CN114836558A - InDel marker linked with broccoli curd low-temperature purple-changing character, primer group and application - Google Patents

InDel marker linked with broccoli curd low-temperature purple-changing character, primer group and application Download PDF

Info

Publication number
CN114836558A
CN114836558A CN202210311631.XA CN202210311631A CN114836558A CN 114836558 A CN114836558 A CN 114836558A CN 202210311631 A CN202210311631 A CN 202210311631A CN 114836558 A CN114836558 A CN 114836558A
Authority
CN
China
Prior art keywords
low
broccoli
temperature
seq
indel
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN202210311631.XA
Other languages
Chinese (zh)
Other versions
CN114836558B (en
Inventor
虞慧芳
顾宏辉
王建升
沈钰森
盛小光
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Zhejiang Academy of Agricultural Sciences
Original Assignee
Zhejiang Academy of Agricultural Sciences
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Zhejiang Academy of Agricultural Sciences filed Critical Zhejiang Academy of Agricultural Sciences
Priority to CN202210311631.XA priority Critical patent/CN114836558B/en
Publication of CN114836558A publication Critical patent/CN114836558A/en
Application granted granted Critical
Publication of CN114836558B publication Critical patent/CN114836558B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/6858—Allele-specific amplification
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/13—Plant traits
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Analytical Chemistry (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Molecular Biology (AREA)
  • Physics & Mathematics (AREA)
  • Genetics & Genomics (AREA)
  • General Health & Medical Sciences (AREA)
  • Immunology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Botany (AREA)
  • Mycology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention discloses an InDel marker linked with a broccoli curd low-temperature purple-changing character, a primer group and application thereof, wherein the nucleotide sequence of the InDel marker is shown as SEQ ID NO.6, the InDel marker is closely linked with the broccoli curd low-temperature purple-changing character, and the physical position of the InDel marker is Chr9.60169854. The InDel marker linked with the low-temperature purple-changing character of the broccoli curd can be applied to auxiliary selection of the low-temperature purple/green character of the broccoli curd, and batch detection can be performed on breeding materials at an early stage, so that a large number of non-ideal materials can be eliminated at the early stage, the detection is convenient, the cost is low, and the workload of field planting, field management and phenotype identification required at the later stage is greatly reduced.

Description

InDel marker linked with broccoli curd low-temperature purple-changing character, primer group and application
Technical Field
The invention relates to an InDel marker linked with a broccoli curd low-temperature purple-changing character, in particular to an InDel marker linked with a broccoli curd low-temperature purple-changing character, a primer group and application.
Background
Broccoli (Brassica oleracea L.var. italica) is a variety of Brassica oleracea of Brassica in brassicaceae and takes a ball of flowers as a product, is highly popular among people due to rich nutrition and rich sulforaphane, and the cultivation area is increased year by year in recent years. The phenomenon that the broccoli is purple when meeting low temperature often appears in the production, and the appearance quality of the commercial flowery balls is influenced.
Research has shown that Plant purple is a pigment display of betalains or anthocyanins (Biosynthesis of pigments: anthocyanins, betalains and carotenoids. Plant J.2008; 54: 733-49; La vitamin en rose: "Biosynthesis, sources, and applications of betalains. mol plant.2018; 11(1): 7-22; illumination colors: alignment of carotenoids and accumulation by light. Current Plant biol.2017; 37: 49-55). The beet red pigment is purple or yellow and only exists in plants of Caryophyllales; anthocyanins are ubiquitous in many different plant species, exhibiting colors ranging from red to purple to blue (Outchkourov NS, Karlova R,
Figure BDA0003568585330000011
m, Schrama X, Blilou I, Jongedijk E, et al. transformation factor-mediated control of anticancer in biochemical in vector properties. J Plant physical.2018; 176(2):1862-78.). The research result of The brilliant Purple of The Brassica Plant shows that The brilliant Purple in The Brassica Plant is caused by The expression enhancement of a transcription factor MYB (The pure promoter from activity of a MYB transcription factor. Plant physiol.2010; 154(3) 1470-80; pure promoter from a. cadita F. rubra is to The low of The BoMYBL2-1 expression. BMC biol.2018; 18: 82-97).
At present, the low-temperature purple property of broccoli curd is not researched much, and the research report of sites or markers closely linked with the property is rarely seen. The low-temperature green keeping of broccoli florae is one of breeding directions for a long time. Therefore, the method has important production and application values and practical significance for digging and developing the genes for controlling the low-temperature purple change of broccoli bulbs and related molecular markers, and provides technical support for polymerizing low-temperature green-keeping excellent sites of broccoli, cultivating new low-temperature-resistant broccoli varieties, identifying materials and the like.
Disclosure of Invention
The invention aims to provide an InDel marker linked with a broccoli low-temperature purple-changing character, a primer group and application, which can detect broccoli materials, can detect the broccoli low-temperature purple-changing materials quickly and accurately in an early stage, and can perform gene typing on the developed InDel marker by using a KASP technology.
In order to achieve the aim, the invention provides an InDel marker linked with the broccoli curd low-temperature purple-changing character, the nucleotide sequence of the InDel marker is shown as SEQ ID NO.6, the InDel marker is closely linked with the broccoli curd low-temperature purple-changing character, and the physical position of the InDel marker is Chr 9.60169854.
Another objective of the present invention is to provide an InDel marker primer set linked with broccoli curd low-temperature purple-changing trait, the primer set comprising: a specific Primer F with a nucleotide sequence shown as SEQ ID NO.1, a specific Primer H with a nucleotide sequence shown as SEQ ID NO.2, and a general Primer C with a nucleotide sequence shown as SEQ ID NO. 3.
Preferably, the 5' ends of the specific Primer F and the specific Primer H are respectively connected with different fluorescent sequences, and the fluorescent sequences are respectively FAM fluorescent sequence and HEX fluorescent sequence.
Preferably, the FAM fluorescent sequence is shown as SEQ ID NO. 4.
Preferably, the HEX fluorescent sequence is shown as SEQ ID NO. 5.
Another objective of the present invention is to provide an application of the InDel-labeled primer set, wherein the application is selected from any one of the following:
(1) the application in identifying the low-temperature purple and low-temperature green characters of broccoli flower balls;
(2) the application in molecular marker assisted breeding of broccoli.
The invention also aims to provide a method for identifying the low-temperature discoloration character of broccoli curd, which comprises the following steps: adopting the InDel labeled primer group, taking the DNA genome of the broccoli to be detected as a template, carrying out KASP reaction, and analyzing the low-temperature discoloration character of the broccoli curd according to the result: if only the amplification product with the nucleotide sequence shown as SEQ ID NO.6 is inserted, the flower ball of the broccoli to be detected shows low-temperature purple; if only the amplification product without the nucleotide sequence insertion shown as SEQ ID NO.6 exists, the flower ball of the broccoli to be detected shows low-temperature green keeping; if the amplification product of the nucleotide sequence insertion shown in SEQ ID NO.6 exists or does not exist, the flower ball of the broccoli to be detected shows low-temperature purple.
The InDel marker linked with the low-temperature purple-changing character of broccoli curd, the primer group and the application have the following advantages:
the InDel marker linked with the low-temperature purple-changing character of the broccoli curd can be applied to auxiliary selection of the low-temperature purple/green character of the broccoli curd, can carry out batch detection on breeding materials in the early stage, can eliminate a large number of non-ideal materials in the early stage, is convenient to detect and low in cost, and greatly reduces the workload of field planting, field management and phenotype identification required in the later stage.
The traditional breeding method completely depends on the selection of the survey result of the flower ball color, the low-temperature purple change of flower buds of the flower balls is dominant on the low-temperature green keeping of the flower buds of the flower balls, individuals with purple phenotypes do not represent gene loci which do not carry the low-temperature green keeping, so that the selection of materials with low-temperature green keeping by using the phenotypes usually needs additional selfing for one generation, and a large amount of time is consumed; if the individuals with low-temperature purple color are directly eliminated, some individuals with other excellent characters are lost unconsciously. The method can be used for identifying the genotype of the corresponding site and directly determining whether the sample contains the gene which keeps green at low temperature.
The invention carries out genotyping on the developed InDel marker by using the KASP technology, and the automation of PCR system construction, fluorescent signal detection and the like in the KASP technical process can realize high-throughput sample detection.
Drawings
FIG. 1 is a KASP typing map of a segregating population according to the invention.
Detailed Description
The technical solutions in the embodiments of the present invention will be clearly and completely described below, and it is obvious that the described embodiments are only a part of the embodiments of the present invention, and not all embodiments. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.
Example 1 InDel marker linked with Low temperature purple-changing character of broccoli curd
1. Primer design
Primary localization and BC by BSA-QTL 2 F 2 The method comprises the following steps of (1) obtaining a physical position (Chr9.60169854) of a marker closely linked with a broccoli curd low-temperature purple-changing character through series analysis of large groups, wherein whether the site has a deletion of a 43bp base (SEQ ID NO.6) or not, and if the site has the deletion, the corresponding curd shows that the low-temperature green-keeping is realized; if the locus is not deleted, the corresponding flower ball shows low-temperature purple; if the locus is a heterozygous locus, the corresponding flower ball shows low-temperature purple. Extracting InDel locus and flanking sequence, designing primer groups (two specific primers and one universal primer), and respectively connecting FAM and HEX fluorescent sequences to the 5' ends of the two specific primers.
Nucleotide sequence of 43bp bases (SEQ ID NO. 6):
ATCCGTTAGAGTTCCACCCTCACCGTCAAAATCAGTTCCCTTA；
nucleotide sequence of specific primer PrimerF (SEQ ID NO. 1):
5’-CAATAGCAAGGCTTTGATCTCAGTAG-3’；
nucleotide sequence of specific Primer H (SEQ ID NO. 2):
5’-CAATAGCAAGGCTTTGATCTCAGTAT-3’；
nucleotide sequence of Universal Primer C (SEQ ID NO. 3):
5’-GCACACGGACATGCTTAGCACTTTA-3’；
FAM fluorescent sequence (SEQ ID NO. 4):
GAAGGTGACCAAGTTCATGCT；
HEX fluorescent sequence (SEQ ID NO. 5):
GAAGGTCGGAGTCAACGGATT。
2. InDel labeling application
(1) Extraction of genomic DNA of broccoli to be detected
Extracting genome DNA from the broccoli material to be detected according to a conventional CTAB method, and storing at-20 ℃ for later use.
(2) KASP reaction test
The KASP reaction was performed on an IntelliQube high throughput genotyping platform (LGC, Biosearch Technologies).
About 5-10 ng of DNA sample was added to the microwell reaction plate, and KASP reaction solution was added to obtain 1.6. mu.L of total reaction system, wherein the final concentration of Primer C was 1.74. mu.M, and the final concentrations of Primer F and Primer H were both 0.69. mu.M, 1 XKASP MasterMix.
PCR amplification is completed in a water bath thermal cycler, and the Touchdown PCR reaction conditions are as follows: pre-denaturation at 94 ℃ for 15min for 1 cycle; denaturation at 94 ℃ for 20sec, annealing at 61-55 ℃ and extension for 60sec, 10 cycles, wherein the annealing and extension temperature is reduced by 0.6 ℃ in each cycle; the second amplification reaction, denaturation at 94 ℃ for 20s, annealing at 55 ℃ and extension for 60s, 26 cycles.
After the reaction is finished, fluorescence data reading is carried out on the KASP reaction product by utilizing IntelliQube, and the result of fluorescence scanning is automatically converted into a graph.
(3) Tagging typed data
According to the above detection method, for one F 2 92 individuals (F2 segregating population selfed after crossing of a low-temperature purple-emitting pure material and a low-temperature non-purple-emitting pure material) and 23 important broccoli pure materials in the segregating population are verified. The KASP validation results for 92 individuals matched the phenotype by 100%. The KASP validation results for 23 core materials gave 95% agreement with the phenotype (see table 1). Therefore, the primers can be used for detecting the low-temperature purple/green-keeping character of the broccoli curd with high efficiency and high precision. The phenotype of the 23 parts of core materials is not matched with the KASP detection result by 100 percent, which indicates that the low-temperature green-keeping gene or site of the broccoli in nature is not limited to the site involved in the invention.
TABLE 1 genotyping data for 23 materials
Figure BDA0003568585330000051
Note: deletion represents a Deletion; insert denotes insertion; HX-1 to HX-23 are all pure breeding materials.
FIG. 1 is a KASP typing map of an isolated population tested against 92 individuals according to the present invention, wherein blue dots represent low temperature bud purple, red dots represent low temperature bud green, and purple dots represent low temperature bud purple, but contain genes that remain green at low temperature.
While the present invention has been described in detail with reference to the preferred embodiments, it should be understood that the above description should not be taken as limiting the invention. Various modifications and alterations to this invention will become apparent to those skilled in the art upon reading the foregoing description. Accordingly, the scope of the invention should be determined from the following claims.
Sequence listing
<110> Zhejiang province academy of agricultural sciences
<120> InDel marker linked with broccoli curd low-temperature purple-changing character, primer group and application
<160> 6
<170> SIPOSequenceListing 1.0
<210> 1
<211> 26
<212> DNA
<213> Artificial Sequence
<400> 1
caatagcaag gctttgatct cagtag 26
<210> 2
<211> 26
<212> DNA
<213> Artificial Sequence
<400> 2
caatagcaag gctttgatct cagtat 26
<210> 3
<211> 25
<212> DNA
<213> Artificial Sequence
<400> 3
gcacacggac atgcttagca cttta 25
<210> 4
<211> 21
<212> DNA
<213> Artificial Sequence
<400> 4
gaaggtgacc aagttcatgc t 21
<210> 5
<211> 21
<212> DNA
<213> Artificial Sequence
<400> 5
gaaggtcgga gtcaacggat t 21
<210> 6
<211> 43
<212> DNA
<213> Artificial Sequence
<400> 6
atccgttaga gttccaccct caccgtcaaa atcagttccc tta 43

Claims (7)

1. An InDel marker linked with a broccoli curd low-temperature purple-changing character is characterized in that the nucleotide sequence of the InDel marker is shown as SEQ ID No.6, the InDel marker is closely linked with the broccoli curd low-temperature purple-changing character, and the physical position of the InDel marker is Chr 9.60169854.
2. An InDel marker primer group linked with the low-temperature purple-changing character of broccoli curd is characterized by comprising: a specific Primer F with a nucleotide sequence shown as SEQ ID NO.1, a specific Primer H with a nucleotide sequence shown as SEQ ID NO.2, and a general Primer C with a nucleotide sequence shown as SEQ ID NO. 3.
3. The InDel labeled Primer set as claimed in claim 2, wherein the specific Primer F and the specific Primer H have different fluorescence sequences at their 5' ends, and the fluorescence sequences are FAM fluorescence sequence and HEX fluorescence sequence, respectively.
4. The InDel labeled primer set according to claim 3, wherein the FAM fluorescent sequence is shown in SEQ ID No. 4.
5. The InDel labeled primer set according to claim 3, wherein the HEX fluorescent sequence is shown as SEQ ID No. 5.
6. Use of the InDel labeled primer set according to any one of claims 2-5, selected from any one of the following:
(1) the application in identifying the low-temperature purple and low-temperature green characters of broccoli flower balls;
(2) the application in molecular marker assisted breeding of broccoli.
7. A method for identifying the low-temperature discoloration character of broccoli curd is characterized by comprising the following steps:
carrying out KASP reaction by adopting the InDel labeled primer group as any one of claims 2-5 and taking the DNA genome of the broccoli to be detected as a template, and analyzing the low-temperature discoloration character of the broccoli ball according to the result:
if only the amplification product with the nucleotide sequence shown as SEQ ID NO.6 is inserted, the flower ball of the broccoli to be detected shows low-temperature purple;
if only the amplification product without the nucleotide sequence insertion shown as SEQ ID NO.6 exists, the flower ball of the broccoli to be detected shows low-temperature green keeping;
if the amplification product of the insertion of the nucleotide sequence shown in SEQ ID No.6 exists or not, the curd of the broccoli to be detected shows low-temperature purple.
CN202210311631.XA 2022-03-28 2022-03-28 InDel marker linked with broccoli low Wen Bianzi trait, primer set and application Active CN114836558B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202210311631.XA CN114836558B (en) 2022-03-28 2022-03-28 InDel marker linked with broccoli low Wen Bianzi trait, primer set and application

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202210311631.XA CN114836558B (en) 2022-03-28 2022-03-28 InDel marker linked with broccoli low Wen Bianzi trait, primer set and application

Publications (2)

Publication Number Publication Date
CN114836558A true CN114836558A (en) 2022-08-02
CN114836558B CN114836558B (en) 2023-10-10

Family

ID=82563243

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202210311631.XA Active CN114836558B (en) 2022-03-28 2022-03-28 InDel marker linked with broccoli low Wen Bianzi trait, primer set and application

Country Status (1)

Country Link
CN (1) CN114836558B (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN114836560A (en) * 2022-03-28 2022-08-02 浙江省农业科学院 SNP molecular marker linked with broccoli hypocotyl color character and application and method thereof

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110791550A (en) * 2019-11-29 2020-02-14 广东省农业科学院蔬菜研究所 Mustard blue InDel molecular markers and development method and application thereof
CN113151529A (en) * 2020-12-04 2021-07-23 湖北省农业科学院经济作物研究所 InDel marker for identifying radish flower color control gene and application thereof

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110791550A (en) * 2019-11-29 2020-02-14 广东省农业科学院蔬菜研究所 Mustard blue InDel molecular markers and development method and application thereof
CN113151529A (en) * 2020-12-04 2021-07-23 湖北省农业科学院经济作物研究所 InDel marker for identifying radish flower color control gene and application thereof

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
FENG-QING HAN: "Inheritance and InDel markers closely linked to petal color gene (cpc-1) in Brassica oleracea", 《MOL BREEDING》, vol. 35, pages 160 *
MD ABDUR RAHIM: "Molecular analysis of anthocyanin biosynthesis-related genes reveal BoTT8 associated with purple hypocotyl of broccoli ( Brassica oleracea var. italicaL.)", 《GENOME》, vol. 62, no. 4, pages 253 - 266, XP009541883, DOI: 10.1139/gen-2018-0173 *
NCBI: "PREDICTED: Brassica oleracea var. oleracea flavonoid 3\'-monooxygenase (LOC106313667), mRNA, XM_013751545.1", 《GENBANK》 *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN114836560A (en) * 2022-03-28 2022-08-02 浙江省农业科学院 SNP molecular marker linked with broccoli hypocotyl color character and application and method thereof
CN114836560B (en) * 2022-03-28 2023-09-01 浙江省农业科学院 SNP molecular marker linked with broccoli hypocotyl color traits and application and method thereof

Also Published As

Publication number Publication date
CN114836558B (en) 2023-10-10

Similar Documents

Publication Publication Date Title
CN113604592B (en) InDel molecular marker with white cauliflower ball purple character, primer and application thereof
CN109593876A (en) The KASP label serotype specific primer group and its application of high throughput detection AhFAD2B gene mutation site
CN109609687B (en) KASP marker primer combination for detecting watermelon fusarium wilt resistance and application thereof
CN114836558A (en) InDel marker linked with broccoli curd low-temperature purple-changing character, primer group and application
CN108220473A (en) It is marked using chloroplaset InDel and differentiates CMS-S maize material
CN106167825B (en) A kind of relevant microsatellite marker of yellow catfish growing characteristic and its detection and application
CN108103162A (en) The core SNP marker identified for cabbage hybrid and its application based on KASP technological development
CN114606332A (en) SNP (Single nucleotide polymorphism) site and Hf-KASP1 marker for judging pulp hardness of watermelon and application thereof
CN102690814B (en) Molecule marker SIsv0491 closely linked with millet bristle color gene
CN109811075B (en) Method for identifying authenticity of Chinese cabbage variety and special SNP primer combination thereof
CN110283929A (en) The relevant SNP marker 5-160 of capsicum epidemic disease resistant gene and its specific primer and application
CN113832251B (en) SNP locus combination for detecting tomato mosaic virus resistance and application thereof
CN113278723B (en) Composition for analyzing genetic diversity of Chinese cabbage genome segment or genetic diversity introduced in synthetic mustard and application
CN113528702B (en) KASP marker closely linked with main effect QTL of lycopene in carrot and primer and application thereof
CN102690813B (en) Molecule marker SIsv0701 closely linked with millet bristle color gene
CN112029898B (en) SNP marker for identifying broccoli variety Zhe Qing 100
CN111334597B (en) SNP (Single nucleotide polymorphism) site and KASP (Kaempferi protein) marker for detecting powdery mildew resistance of watermelon and application thereof
CN110358855B (en) SNP (Single nucleotide polymorphism) marker 5-156 of pepper phytophthora disease resistance gene as well as specific primer and application thereof
CN110317897B (en) SNP marker 5-162 related to pepper phytophthora blight resistance gene and specific primer and application thereof
Cutler et al. Development of sequence characterized DNA markers linked to a temperature dependence for flower induction in lychee (Litchi chinensis Sonn.) cultivars
CN109504797A (en) A kind of SNP marker and its application based on the identification pear tree early blossoming of high-resolution solubility curve
CN116590453B (en) SNP molecular marker related to dwarf trait of lotus plant and application thereof
CN116622877B (en) SNP molecular marker related to lotus rhizome internode shape and application thereof
CN115852032B (en) Gene related to cowpea pod color, KASP (KASP-related protein kinase) marker and application thereof
CN114908183B (en) Method for identifying resistance of cucumber scab, SNP (Single nucleotide polymorphism) special primer set and application

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant