CN115011728A - Molecular marker of peanut endopleura color regulation gene AhLAC function and application - Google Patents

Molecular marker of peanut endopleura color regulation gene AhLAC function and application Download PDF

Info

Publication number
CN115011728A
CN115011728A CN202210752591.2A CN202210752591A CN115011728A CN 115011728 A CN115011728 A CN 115011728A CN 202210752591 A CN202210752591 A CN 202210752591A CN 115011728 A CN115011728 A CN 115011728A
Authority
CN
China
Prior art keywords
peanut
color
molecular marker
seed coat
marker
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202210752591.2A
Other languages
Chinese (zh)
Inventor
张新友
孙子淇
齐飞艳
郑峥
刘华
秦利
黄冰艳
石磊
苗利娟
张忠信
徐静
田梦迪
赵瑞芳
董文召
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Henan Academy of Agricultural Sciences
Original Assignee
Henan Academy of Agricultural Sciences
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Henan Academy of Agricultural Sciences filed Critical Henan Academy of Agricultural Sciences
Priority to CN202210752591.2A priority Critical patent/CN115011728A/en
Publication of CN115011728A publication Critical patent/CN115011728A/en
Pending legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/6858—Allele-specific amplification
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/13—Plant traits
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Analytical Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Biotechnology (AREA)
  • Molecular Biology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Immunology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Genetics & Genomics (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Botany (AREA)
  • Mycology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention provides a molecular marker of peanut inner seed coat color regulation gene AhLAC function and application thereof, wherein the molecular marker is A05.114993389 and is positioned at 114,993,389bp of peanut chromosome 5, and the molecular marker site is an InDel insertion deletion marker. The invention develops the KASP molecular marker of A05.114993389(InDel locus) based on the mutation type of the sequence of the peanut endopleura color regulating gene AhLAC, the typing result of the marker in the peanut natural population material is completely linked with the endopleura color, and the accuracy of the marker is proved. The KASP marker can quickly and accurately obtain the color information of the inner seed coat of the peanut material, and can be applied to peanut molecule-assisted marker breeding.

Description

Molecular marker of peanut endopleura color regulation gene AhLAC function and application
Technical Field
The invention relates to development and application of a peanut inner seed coat color regulation gene AhLAC functional molecular marker, belonging to the field of molecular biology.
Background
Peanuts (Arachis hypogaea L.; 2 n-4 x-40) are important oil crops, with a worldwide total yield of 4765 million tons, second only to soybeans, oilseed rape, and sunflowers. The composition of anthocyanins is a factor in determining the colour of peanut seed coats. The anthocyanin is used as a plant secondary metabolite, widely exists in flowering plants, is a safe antioxidant, and has health care values of protecting eyesight, hindering protein saccharification and the like. With the enhancement of health care consciousness of people, anthocyanin is favored by more and more people, and research on anthocyanin synthesis approaches and cultivation of anthocyanin-rich crop varieties becomes one of the hot spots of research.
The color of the seed coat is an important descriptive character for distinguishing different peanut varieties. The color and character description of the peanut seed coat is divided into an episperm color and an endopleura color. At present, the color of the peanut testa is divided into two types of single color and multicolor, and the color of the single-color testa has five types of white, brown, pink, red, purple and the like; the multicolor seed coats have red-white variegated colors, purple stripes on brown colors, white spots on red colors and the like. The color of the inner seed coat is divided into two types, white and yellow. Yellow is divided into light yellow and dark yellow. The seed coat has a large influence on the sensory evaluation of peanut raw products, and the dark peanut seed coat has a large influence on the fragrance. The bitterness of peanut is closely related to the shade of the seed coat, and the darker the seed coat, the stronger the bitterness.
In plants, browning reactions are generally the oxidation of phenolic compounds to produce quinones, which are unstable molecules that readily form yellowish brown polymers. These reactions can be catalyzed by polyphenol oxidases such as laccase (laccase), catechol oxidase (catechol oxidase), tyrosinase (tyrosinase) and peroxidase (peroxidases). Laccases are widely present in eukaryotes (higher plants, fungi and insects) and prokaryotes. They are generally less specific for reducing substrates and are capable of oxidizing diphenolic, monophenolic ascorbic acid. In transgenic corn, the expression of laccase gene is related to corn kernel browning and germination limitation.
Competitive Allele Specific PCR (KASP) allows for precise biallelic determination of SNPs and InDels at Specific sites in a wide range of genomic DNA samples (even some complex genomic DNA samples). Compared with a TaqMan double-color labeling probe method, a MassARRAY molecular weight array technology and an Affymetrix SNP chip, the KASP technology has higher flexibility and low reagent cost, and the same cost can obtain at least twice of data volume. Therefore, the recombinant inbred line population of peanuts is utilized to carry out QTL positioning on the regulatory gene of the peanut endopleura color, and a molecular marker is developed based on the target gene, so that the method can be applied to peanut breeding.
Disclosure of Invention
Aiming at the defects of the prior art, the invention aims to provide the development and application of the peanut inner seed coat color control gene AhLAC functional molecular marker.
In order to achieve the purpose, the invention adopts the technical scheme that:
the functional molecular marker of the peanut inner seed coat color regulation gene AhLAC is A05.114993389 and is positioned at 114,993,389bp of a peanut chromosome 5, and the molecular marker site is an InDel insertion deletion marker;
wherein, the sequence of 200bp around the wild molecular marker locus is as follows:
CCTGGTGACTTTTTTCCTTGCTCAAGAGAAGGTATGCTGTATGCATGAAGATTTCATTTCAAGCATGCTCAAATGTTCTTTGATTTTAGAATCTCTAACTGCATCAATTCTTTTTGTTTTTTCACAGAAACATTCAAGTTTAATGTAGATTTTGGCAAGACTTATCTGCTGAGGATTGTGAATGCTGCAATGAATGTAGTTCTCTTTTTCTCTGTTTACAAACACAGTCTCACTGTTGTTGGTGCTGATGCTGCCTACACCGAGCCATTAACAAGAGACTTCATATGCATAGCTCCAGGACAATCACTTGATGTTTTGTTGCATGCAAATCAAGAACCTGATCACTATTACATGGCTGCAAGAGCATATTCAAGTTCCTCTATTCTTCCTTTTGATAACA；
the mutant is an inserted 214bp sequence, the inserted 214bp sequence is arranged in square brackets, and the sequences of 200bp before and after the molecular marker site are as follows:
CCTGGTGACTTTTTTCCTTGCTCAAGAGAAGGTATGCTGTATGCATGAAGATTTCATTTCAAGCATGCTCAAATGTTCTTTGATTTTAGAATCTCTAACTGCATCAATTCTTTTTGTTTTTTCACAGAAACATTCAAGTTTAATGTAGATTTTGGCAAGACTTATCTGCTGAGGATTGTGAATGCTGCAATGAATGTAGT[TCTCTTTTTGGCAACTACTCCTATGAAGATGCCAAAAACATCTTTTTATGATGATCTTTGTTTAAAAAGTGTAACTTATTTGTTTAGCAACACTTTAAATAAAGATAACACTTTTACTTTAAATAAAATCAAACCCTACAATCTATCATCTAATGGTCAAAATGAAATATCTTCATATGATGACAATCATAAAATCTTCATTGGAGTAGCCACC]TCTCTTTTTCTCTGTTTACAAACACAGTCTCACTGTTGTTGGTGCTGATGCTGCCTACACCGAGCCATTAACAAGAGACTTCATATGCATAGCTCCAGGACAATCACTTGATGTTTTGTTGCATGCAAATCAAGAACCTGATCACTATTACATGGCTGCAAGAGCATATTCAAGTTCCTCTATTCTTCCTTTTGATAACA。
a KASP primer combination for amplifying said functional molecular marker, said KASP primer combination comprising:
qIIC_A05_F1:5’-GCTCAGAGAAAAAGAGAACTACATTC-3’，
qIIC_A05_F2:5’-ATTGACCATTAGATGATAGATTGTAG-3’，
qIIC_A05_com:5’-CAAGAGAAGGTATGCTGTATGCA-3’。
the method for identifying the color of the peanut inner seed coat by using the functional molecular marker comprises the following steps:
(1) extracting DNA of a peanut sample to be identified, detecting genotype data of the peanut sample to be identified by using the KASP primer combination of claim 2, and genotyping the InDel locus of A05.114993389 of the peanut sample to be identified through a SNPLine genotyping platform;
(2) if the typing result of the site A05.114993389 is mutant (MITE: MITE), the color of the inner seed coat of the peanut sample to be identified is white; if the typing result at the A05.114993389 site is the wild type (-: -), the color of the seed coat in the peanut sample to be identified is yellow.
The PCR technology is adopted in the identification in the step (1), and the PCR amplification procedure is as follows: pre-denaturation at 94 ℃ for 15 min; denaturation at 94 ℃ for 20s, extension at 61-55 ℃ for 1min, 10 cycles; denaturation at 94 ℃ for 20s, extension at 55 ℃ for 1min, 26 cycles; storing at 10 deg.C.
The functional molecular marker is applied to the identification of the peanut inner seed coat color.
The functional molecular marker is applied to peanut molecular breeding.
The invention has the beneficial effects that:
the invention utilizes a recombinant inbred line population which takes distant hybrid 9102 and wt09-0023 as parents to construct a high-density linkage map, and the high-density linkage map is positioned to a QTL (qIIC _ A05) for regulating and controlling the peanut inner seed coat color, the physical map position corresponding to the qIIC _ A05 is Chr05:114741295-115061124, the interval size is 319.8Kb, the LOD value is 186.5-444.4, and the genetic contribution rate is 75.8-94.6%. The QTL positioning is reported for the first time, and the blank of peanut endopleura research is filled.
The target gene AhLAC for regulating and controlling the color of the inner seed coat is obtained based on the qIIC _ A05 interval, the gene is cloned to convert an arabidopsis homologous gene mutant, the color of the seed coat of a positive plant is darker than that of the yellow seed coat of the mutant, and the AhLAC gene is proved to have laccase activity. The gene for regulating the peanut inner seed coat color is cloned for the first time, and fills the blank of inner seed coat regulation gene research.
The invention develops the KASP molecular marker of A05.114993389(InDel locus) based on the mutation type of the sequence of the peanut endopleura color regulating gene AhLAC, the typing result of the marker in the peanut natural population material is completely linked with the endopleura color, and the accuracy of the marker is proved. The KASP marker can quickly and accurately obtain the color information of the inner seed coat of the peanut material, and can be applied to peanut molecule-assisted marker breeding.
Drawings
FIG. 1 example 1 "distant hybrid 9102 × wt 09-0023" endopleural color frequency distribution plot of progeny material of RIL population.
FIG. 2 alignment of wild type (AhLAC-WT) and mutant (AhLAC-Mu) AhLAC gene in example 2.
FIG. 3 35S in example 2 comparison of seed coat color over-expressed by AhLAC gene in Arabidopsis thaliana mutant attt 10.
Wherein, 35S, the seed coat color of the AhLAC positive strain is dark yellow, the seed coat color of the Arabidopsis mutant attt10 is light yellow, and the seed coat color of the wild Arabidopsis is yellow brown.
FIG. 4 KASP validation of the A05.114993389InDel site in example 3 in the distal hybrid 9102 and wt09-0023RIL population.
Wherein the left panel shows the result of KASP primer genotyping, red near the X-axis and blue near the Y-axis, wherein the genotype is MITE, the point of MITE is red, and the point of genotype-: is blue.
Figure 5 KASP validation of the a05.114993389indel site in example 3 in 334 natural population material.
Wherein, the left figure is the KASP primer genotyping result, the point near the X axis is red, the point near the Y axis is blue, and the point in the middle of the quadrant is green; wherein the point of genotype MITE is red, the point of genotype-is blue, and the point of genotype MITE-is green.
Detailed Description
The following examples further illustrate the embodiments of the present invention in detail. Unless otherwise stated, the instruments and equipment involved in the examples are conventional instruments and equipment; the related reagents are all conventional reagents sold in the market; the related test methods are all conventional methods.
Example 1 acquisition of major QTL for testa color
(1) Sequencing the Recombinant Inbred Line (RIL) population of the distant hybrid 9102 and wt09-0023 by using a simplified genome sequencing technology, wherein the sequencing depth of the two parents is more than 20 x, and the sequencing depth of the 521 progeny families is 5 x. And (3) obtaining the genotyping data of the parent and the offspring by taking the genome information (Arachis hypogaea. cv. Tifrunner V1.0) of the cultivated peanuts as reference. The two parents obtain 9 ten thousand polymorphic SNPs with homozygous genotypes. SNP markers with deletion rate of more than 10% in all offspring are filtered, SNP markers with approximate genetic linkage positions are filtered by QTL IiMapping v4.1 software, and finally the rest of the markers are mapped by using JoinMap5.0 software, so that a high-quality and high-density genetic map containing 20 linkage groups is constructed, the number of the markers in the map is 5120, and the average genetic distance is 0.62cM (shown in Table 1).
TABLE 1 linkage group information of RIL group high-density linkage maps
Figure BDA0003718807190000041
(2) The inventors investigated the endopleural color of the progeny of the RIL population of the distant hybrid 9102 and wt09-0023 in three years, 2017, 2019 and 2020. Wherein RIL groups (521 families and two parents) are planted in a research institute experimental base of sandlot control and utilization in Liaoning province of Fuxin city of Liaoning province in 2017, and the repetition is set for 2 times. 2019 and 2020, and 2 times of repetition is set in a Henan modern agriculture research and development base planted in agricultural academy of Henan province, New county, Henan province. In 2021, a natural population composed of 334 parts of peanut germplasm was planted in modern agriculture research and development base in Henan, and the planting was repeated for 2 times. When the color of the seed coat in the peanut is investigated, 20 seeds are selected from each family or material, the seed coat is required to be free from disease infection, and the seeds are full. The incised seed coat survey recorded the color of the endopleura, with the yellow mark 2 and the white mark 1 (as shown in FIG. 1).
(3) QTL mapping of the genetic map and the phenotypic data by using IcMapping software shows that qIIC _ A05 is mapped in a 3-year environment. qIIC _ A05 is located on the 5 th chromosome, the corresponding physical map position is Chr05:114741295-115061124, the interval size is 319.8Kb, the LOD value is 186.5-444.4, and the genetic contribution rate (PVE) is 75.8% -94.6%. (as shown in table 2).
TABLE 2 QTL mapping results for endopleural color in RIL populations of distantly mixed 9102 and wt09-0023
Figure BDA0003718807190000051
(4) Gene and function annotated in QTL interval
The qIIC _ A05 interval (114741295 bp to 115061124bp of chromosome 5) annotated genes were obtained with peanut cultivar genomic information (Arachis hypogaea. cv. Tifrunner V1.0) as reference. According to the genes related to seed coat color regulation published in arabidopsis thaliana, 5 genes are found in 32 genes in the interval possibly related to the regulation of the color of the inner seed coat, including 1 laccase gene (arahy.0c6znn) and 4 oxidoreductase family proteins (arahy.7fuc5y, arahy.I6RXR7, arahy.QUQ3d and arahy.85VNG6). The peanut cultivars of published genomes, Tifrunner and Shitouqi, have different coat colors, Tifrunner is yellow and Shitouqi is white. Genome sequences of the 5 genes are intercepted from the Tifrunner genome and the lion head penguin genome and are compared, and the result shows that an InDel mark exists in the laccase gene in the Tifrunner genome compared with the laccase gene in the lion head penguin genome, namely 214bp is deleted in the 114993389bp position of the 5 th chromosome of the Tifrunner genome compared with the lion head penguin genome. No difference is found in the other 4 oxidoreductase family proteins, and the laccase gene is determined to be a target gene for regulating and controlling the color of the endopleura, so that further verification is carried out. (as shown in table 3).
TABLE 3
Figure BDA0003718807190000061
Example 2 cloning and functional verification of target Gene regulating color of inner seed coat
And respectively extracting total seed coat RNA of the yellow-white endopleura material by using a plant RNA extraction kit, and transcribing the total seed coat RNA into first-strand cDNA. Primers were designed to clone the wild type (AhLAC-WT) and mutant (AhLAC-Mu) sequences of the AhLAC gene (see FIG. 2).
The upstream sequence of the primer used was 5'-TGTTAGACAGCCAGAAATTTC-3' (SEQ ID NO.3),
the downstream sequence is 5'-CCCTATTTTTGCATAAAAGAAAGTA-3' (SEQ ID NO. 4).
The mutation occurs at 711bp of AhLAC gene CDs, and 214bp of MITE (the same minor induced-repeat transferable element) sequence is inserted, so that the translation of protein is terminated early.
The wild type sequence was overexpressed in Arabidopsis thaliana mutants, and it was found that 35S:: AhLAC positive transgenic plant (see 35S:: AhLAC in FIG. 3) had a darker color of the seed coat than the Mutant [ Mutant (atac/attt 10) ] yellow seed coat in FIG. 3, Mutant atac (attt10) had a light yellow color of the seed coat, 35S:: AhLAC positive transgenic plant had a dark yellow color of the seed coat, and wild type Arabidopsis thaliana [ see WT (Col-0) in FIG. 3 ] had a tan color of the seed coat, demonstrating that the AhLAC gene had laccase activity. 35S-the seed coat color of AhLAC plants is not restored to the wild type seed coat color, and may be related to the promoter of the overexpression vector.
The promoter of the overexpression vector used in this study was the 35S promoter of cauliflower mosaic virus (CaMV). The CaMV35S promoter is used as a constitutive promoter which can promote the expression of genes in all tissues, has persistence and does not show space-time specificity. Therefore, the expression level of 35S:: AhLAC in the seed coat may be lower than that under the control of the AtLAC (AtTT10) promoter itself, resulting in that the seed coat color of 35S:: AhLAC positive plants is not restored to wild type level.
Example 3 verification of functional molecular markers for the color of the endothelium in the Natural population
(1) Based on the wild type and mutant sequences of the AhLAC gene, 1 set of KASP primers was developed.
Extracting DNA of the peanut sample of the RIL group to be identified, and detecting genotype data of the peanut sample of the RIL group to be identified through a KASP primer.
The primer sequence is as follows:
qIIC_A05_F1:5’-GCTCAGAGAAAAAGAGAACTACATTC-3’(SEQ ID NO.5)，
qIIC_A05_F2:5’-ATTGACCATTAGATGATAGATTGTAG-3’(SEQ ID NO.6)，
qIIC_A05_com:5’-CAAGAGAAGGTATGCTGTATGCA-3’(SEQ ID NO.7)。
KASP primer mix system: the total volume was 100. mu.L, where 12. mu.L was qIIC _ A05_ F1 primer (at a concentration of 100. mu.M), 12. mu.L was qIIC _ A05_ F2 primer (at a concentration of 100. mu.M), 30. mu.L was qIIC _ A05_ com primer (at a concentration of 100. mu.M), and 46. mu.L was double distilled water.
The LGC SNpline genotyping platform used in the invention and the consumable materials of the reagents matched with the platform are purchased from LGC company in the United kingdom.
The PCR reaction system is 1 μ L: mu.L of template DNA (20-50 ng/. mu.L), oven dried and added with 1. mu.L of a mixture of 1 XKASP Master Mix and KASP primers, the volume of KASP primer in the mixture being about 1.4%, the procedure consisting of Meridian 2 And finishing by using a micro-liquid separation instrument.
PCR amplification is completed in a water bath thermal cycler, and the PCR amplification procedure is as follows: pre-denaturation at 94 ℃ for 15 min; denaturation at 94 ℃ for 20s, extension at 61-55 ℃ for 1min, 10 cycles, and temperature reduction of 0.6 ℃ in each cycle; denaturation at 94 ℃ for 20s, extension at 55 ℃ for 1min, 26 cycles; storing at 10 deg.C. And (3) reading fluorescence data of the KASP reaction product by using a microplate reader PHERAStar, and automatically converting the fluorescence result into a graph.
And (3) genotyping the InDel locus of A05.114993389 of the peanut sample to be identified in the RIL population by using a SNPLine genotyping platform.
The authenticity of the A05.114993389InDel locus in the distantly mixed 9102 and wt09-0023RIL populations was verified using the SNPLine genotyping platform (LGC) (see FIG. 4 left). If the typing result at the A05.114993389 site is mutant type (MITE: MITE), the color of the inner seed coat of the filial generation material of the RIL population is white; if the typing result at the A05.114993389 locus is a wild type (-: -), the color of the episome of the filial generation material of the RIL group is yellow, and the genotyping results of 490 families in the RIL group are completely consistent with the color of the episome (see the right part of a figure 4); the genotyping results of 31 families are heterozygote, and the color of the inner seed coat of the offspring is in the condition of yellow-white segregation.
(2) The functional molecular marker of the AhLAC gene is used for detecting natural population materials, and the genotyping result is completely linked with the color of the endopleura.
The research group selects a natural population (comprising farmer species, foreign introduction species and domestic bred species) consisting of 334 cultivar germplasms from different sources to investigate the color of the endopleura and detect the functional molecular marker of the AhLAC gene. Of the 334 parts of natural colony material, 147 parts of continuous flowering subspecies material and 187 parts of alternate flowering subspecies material were used. 78 parts of a variation of the species Vicia (var. vulgaris), 26 parts of a variation of the species Vicia (var. rostatica) and 43 parts of a material of the intermediate type (irregular fas-type); the alternate flowering subspecies material contains 79 parts of dense branch variety (var. hygoaea), 12 parts of downy variety (var. hirsuta) and 96 parts of intermediate type material (irregular hyp-type).
Extracting DNA of the peanut sample of the natural population to be identified, detecting genotype data of the peanut sample of the natural population to be identified through a KASP primer, and carrying out genotyping on an InDel locus of A05.114993389 of the peanut sample of the natural population to be identified through a SNPLine genotyping platform.
334 natural population materials were tested using KASP primer at A05.114993389InDel locus to obtain genotype data (see FIG. 5, left) for linkage analysis with the endopleural phenotype. The results show that if the typing result of the A05.114993389 site is mutant type (MITE: MITE), the color of the inner seed coat of the natural population material is white; if the typing result at the A05.114993389 site is wild type (-: -), the color of the endopleura of the natural population material is yellow, and the genotyping result of the natural population material is completely and basically consistent with the color of the endopleura (see the right part of figure 5).
The natural colony material has 2 material A05.114993389InDel locus genotypes, which are not in accordance with the color of the inner seed coat, and the genotype is wild type (-: but the color of the inner seed coat is white. The episperm of the 2 parts of materials is also white, probably because procyanidine is not accumulated in the episperm and the episperm due to upstream gene mutation of an anthocyanin synthesis channel, the laccase gene functions normally, but because no substrate is available, the color of the episperm is still white.
By combining the verification results of the distal hybrid 9102 and wt09-0023RIL population and natural population materials, the InDel marker A05.114993389 is completely linked with the color of the inner seed coat, and when the genotype is wild type (-: -), the color of the inner seed coat of the peanut material is yellow; when the genotype is the mutant type (MITE: MITE), the color of the endopleura of the peanut material is white, thus proving the accuracy of the marker.
Wherein the InDel marker A05.114993389 is located at 114993389bp of the peanut chromosome 5,
the sequence of 200bp around the wild type molecular marker A05.114993389 site is as follows:
CCTGGTGACTTTTTTCCTTGCTCAAGAGAAGGTATGCTGTATGCATGAAGATTTCATTTCAAGCATGCTCAAATGTTCTTTGATTTTAGAATCTCTAACTGCATCAATTCTTTTTGTTTTTTCACAGAAACATTCAAGTTTAATGTAGATTTTGGCAAGACTTATCTGCTGAGGATTGTGAATGCTGCAATGAATGTAGTTCTCTTTTTCTCTGTTTACAAACACAGTCTCACTGTTGTTGGTGCTGATGCTGCCTACACCGAGCCATTAACAAGAGACTTCATATGCATAGCTCCAGGACAATCACTTGATGTTTTGTTGCATGCAAATCAAGAACCTGATCACTATTACATGGCTGCAAGAGCATATTCAAGTTCCTCTATTCTTCCTTTTGATAACA(SEQ ID NO.1)；
the mutant is an inserted 214bp sequence, and the sequence 200bp before and after the A05.114993389 site of the molecular marker is (the inserted 214bp sequence is in square brackets):
CCTGGTGACTTTTTTCCTTGCTCAAGAGAAGGTATGCTGTATGCATGAAGATTTCATTTCAAGCATGCTCAAATGTTCTTTGATTTTAGAATCTCTAACTGCATCAATTCTTTTTGTTTTTTCACAGAAACATTCAAGTTTAATGTAGATTTTGGCAAGACTTATCTGCTGAGGATTGTGAATGCTGCAATGAATGTAGT[TCTCTTTTTGGCAACTACTCCTATGAAGATGCCAAAAACATCTTTTTATGATGATCTTTGTTTAAAAAGTGTAACTTATTTGTTTAGCAACACTTTAAATAAAGATAACACTTTTACTTTAAATAAAATCAAACCCTACAATCTATCATCTAATGGTCAAAATGAAATATCTTCATATGATGACAATCATAAAATCTTCATTGGAGTAGCCACC]TCTCTTTTTCTCTGTTTACAAACACAGTCTCACTGTTGTTGGTGCTGATGCTGCCTACACCGAGCCATTAACAAGAGACTTCATATGCATAGCTCCAGGACAATCACTTGATGTTTTGTTGCATGCAAATCAAGAACCTGATCACTATTACATGGCTGCAAGAGCATATTCAAGTTCCTCTATTCTTCCTTTTGATAACA(SEQ ID NO.2)。
sequence listing
<110> agricultural science institute of Henan province
<120> molecular marker of peanut endopleura color regulation gene AhLAC function and application
<130> molecular biology
<160> 7
<170> SIPOSequenceListing 1.0
<210> 1
<211> 400
<212> DNA
<213> Artificial sequence ()
<400> 1
cctggtgact tttttccttg ctcaagagaa ggtatgctgt atgcatgaag atttcatttc 60
aagcatgctc aaatgttctt tgattttaga atctctaact gcatcaattc tttttgtttt 120
ttcacagaaa cattcaagtt taatgtagat tttggcaaga cttatctgct gaggattgtg 180
aatgctgcaa tgaatgtagt tctctttttc tctgtttaca aacacagtct cactgttgtt 240
ggtgctgatg ctgcctacac cgagccatta acaagagact tcatatgcat agctccagga 300
caatcacttg atgttttgtt gcatgcaaat caagaacctg atcactatta catggctgca 360
agagcatatt caagttcctc tattcttcct tttgataaca 400
<210> 2
<211> 614
<212> DNA
<213> Artificial sequence ()
<400> 2
cctggtgact tttttccttg ctcaagagaa ggtatgctgt atgcatgaag atttcatttc 60
aagcatgctc aaatgttctt tgattttaga atctctaact gcatcaattc tttttgtttt 120
ttcacagaaa cattcaagtt taatgtagat tttggcaaga cttatctgct gaggattgtg 180
aatgctgcaa tgaatgtagt tctctttttg gcaactactc ctatgaagat gccaaaaaca 240
tctttttatg atgatctttg tttaaaaagt gtaacttatt tgtttagcaa cactttaaat 300
aaagataaca cttttacttt aaataaaatc aaaccctaca atctatcatc taatggtcaa 360
aatgaaatat cttcatatga tgacaatcat aaaatcttca ttggagtagc cacctctctt 420
tttctctgtt tacaaacaca gtctcactgt tgttggtgct gatgctgcct acaccgagcc 480
attaacaaga gacttcatat gcatagctcc aggacaatca cttgatgttt tgttgcatgc 540
aaatcaagaa cctgatcact attacatggc tgcaagagca tattcaagtt cctctattct 600
tccttttgat aaca 614
<210> 3
<211> 21
<212> DNA
<213> Artificial sequence ()
<400> 3
tgttagacag ccagaaattt c 21
<210> 4
<211> 25
<212> DNA
<213> Artificial sequence ()
<400> 4
ccctattttt gcataaaaga aagta 25
<210> 5
<211> 26
<212> DNA
<213> Artificial sequence ()
<400> 5
gctcagagaa aaagagaact acattc 26
<210> 6
<211> 26
<212> DNA
<213> Artificial sequence ()
<400> 6
attgaccatt agatgataga ttgtag 26
<210> 7
<211> 23
<212> DNA
<213> Artificial sequence ()
<400> 7
caagagaagg tatgctgtat gca 23

Claims (6)

1. The functional molecular marker of the peanut inner seed coat color regulation gene AhLAC is characterized in that the molecular marker is A05.114993389 and is positioned at 114,993,389bp of a peanut chromosome 5, and the molecular marker site is an InDel insertion deletion marker;
wherein, the sequence of 200bp around the wild molecular marker locus is as follows:
CCTGGTGACTTTTTTCCTTGCTCAAGAGAAGGTATGCTGTATGCATGAAGATTTCATTTCAAGCATGCTCAAATGTTCTTTGATTTTAGAATCTCTAACTGCATCAATTCTTTTTGTTTTTTCACAGAAACATTCAAGTTTAATGTAGATTTTGGCAAGACTTATCTGCTGAGGATTGTGAATGCTGCAATGAATGTAGTTCTCTTTTTCTCTGTTTACAAACACAGTCTCACTGTTGTTGGTGCTGATGCTGCCTACACCGAGCCATTAACAAGAGACTTCATATGCATAGCTCCAGGACAATCACTTGATGTTTTGTTGCATGCAAATCAAGAACCTGATCACTATTACATGGCTGCAAGAGCATATTCAAGTTCCTCTATTCTTCCTTTTGATAACA；
the mutant is an inserted 214bp sequence, the inserted 214bp sequence is arranged in square brackets, and the sequences of 200bp before and after the molecular marker site are as follows:
CCTGGTGACTTTTTTCCTTGCTCAAGAGAAGGTATGCTGTATGCATGAAGATTTCATTTCAAGCATGCTCAAATGTTCTTTGATTTTAGAATCTCTAACTGCATCAATTCTTTTTGTTTTTTCACAGAAACATTCAAGTTTAATGTAGATTTTGGCAAGACTTATCTGCTGAGGATTGTGAATGCTGCAATGAATGTAGT[TCTCTTTTTGGCAACTACTCCTATGAAGATGCCAAAAACATCTTTTTATGATGATCTTTGTTTAAAAAGTGTAACTTATTTGTTTAGCAACACTTTAAATAAAGATAACACTTTTACTTTAAATAAAATCAAACCCTACAATCTATCATCTAATGGTCAAAATGAAATATCTTCATATGATGACAATCATAAAATCTTCATTGGAGTAGCCACC]TCTCTTTTTCTCTGTTTACAAACACAGTCTCACTGTTGTTGGTGCTGATGCTGCCTACACCGAGCCATTAACAAGAGACTTCATATGCATAGCTCCAGGACAATCACTTGATGTTTTGTTGCATGCAAATCAAGAACCTGATCACTATTACATGGCTGCAAGAGCATATTCAAGTTCCTCTATTCTTCCTTTTGATAACA。
2. a KASP primer combination for amplifying a functional molecular marker of claim 1, comprising:
qIIC_A05_F1:5’-GCTCAGAGAAAAAGAGAACTACATTC-3’，
qIIC_A05_F2:5’-ATTGACCATTAGATGATAGATTGTAG-3’，
qIIC_A05_com:5’-CAAGAGAAGGTATGCTGTATGCA-3’。
3. the method for identifying the color of the peanut inner seed coat by using the functional molecular marker as claimed in claim 1, which comprises the following steps:
(1) extracting DNA of a peanut sample to be identified, detecting genotype data of the peanut sample to be identified by using the KASP primer combination of claim 2, and genotyping the InDel locus of A05.114993389 of the peanut sample to be identified through a SNPLine genotyping platform;
(2) if the typing result of the site A05.114993389 is mutant (MITE: MITE), the color of the inner seed coat of the peanut sample to be identified is white; if the typing result at the A05.114993389 site is the wild type (-: -), the color of the seed coat in the peanut sample to be identified is yellow.
4. The method of claim 3, wherein the step (1) is characterized by using PCR technology, and the PCR amplification procedure is as follows: pre-denaturation at 94 ℃ for 15 min; denaturation at 94 ℃ for 20s, extension at 61-55 ℃ for 1min, 10 cycles; denaturation at 94 ℃ for 20s, extension at 55 ℃ for 1min, 26 cycles; storing at 10 deg.C.
5. The use of the functional molecular marker of claim 1 in the identification of the color of the inner seed coat of peanuts.
6. Use of a functional molecular marker as claimed in claim 1 in peanut molecular breeding.
CN202210752591.2A 2022-06-28 2022-06-28 Molecular marker of peanut endopleura color regulation gene AhLAC function and application Pending CN115011728A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202210752591.2A CN115011728A (en) 2022-06-28 2022-06-28 Molecular marker of peanut endopleura color regulation gene AhLAC function and application

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202210752591.2A CN115011728A (en) 2022-06-28 2022-06-28 Molecular marker of peanut endopleura color regulation gene AhLAC function and application

Publications (1)

Publication Number Publication Date
CN115011728A true CN115011728A (en) 2022-09-06

Family

ID=83079480

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202210752591.2A Pending CN115011728A (en) 2022-06-28 2022-06-28 Molecular marker of peanut endopleura color regulation gene AhLAC function and application

Country Status (1)

Country Link
CN (1) CN115011728A (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN115725772A (en) * 2022-10-13 2023-03-03 沈阳农业大学 InDel molecular marker for identifying seed coat color of cabbage type rape and application thereof
CN116814839A (en) * 2023-08-01 2023-09-29 山东省农业科学院 Molecular marker AhyCs1 closely linked with peanut seed coat color speckles and application thereof

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN115725772A (en) * 2022-10-13 2023-03-03 沈阳农业大学 InDel molecular marker for identifying seed coat color of cabbage type rape and application thereof
CN115725772B (en) * 2022-10-13 2024-05-07 沈阳农业大学 InDel molecular marker for identifying seed coat color of cabbage type rape and application thereof
CN116814839A (en) * 2023-08-01 2023-09-29 山东省农业科学院 Molecular marker AhyCs1 closely linked with peanut seed coat color speckles and application thereof
CN116814839B (en) * 2023-08-01 2024-01-23 山东省农业科学院 Molecular marker AhyCs1 closely linked with peanut seed coat color speckles and application thereof

Similar Documents

Publication Publication Date Title
Wang et al. Functional markers developed from multiple loci in GS3 for fine marker-assisted selection of grain length in rice
CN115011728A (en) Molecular marker of peanut endopleura color regulation gene AhLAC function and application
Xie et al. SSR-and SNP-related QTL underlying linolenic acid and other fatty acid contents in soybean seeds across multiple environments
CN110205327A (en) A kind of rice temp-sensing genic male sterile gene tms3 mutant and its molecular labeling and application
BRPI0819551B1 (en) PROCESS OF INDENTIFICATION OF A CORN PLANT WITH TOLERANCE TO THE FOLLOW GRAY STAIN
CN111944921B (en) Application of brassica napus BnaA08.PDS3 gene in breeding of color traits of brassica napus petals
RU2670517C2 (en) Molecular markers for low palmitic acid content in sunflower (helianthus annus) and methods of using the same
Yang et al. Fine mapping of qAHPS07 and functional studies of AhRUVBL2 controlling pod size in peanut (Arachis hypogaea L.)
Lu et al. Structural analysis of Actinidia arguta natural populations and preliminary application in association mapping of fruit traits
WO2024139283A1 (en) Capsicum cytoplasmic male sterility fertility restoration molecular marker, typing primer and use thereof
CN108064302A (en) QTL associated with the resisting breakage of Canola and the method for identifying resisting breakage
US20200270628A1 (en) Broad Resistance to Soybean Cyst Nematode
CA2674243C (en) Genetic markers for orobanche resistance in sunflower
Haque et al. Genetic analyses of anthocyanin content using polyploid GWAS followed by QTL detection in the sweetpotato (Ipomoea batatas L.) storage root.
Dong et al. Mining of favorable marker alleles for flag leaf inclination in some rice (Oryza sativa L.) accessions by association mapping
CN116694799A (en) Site of InDel related to rice essential amino acid accumulation in rice OsAUX5 gene and application
CN114836558A (en) InDel marker linked with broccoli curd low-temperature purple-changing character, primer group and application
Cutler et al. Development of sequence characterized DNA markers linked to a temperature dependence for flower induction in lychee (Litchi chinensis Sonn.) cultivars
Wei et al. Quantitative trait locus analysis for grain size related traits of rice
JP6499817B2 (en) Function deficient glucorafasatin synthase gene and use thereof
Wang et al. A novel Effective Panicle Number per Plant 4 haplotype enhances grain yield by coordinating panicle number and grain number in rice
CN113278726B (en) Molecular marker Oil-4-3776551 for assisting in identifying high and low soybean Oil content, kit and method
JP4298538B2 (en) Genetic markers linked to loci involved in dormancy and their use
CN118127227B (en) InDel and KASP molecular marker for size and shape of watermelon seeds and application
CN113355443B (en) Molecular marker Oil-11-6708663 for assisting in identifying high and low soybean Oil content, kit and method

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination