37 ℃, then bacterial liquid PCR detection is carried out, plasmid is extracted from bacterial liquid positive in reaction, enzyme digestion identification is carried out, and the recombinant positive plasmid is named pSMA-VP1. The primers used for bacterial liquid PCR detection are universal primers T7 and T7ter, wherein the nucleotide sequence of T7 is shown as SEQ ID NO. 4: taatagacgctactacttaggg; the nucleotide sequence of T7ter is shown in SEQ ID NO. 5: TGCTAGTTATTGCTCAGCGG. The bacterial liquid PCR detection system of the invention is calculated by 20 mu L, and preferably comprises: 1 mu L of bacterial liquid, 10 mu L of upstream and downstream primer respectively, and 8 mu L of water; the reaction procedure includes a pre-denaturation at 98℃for 10min;98 ℃ for 1min, 55 ℃ for 30s, 72 ℃ for 90s,30 cycles; and at 72℃for 10min. The enzyme digestion identification is preferably carried out by using EcoRI, and then agarose gel electrophoresis analysis is carried out on the enzyme-digested fragments, so that the recombinant positive plasmid is named pSMA-VP1. Then transforming pSMA-VP1 recombinant plasmid into an escherichia coli BL21 (DE 3) strain to obtain the recombinant strain.

After the recombinant bacteria are obtained, the recombinant bacteria in the step (2) are subjected to prokaryotic expression, purified and assembled in vitro to obtain the O type/A type foot-and-mouth disease virus VP1 chimeric nanoparticle.

The invention preferably further comprises screening positive clones in the recombinant bacteria by ampicillin, selecting positive clones in LB culture medium, culturing at 37 ℃ and 220rpm overnight, and then carrying out prokaryotic expression. The prokaryotic expression of the invention preferably comprises inoculating the above-mentioned bacterial liquid after overnight culture in 1L LB culture medium at a volume ratio of 1:100, shaking culture at 37deg.C and 220rpm to OD of the bacterial liquid ₆₀₀ With a value of about 0.8, isopropyl thiogalactoside (IPTG) was added to a final concentration of 0.05mM, induced to express at 20℃overnight, and then the bacterial pellet was collected by centrifugation at 5000rpm for 30min.

In the invention, a small ubiquitin-like modified protein prokaryotic expression system is adopted, so that the correct folding of target proteins is promoted, the soluble expression is improved, and the advantages of high expression efficiency, low cost and the like of the prokaryotic expression system are also considered.

The invention preferably further comprises purification after said prokaryotic expression, more preferably comprises lysing the collected bacterial pellet, subjecting the supernatant resulting from the lysis to nickel column affinity chromatography. The specific operation steps of the nickel column affinity chromatography of the present invention are not particularly limited, and the conventional operation of the present invention may be utilized. After the purification, the invention carries out SDS-PAGE electrophoresis on the obtained purified sample to obtain VP1 fusion recombinant protein with expected size.

The VP1 fusion recombinant protein obtained is assembled in vitro, wherein the assembly in vitro preferably comprises the steps of placing the purified recombinant protein in a dialysis bag and assembling in 500mL of assembly buffer, wherein the 500mL of assembly buffer comprises 500mM NaCl and 50mM Tris-HCl, and the pH value is 8.0. During assembly, the invention carries out assembly by dialysis at 4 ℃ overnight with slow and uniform stirring, and the assembly effect can be observed by a conventional transmission electron microscope. In the examples of the present invention, it is preferable that the obtained nanoparticle is spherical and has a diameter of about 25nm as observed by a Ri Li H-7100FA transmission electron microscope (FIG. 3). Further, the hydrated particle size of the nanoparticles was measured by a Malvern nanosize analyzer, and the result showed that the nanoparticle size was about 25nm (FIG. 4).

According to the invention, immunoblotting analysis is carried out on the VP1 fusion recombinant protein, and the result shows that the VP1 fusion recombinant protein can react with the anti-hyperimmune serum specificity of the foot-and-mouth disease rabbit, so that the VP1 fusion recombinant protein can be applied to the preparation of vaccines for preventing diseases caused by O type/A type foot-and-mouth disease viruses or detection reagents for detecting O type/A type foot-and-mouth disease viruses.

The following examples are provided to illustrate the chimeric nanoparticle of foot-and-mouth disease virus VP1, and the preparation method and application thereof, but should not be construed as limiting the scope of the invention.

Example 1

Preparation of O-type/A-type foot-and-mouth disease virus VP1 chimeric nanoparticle based on natural protein skeleton

Codon optimization and synthesis of VP1 structural protein and nano-skeleton protein gene of O-type/A-type foot-and-mouth disease virus:

based on the published sequence of O/A type foot-and-mouth disease virus (GenBank accession number: JN998085.1; KC 924746.1), the VP1 gene of O/A type foot-and-mouth disease virus is optimized according to the codon preference of escherichia coli, the self-assembled protein skeleton gene sequence is optimized, and then the two genes are covalently connected by using a Linker. The optimized recombinant gene sequence is shown as SEQ ID NO.1 and SEQ ID NO. 2.

Construction of recombinant expression vector of VP1 fusion recombinant protein

(1) Cleavage of fragments and vectors

Referring to the endonuclease specification, the synthesized VP1 fusion recombinant genes are respectively subjected to enzyme digestion, and the reaction system is as follows: 20. Mu.L of the DNA fragment or 30. Mu.L of the vector was added to 50. Mu.L of the cleavage reaction system, and 5. Mu.L of each of the endonuclease buffer, the endonuclease BsmB I and BamH I was contained therein, and the mixture was supplemented with deionized water to 50. Mu.L. And (3) enzyme digestion is carried out for 4 hours at 37 ℃, agarose electrophoresis is carried out to confirm whether the enzyme digestion products are cut or not, and then gel recovery is carried out.

(2) Enzyme-cut product gum recovery

And observing an electrophoresis result of the enzyme digestion product by using a gel imaging system, cutting a target fragment, and recovering and purifying the target fragment by using a common agarose gel DNA recovery kit.

(3) Ligation reaction

The two products were ligated according to the molar ratio of the support and the recovered fragment. The reaction system is as follows: 2. Mu.L of the target fragment, 1. Mu.L (1U/. Mu.L) of vector 1. Mu. L, T4 DNA ligase, 1. Mu.L of 10 xT 4 DNA ligation buffer, and the total volume of ultrapure water to 10. Mu.L were supplemented, and after mixing, ligation was performed at 4℃overnight or 16℃for 4 hours.

(4) Transformation of TOP10 clone

100ng of each ligation product was added to 100. Mu.LTOP 10 competent cells, and after gentle mixing, the mixture was subjected to ice bath for 30min, heat shock at 42℃for 90s, immediately ice bath for 5min, 800. Mu.L of LB liquid medium preheated at 37℃was added, shake culture was performed at 37℃for 1h, the culture was uniformly spread on LB agar plates containing 50. Mu.g/mL ampicillin, and stationary culture was performed at 37℃for about 16h.

(5) Identification of recombinant plasmids

Bacterial colonies with uniform size on the plates are picked by using sterile toothpicks and are inoculated into LB liquid culture medium, and shake culture is carried out for 16 hours at 37 ℃. The bacterial solutions after overnight culture with different numbers are inoculated into a 10 mu L PCR buffer solution system and identified by a whole bacterial PCR method. And (3) extracting plasmids from the bacterial liquid which is identified as positive by the PCR reaction by using a small amount of plasmid extraction kit, and carrying out enzyme digestion identification. The enzyme digestion system is as follows: ecoRI 05. Mu.L, 10 XH Buffer, DNA 4. Mu.L, ultrapure water 4.5. Mu.L, and digested at 37℃for 1 hour. After the enzyme digestion reaction is finished, agarose gel electrophoresis analysis is carried out, and the recombinant positive plasmid is named pSMA-VP1.

Expression purification of VP1 recombinant protein and immunoblot analysis

(1) Expression of recombinant proteins

The pSMA-VP1 recombinant plasmid was transformed into E.coli BL21 (DE 3) strain. Positive clones were screened with ampicillin. Positive clones were selected and cultured in LB medium at 37℃and 220rpm overnight. The bacterial liquid is inoculated in 1L LB culture medium at a ratio of 1:100, and is shake-cultured at 37 ℃ and 220rpm until the OD600 value of the bacterial liquid is about 0.8, isopropyl thiogalactoside (IPTG) is added to a final concentration of 0.05mM, and the bacterial liquid is induced to express overnight at 20 ℃, and then the bacterial liquid is collected by centrifugation at 5000rpm for 30min.

(2) Purification of expression fusion recombinant proteins

Bacterial pellet was resuspended in 10-20 ml ice-bath treated buffer A (500 mM NaCl, 20mM Tris-HCl, 20mM Imidazole, 1mM DTT, pH 8.0) and the cells were sonicated on ice (sonication time 3s, interval 3s, total 7min, power 350W). The sonicated broth was centrifuged at 12000rpm for 30min at 4℃and the supernatant was left. The supernatant was transferred to a column preloaded with a nickel affinity chromatography resin equilibrated with BufferA, the supernatant was mixed with Ni-NTAResins and bound at room temperature for about 1h, and nonspecifically bound hybrid proteins were washed with 10 resin volumes of BufferA and 5% BufferB (500 mM NaCl, 20mM Tris-HCl, 500mM Imidazole, 1mM DTT, pH 8.0), and the target proteins were eluted with BufferB 1mL each time, and the elution was repeated 6 to 7 times. The above samples were subjected to SDS-PAGE electrophoresis, and the results showed that the desired size of protein was obtained (FIG. 1).

(3) Immunoblotting experiments

The eluted VP1 fusion recombinant protein was subjected to 10% SDS-PAGE, electrotransferred to polyvinylidene fluoride hybridization membrane (PVDF membrane) by wet transfer, blocked with blocking solution (PBST, 5% skimmed milk powder, pH 7.0) for 1h at 37deg.C, and treated with PBST1: diluting anti-rabbit IgG secondary antibody marked by horseradish peroxidase with 2000 in PBST1:2000, fully acting for 1h at 37 ℃, and fully washing by PBST; and then developed by a developing apparatus. The band was found to be consistent with the expected size, indicating that the obtained protein was able to react specifically with the anti-hyperimmune serum of foot-and-mouth disease rabbits (FIG. 2).

In vitro autonomous assembly of 4.O/A foot-and-mouth disease virus VP1 chimeric nanoparticles

The purified VP1 fusion recombinant protein is placed in 500mL of assembly buffer solution (500mM NaCl,50mM Tris-HCl, pH 8.0) and slowly stirred at a constant speed, and is dialyzed overnight at 4 ℃ for assembly, and the assembly effect is observed by a conventional transmission electron microscope. Further, the hydrated particle size of the nanoparticles was measured by a Malvern nanosize analyzer, and the result showed that the nanoparticle size was about 25nm (FIG. 4).

5.O type/A type foot-and-mouth disease virus VP1 chimeric nanoparticle guinea pig immune efficacy detection

About 12 guinea pigs of 200g size were divided into 2 groups, the first group immunized with VP1 chimeric nanoparticles and the second group injected with PBS as a control. Serum was collected weekly after immunization, and serum was collected continuously for four weeks, and specific antibodies and neutralizing antibodies were detected. And then transferring the guinea pigs into a P3 animal laboratory for toxicity attack protection rate determination.

Specific antibody detection specific procedures were as follows: the serum of guinea pig and the negative and positive control serum were serially diluted 2-fold with PBST on a microplate, and then added with foot-and-mouth disease virus antigen and allowed to stand at 37℃for 1 hour. The antigen-antibody mixture was transferred to an ELISA plate coated with a foot-and-mouth disease rabbit antibody, and incubated at 37℃for 60min. PBST was washed 3 times, and a working solution (50. Mu.L) of an antibody against foot-and-mouth disease guinea pig was added to the well plate, followed by sealing and incubation at 37℃for 30min. After 3 wash passes of PBST, rabbit anti-guinea pig IgG-HRP working solution (50. Mu.L) was added, the plates were closed and incubated at 37℃for 30min. After 3 washes of PBST, 50. Mu.L of substrate solution was added to each well and incubated at 37℃for 15min. The color reaction was then stopped by adding 50. Mu.L of stop solution to each well, and the Optical Density (OD) was measured at 490nm (see FIG. 5).

The specific operation of detecting serum neutralizing antibodies is as follows: after inactivation of saline-diluted guinea pig serum at 56℃for 30min, 2-fold serial dilutions of the serum were made in DMEM medium on 96-well cell culture plates, 4 wells per dilution, 50 μl of virus solution (100 TCID was added per well ₅₀ ) After neutralization in a 37℃incubator for 1h, 100. Mu.L of cell suspension (1X 10) was added to each well ⁵ personal/mL), 5% co ₂ Culturing in an incubator at 37 ℃ and observing the end judgment of 144 hours from 48 hours. Positive and negative serum controls, viral regression tests, serum toxicity controls, and normal cell controls were set. The serum dilution that protects 50% of the cells from cytopathic effect was calculated as the neutralizing antibody titer of the test sample according to the Spearman-Karber method (see fig. 6).

FIG. 5 shows the results of serum-specific antibody level detection in guinea pigs, showing that serum antibody levels in nanoparticle immunized groups continue to rise, reach the highest peak at week 3, and continue all the way to PBS control. This suggests that the nanoparticles are able to maintain a strong stimulus that causes the animal body to produce more antibodies.

FIG. 6 shows the results of serum neutralizing antibody level detection in guinea pigs, showing that the level of neutralizing antibody in guinea pigs is continuously increased after nanoparticle immunization and reaches the highest peak at week 3 and still is higher at week 4, compared with PBS group, indicating that nanoparticle immunization group can cause body to produce neutralizing antibody.

The specific operation of the toxicity attack protection rate measurement is as follows: 200. Mu.L of a virus solution (100 TCID) was injected at the left hoof of each guinea pig by cross-puncture ₅₀ ) The patients were kept for about one week, and four limbs were observed daily to see if any disease occurred. Compared with the PBS group, the nanoparticle protection rate reaches 83 percent. The test results are shown in Table 1.

TABLE 1 determination of toxicity attack protection rate

Immunization	Number of immunizations	Number of incidences	Incidence (%)	Protection ratio (%)
					PBS	6	6	100	0
Chimeric nanoparticles	6	1	16	83

6.O type/A type foot-and-mouth disease virus VP1 chimeric nanoparticle pig immune efficacy detection

8 pigs at 5 weeks of age were divided into 2 groups, the first group (3) was immunized with PBS as a control, the second group (5) was immunized with VP1 chimeric nanoparticle protein, jugular vein blood collection was performed on all experimental pigs prior to immunization, weekly blood collection was started the first week after immunization, continuous blood collection was performed for 4 weeks, serum was isolated and antibody level detection was performed.

Specific antibody detection specific procedures were as follows: the serum of guinea pig and the serum of negative and positive control are serially diluted by PBST 2 times on a micro-blood coagulation plate, and then the foot-and-mouth disease O-type virus antigen is added and kept stand for 1h at 37 ℃. The antigen-antibody mixture was transferred to an ELISA plate coated with foot-and-mouth disease type O rabbit antibody, and incubated at 37℃for 60min. PBST was washed 3 times, and a working solution (50. Mu.L) of foot-and-mouth disease type O guinea pig antibody was added to the well plate, followed by sealing and incubation at 37℃for 30min. After 3 wash passes of PBST, rabbit anti-guinea pig IgG-HRP working solution (50. Mu.L) was added, the plates were closed and incubated at 37℃for 30min. After 3 washes of PBST, 50. Mu.L of substrate solution (OPD, 3% hydrogen peroxide added) was added to each well and incubated at 37℃for 15min. The color reaction was then stopped with 50. Mu.L of stop solution applied to each well and the Optical Density (OD) was measured at 490nm (see FIG. 7).

The specific operation of the detection of the neutralizing antibody is as follows: after inactivating the physiological saline-diluted pig serum at 56℃for 30min, 2-fold serial dilutions of the serum were made in a 96-well microcell culture plate with DMEM medium, 4 wells for each dilution, and 50. Mu.L of virus solution (100 TCID were added to each well ₅₀ ) After neutralization in a 37℃incubator for 1h, 100. Mu.L of cell suspension (1X 10) was added to each well ⁵ personal/mL), 5% co ₂ Culturing in an incubator at 37 ℃ and observing the end judgment of 144 hours from 48 hours. Positive and negative serum controls, viral regression tests, serum toxicity controls, and normal cell controls were set. The dilution of serum that protected 50% of the cells from cytopathic effect was calculated as the neutralizing antibody titer of the test samples according to the Spearman-Karber method (fig. 8).

FIG. 7 shows the results of pig serum specific antibody level detection, showing that serum antibody levels in nanoparticle immunized groups continue to rise, reach the highest peak at week 3, and continue all the way to the PBS control group. This suggests that the nanoparticles are able to maintain a strong stimulus that causes the animal body to produce more antibodies.

Fig. 8 shows the results of pig serum neutralizing antibody level detection, and shows that the level of the neutralizing antibody in guinea pigs is continuously increased after nanoparticle immunization compared with that in a PBS group, and reaches the highest peak at the 4 th week, which indicates that nanoparticle immunization can cause the body to generate neutralizing antibody. The potential efficacy of the type O/a foot and mouth disease virus VP1 chimeric nanoparticle as a vaccine is further demonstrated.

In conclusion, the O type/A type foot-and-mouth disease virus VP1 fusion recombinant protein expressed by the prokaryotic expression system has good reactivity, can react with the anti-hyperimmune serum specificity of the O type/A type foot-and-mouth disease virus VP1 protein rabbit, can be assembled into nano particles in vitro, has good immune effect on guinea pigs and pigs, and can be applied to preparation of vaccines for preventing diseases caused by the O type/A type foot-and-mouth disease virus and detection reagents of the O type/A type foot-and-mouth disease virus.

The foregoing is merely a preferred embodiment of the present invention and it should be noted that modifications and adaptations to those skilled in the art may be made without departing from the principles of the present invention, which are intended to be comprehended within the scope of the present invention.

Sequence listing

<110> the animal doctor institute of Lanzhou, china academy of agricultural sciences

<120> foot-and-mouth disease virus VP1 chimeric nanoparticle, and preparation method and application thereof

<160> 5

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1317

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 1

atgcatcacc accaccacca cggatcaaca accagcatcg gcgagtccgc tgatccggtc 60

accacaaccg ttgaaaatta tggcggagag acgcaagttc agcgtcgtca gcatacggat 120

gtgtcgttca tcctggaccg cttcgtcaag gtgactccca aggaccagat taacgtgttg 180

gaccttatgc agaccccggc acatactctg gttggcgcgc tgttacggac cgctacctac 240

tattttgcag acctggaagt tgcggtcaag cacgaaggca acttgacctg ggttccgaac 300

ggtgccccgg aaaccgcctt ggacaacacc accaacccga ctgcgtatca caaggctccg 360

ctgacacgtc tggcgttgcc gtataccgcg ccacatcgtg ttctggcgac cgtgtacaat 420

ggtaactgca agtacggcga atcgccggtt accaacgcca gaggcgatct gcaagtcctc 480

gcgcaaaaag cagcacgcgc gttgccgacg agcttcaatt acggcgcgat caaagcaacc 540

cgtgtgacgg agctgctgta ccgtatgcgt cgtgcggaga cttactgccc gcgtccgttg 600

ctcgccatcc atccgagcga agcgcgccac aaacaaaaaa tcgtggcgcc ggtgaagcaa 660

ctgctgggtg gctcgggcgg ttctggtggt tccggcggta gcatgaagat ggaagagctg 720

ttcaagaaac acaaaattgt tgctgtgttg cgtgccaact ccgttgaaga ggcaaaaaaa 780

aaggcgctgg ctgtgttcct cggcggcgtt cacctaattg aaattacctt taccgttccg 840

gatgcggata ccgttatcaa agagctgtca tttctgaaag agatgggtgc tatcatcggt 900

gccggcaccg tgaccagcgt cgagcagtgt cgtaaagcgg tcgagagcgg agcggaattt 960

attgttagcc cgcatttgga cgaagagatc agccagtttt gtaaagaaaa gggtgttttc 1020

tatatgcctg gtgttatgac cccgaccgag ctggtgaagg caatgaagct cggtcacacc 1080

attctgaagc tgttcccggg tgaggtggtg ggtccgcagt ttgtgaaggc catgaaaggc 1140

ccatttccga acgtcaagtt cgttccgact ggtggcgtga atctggacaa cgtgtgcgaa 1200

tggtttaaag cgggggttct ggcggttggt gtgggttccg ctctggtcaa gggtacgccg 1260

gtggaggttg cggagaaagc caaggcgttt gttgagaaaa ttcgcgggtg caccgaa 1317

<210> 2

<211> 1216

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 2

atgcatcacc accaccacca cggatcaccg acgtcagngg ggnaacgntg cagaccctgt 60

caccaccacc gttgagaact acggtggtga gacacaggtt cagcgacgtt accacactga 120

cgtcggcttc attatggaca ggtttgtgaa aatcagccct gtgagcccca cgcacgtcat 180

cgacctcatg caaacacacc aacacgcgtt ggtgggtgcc ttcttgcgtg cagccacgta 240

ctacttctcc gacctggaga ttgtggtgcg tcacgatggc aacttgacgt gggtacccaa 300

tggagcacct gaacaagcct tgggtaacac aagcaacccc actgcctacc acaagcagcc 360

atttaccaga ctcgcgctcc cttacaccgc gccacaccga gtgttggcaa cggtgtacaa 420

cggagtaagc aagtactctg caactggtgg tggtagaagg ggtgacctgg ggtctcttgc 480

ggcgcgggtc gccacacagt tacccagctc tttcaatttt ggtgcaatcc gggccacgac 540

catccacgag cttctcgtgc gcatgggtgg ctcgggcggt tctggtggtt ccggcggtag 600

catgaagatg gaagagctgt tcaagaaaca caaaattgtt gctgtgttgc gtgccaactc 660

cgttgaagag gcaaaaaaaa aggcgctggc tgtgttcctc ggcggcgttc acctaattga 720

aattaccttt accgttccgg atgcggatac cgttatcaaa gagctgtcat ttctgaaaga 780

gatgggtgct atcatcggtg ccggcaccgt gaccagcgtc gagcagtgtc gtaaagcggt 840

cgagagcgga gcggaattta ttgttagccc gcatttggac gaagagatca gccagttttg 900

taaagaaaag ggtgttttct atatgcctgg tgttatgacc ccgaccgagc tggtgaaggc 960

aatgaagctc ggtcacacca ttctgaagct gttcccgggt gaggtggtgg gtccgcagtt 1020

tgtgaaggcc atgaaaggcc catttccgaa cgtcaagttc gttccgactg gtggcgtgaa 1080

tctggacaac gtgtgcgaat ggtttaaagc gggggttctg gcggttggtg tgggttccgc 1140

tctggtcaag ggtacgccgg tggaggttgc ggagaaagcc aaggcgtttg ttgagaaaat 1200

tcgcgggtgc accgaa 1216

<210> 3

<211> 615

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 3

atgaagatgg aagagctgtt caagaaacac aaaattgttg ctgtgttgcg tgccaactcc 60

gttgaagagg caaaaaaaaa ggcgctggct gtgttcctcg gcggcgttca cctaattgaa 120

attaccttta ccgttccgga tgcggatacc gttatcaaag agctgtcatt tctgaaagag 180

atgggtgcta tcatcggtgc cggcaccgtg accagcgtcg agcagtgtcg taaagcggtc 240

gagagcggag cggaatttat tgttagcccg catttggacg aagagatcag ccagttttgt 300

aaagaaaagg gtgttttcta tatgcctggt gttatgaccc cgaccgagct ggtgaaggca 360

atgaagctcg gtcacaccat tctgaagctg ttcccgggtg aggtggtggg tccgcagttt 420

gtgaaggcca tgaaaggccc atttccgaac gtcaagttcg ttccgactgg tggcgtgaat 480

ctggacaacg tgtgcgaatg gtttaaagcg ggggttctgg cggttggtgt gggttccgct 540

ctggtcaagg gtacgccggt ggaggttgcg gagaaagcca aggcgtttgt tgagaaaatt 600

cgcgggtgca ccgaa 615

<210> 4

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 4

taatacgact cactataggg 20

<210> 5

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 5

tgctagttat tgctcagcgg 20

Claims

1. A foot-and-mouth disease virus VP1 chimeric nanoparticle, characterized in that the VP1 chimeric nanoparticle comprises a VP1 protein and a natural protein backbone protein of a type O/a foot-and-mouth disease virus that are covalently linked;

after covalent connection, the coding gene sequence of the obtained chimeric nanoparticle of the O-type foot-and-mouth disease virus VP1 is shown as SEQ ID NO. 1; the coding gene sequence of the obtained foot-and-mouth disease virus VP1 chimeric nanoparticle is shown as SEQ ID NO. 2.

2. A method of preparing the VP1 chimeric nanoparticle of claim 1, comprising the steps of: (1) The nucleotide sequences shown in SEQ ID NO.1 and SEQ ID NO.2 are respectively inserted between BsmBI and BamHI enzyme cutting sites of the vector pSMA to obtain recombinant type O pSMA-VP1 plasmid and recombinant type A pSMA-VP1 plasmid;

3. The method of claim 2, wherein each 100. Mu.L of E.coli competent is mixed with 100ng of recombinant pSMA-VP1 plasmid and 100ng of recombinant pSMA-VP1 plasmid per 100ng of the cotransformation in step (2).

4. The method according to claim 2, wherein the purification in the step (3) comprises subjecting the collected cell pellet to lysis after the prokaryotic expression, and subjecting the supernatant resulting from the lysis to nickel column affinity chromatography.

5. The method of claim 2, wherein the in vitro assembly of step (3) comprises placing the purified recombinant protein in a dialysis bag and assembling in 500mL of assembly buffer, wherein the 500mL of assembly buffer comprises 500mm naci and 50mm tris-HCl, ph8.0.

6. Use of the VP1 chimeric nanoparticle of claim 1 in the preparation of a vaccine for preventing diseases caused by foot-and-mouth disease virus type O/a.

7. The use of the VP1 chimeric nanoparticle of claim 1 for preparing a detection reagent for detecting foot-and-mouth disease virus type O/a.