CN115011609B - BnaFANCM gene, application and method for obtaining male sterile mutant of rape - Google Patents

Abstract

The invention provides BnaFANCM gene, application and a method for obtaining a male sterile mutant of rape, relating to the technical fields of plant gene editing and plant breeding; firstly, obtaining homologous sequences BnaFANCM-C05 and BnaFANCM-A05 of 2 FANCMs; target1 and Target2 of CRISPPR/Cas 9 are designed according to the sequence of BnaFANCM-C05 gene; then constructing recombinant vectors pKSE401-BnaFANCM-CRISPR of which Target1 and Target2 are respectively fused with sgRNA; GV3101 containing pKSE 401-BnafaFANCM-CRISPR vector infects rape to obtain transgenic plant. The invention utilizes CRISPR/Cas9 system to edit the BnaFANCM gene of the cabbage type rape so as to create new male sterile rape germplasm resources, which not only has wide application prospect in rape heterosis utilization, but also has wide application prospect in the aspect of new germplasm creation.

Description

BnaFANCM gene, application and method for obtaining male sterile mutant of rape

Technical Field

The invention relates to BnaFANCM gene, application and a method for obtaining male sterile mutant of rape, belonging to the technical field of plant gene editing and plant breeding.

Background

Cabbage type rape (Brassica napus l.) belongs to the brassicaceae family, brassica, and is one of the most important oil crops in china. The original rape is produced in the Mediterranean region of Europe, the 20 th century of China is introduced from Japan, and the original rape is introduced from Europe later, because the planting history of the rape in China is only nearly one hundred years, the excellent and heterogeneous resource is lacking, the rape germplasm resource is an indispensable material basis for scientific research, variety improvement and industrial development, and the research on the excellent and heterogeneous resource is an important field for guaranteeing the continuous development of new varieties of crops and the sustainable development of agricultural production, and is also the core competitive embodiment of the country in the crop breeding field.

At present, a male sterile system for utilizing rape heterosis in China mainly surrounds a cytoplasmic male sterile system and a nuclear male sterile system, but the 2 systems have some defects in practical production and application; in recent years, new progress is continuously made in the field of male sterility research of rape in China, and development of some molecular markers, cloning and research of breeding related genes and research of male sterility cultivation of the rape are continuously promoted.

The FANCM gene is involved in normal homologous chromosomal crossover, mitotic recombination and fertility of meiotic cells, and in Arabidopsis FANCM (a homolog of the mammalian Fanconi anemia complement M) inhibits recombination.

In recent years, the CRISPR/Cas9 (Clustered regulularly interspaced short palindromic repeats and CRISPR associated) system is an emerging genetic engineering technology capable of efficiently and accurately editing genome, and no report on the improvement of a rape FANCM gene by utilizing the CRISPR/Cas9 system exists at present.

Disclosure of Invention

Aiming at some defects and shortcomings of the prior art, the invention provides a novel method for creating male sterile rape germplasm resources; the invention also utilizes CRISPR/Cas9 system to carry out site-directed mutagenesis on the BnaFANCM gene of the brassica napus, thus obtaining a male sterile transgenic plant.

In order to achieve the technical purpose, the invention adopts the following technical scheme:

the invention firstly provides a male sterility related gene BnaFANCM of rape, wherein the gene BnaFANCM comprises a gene BnaFANCM-C05 and a gene BnaFANCM-A05, the nucleotide sequence of the BnaFANCM-C05 is shown as SEQ.ID.NO.8, and the nucleotide sequence of the BnaFANCM-A05 is shown as SEQ.ID.NO. 9.

The invention also provides an application of the BnaFANCM gene in male sterile breeding of rape.

The invention also provides a gene editing vector pKSE401-BnafANCM-CRISPR, which comprises a CRISPR/Cas9 system sequence element group for the BnafANCM gene editing of brassica napus, wherein the system sequence comprises U6-26p-Target1-gRNA, U6-26p-Target2-gRNA, a Cas9 gene optimized according to codons and a resistance gene Kana.

The invention also provides a genetically engineered bacterium for BnaFANCM gene editing of brassica napus, which is obtained by transforming host bacterium GV3101 by using the gene editing vector pKSE401-BnaFANCM-CRISPR.

The invention firstly provides a method for obtaining male sterile mutants of brassica napus, which utilizes a CRISPR/Cas9 system to edit the BnaFANCM gene of brassica napus, and further comprises the following steps:

(1) Target1 and Target2 of sgRNA are designed and screened aiming at BnaFANCM gene sequences in brassica napus, the nucleotide sequence of the Target1 is shown as SEQ ID No.1, the nucleotide sequence of the Target2 is shown as SEQ ID No.2, and primers required for constructing vectors are synthesized.

(2) Constructing a double-target CRISPR/Cas9 gene editing vector: and 2 targets, namely Target1 and Target2, are respectively connected with the sgRNA sequence through PCR amplification and enzyme digestion, so that a double-Target gene editing vector pKSE401-BnaFANCM-CRISPR is constructed.

(3) Transforming agrobacterium with pKSE401-BnafANCM-CRISPR vector to obtain agrobacterium with gene editing expression vector pKSE401-BnafANCM-CRISPR;

(4) Transferring the pKSE401-BnaFANCM-CRISPR vector into a receptor material by using an agrobacterium transformation mode, and obtaining a transgenic plant through the steps of infection of rape hypocotyl, callus induction, redifferentiation, rooting culture and the like.

Further, in order to verify that the obtained plant is a target plant, positive seedling plants are screened from transgenic plants, amplification identification is carried out by utilizing U626F/R and Cas9F/R, positive seedling FANCM gene target sequences are amplified by PCR and are connected with T vectors to be sent to a biological engineering company for sequencing, sequencing results are compared, and meanwhile, an editing form is determined.

Wherein the BnaFANCM genes of the brassica napus comprise BnaFANCM-C05 and BnaFANCM-A05, the nucleotide sequence of the sgRNA is shown as SEQ.ID.NO.3, and the Target1 and the Target2 are common targets of the BnaFANCM-C05 and the BnaFANCM-A05 genes;

the nucleotide sequence of BnaFANCM-C05 is shown as SEQ.ID.NO.8, and the amino acid sequence is shown as SEQ.ID.NO. 10;

the nucleotide sequence of BnaFANCM-A05 is shown as SEQ ID.NO.9, and the amino acid sequence is shown as SEQ ID.NO. 11.

The primer sequences in step (1) are as follows:

DT ₁ -BsF(SEQ.ID.NO.4)：

ATATATGGTCTCGATTGAGTCCACACGAATTACTTAGTT

DT ₂ -BsR(SEQ.ID.NO.5)：

ATTATTGGTCTCGAAACGCTGAACTTTTTGCGACTGCAA

DT ₁ -F0(SEQ.ID.NO.6)：

TGAGTCCACACGAATTACTTAGTTTTAGAGCTAGAAATAGC

DT ₂ -R0(SEQ.ID.NO.7)：

AACGCTGAACTTTTTGCGACTGCAATCTCTTAGTCGACTCTAC

the agrobacterium in step (3) is agrobacterium GV3101, and the acceptor material is Y127.

The invention also provides application of the FANCM gene or the method in obtaining the male sterile mutant of the rape, and further, the application is to edit the FANCM gene by using a CRISPR/Cas9 system, so as to further obtain the male sterile mutant of the rape; further, the rape FANCM gene comprises BnaFANCM-C05 and BnaFANCM-A05.

The invention also provides a method for editing BnaFANCM through CRISPR/Cas9 to obtain BnaFANCM edited mutants fancm-1, fancm-2 and fancm-3, further observing the phenotype of the gene edited BnaFANCM mutant, and finding that the mutant shows a male sterile phenotype relative to a wild type; the method for obtaining a new male sterile plant by utilizing the CRISPR/Cas9 system directional mutation BnaFANCM provides a new germplasm resource for hybrid breeding of cabbage type rape and has wide application prospect in molecular design breeding of the rape.

In the invention, the BnaFANCM gene is edited, and the main editing type is that the insertion of T base causes the frame shift mutation of the gene.

The invention has the following advantages and beneficial effects:

at present, materials with natural mutation are screened and identified to obtain sterile lines, and physical ray mutagenesis or chemical mutagenesis is also manually carried out, and then the sterile lines are screened; the mutation rate of natural mutation and physicochemical mutation is low, a large amount of screening materials are needed, and manpower and material resources are greatly lost. Therefore, the invention focuses on the gene editing technology, and edits fertility genes to generate sterile line materials.

(1) In the invention, one of the limiting factors for limiting gene recombination or limiting the generation of new genotypes is relieved by editing the BnaFANCM gene, so that more genotypes are generated; the genotype determines the phenotype, so that a plurality of plants with different phenotypes can be finally generated, and the selection of favorable phenotypes for breeding is facilitated.

(2) The BnaFANCM gene is specifically knocked out in the cabbage type rape by adopting the method, so that single plants with different mutation types of BnaFANCM are obtained, and the fertility of the single plants is obviously reduced compared with that of a receptor material Y127;

(3) The method for obtaining a new sterile plant by utilizing CRISPR/Cas9 system directional mutation BnaFANCM provides a new germplasm resource for hybrid seed selection of brassica napus;

(4) The method provides an advantageous material for heterosis utilization in hybrid seed production, and has important theoretical and practical significance;

(5) The BnaFANCM mutant plant offspring can continuously generate new genotypes, and compared with natural mutation, the BnaFANCM mutant plant offspring accelerates the generation of new phenotypes;

(6) The gene editing vector pKSE401-BnaFANCM-CRISPR constructed by the invention converts rape to obtain a transformant, and provides experimental materials for researching the functions and action mechanisms of the gene BnaFANCM. The method of the invention can be applied to heterosis and three-line hybridization, and the obtained mutant plants are continuously mutated, namely the plants are sterile, but more genotypes are generated by increasing gene recombination when the plants are sterile and homozygous.

Drawings

FIG. 1 is a schematic representation of a pKSE401-BnafANCM-CRISPR vector; LB in the figure: a left boundary; RB: a right boundary; kan: kanamycin resistance gene; 35S: the CaMV35 promoter; u6-26p-Target1-gRNA: a group of gRNA expression elements comprising promoter U6-26p, target1 (Target 1) and a gRNA backbone structure; u6-26p-Target2-gRNA: a group of gRNA expression elements including promoter U6-26p, target2 (Target 2) and gRNA backbone structure; cas9: cas9 gene optimized according to codon.

FIG. 2 is a diagram of a PCR identification gel for extracting leaf genome from a positive plant obtained by transformation; in the figure, WT: wild type; fascm-1, fascm-2, fascm-3: a mutant transgenic plant; +: positive control, pKSE 401-bnafacm-CRISPR plasmid; -: negative control, ddH ₂ O；Marker：Takara DL2000 DNA Marker。

FIG. 3 is a schematic diagram showing the analysis of the sequencing results of specific positions (a), bnaFANCM-C05 gene (b) and BnaFANCM-A05 gene (C) of the target point of BnaFANCM-C05 in the fancm mutant compared with the wild type.

FIG. 4 is a simplified schematic representation of frame shift mutations resulting from T insertion at the fancm mutant target 1; in the figure, (a) is an alteration of the BnaFANCM-C05 gene in the mutant compared to the wild type; (b) Is an alteration of the BnaFANCM-A05 gene in the mutant compared to the wild type.

FIG. 5 is a mutant material T ₀ The phenotype observation of the self-copulation fruits of the partial strain of the generation and the phenotype observation of the back-and-forth copulation, wherein (a) is T ₀ Observing the phenotype of the self-copulated fruits of the partial strain; (b) Is a positive and negative cross phenotype observation of the fascm mutant and the Wild Type (WT).

Detailed Description

In order to enable those skilled in the art to better understand the technical scheme of the present invention, the following detailed description of the preferred embodiments of the present invention is provided, but the following embodiments do not limit the scope of the present invention.

In the examples of the present invention, which are not described in detail, the processes involved in the examples are all performed by conventional experimental methods, and the materials or reagents not specifically described are all conventional commercially available materials, which are understood and easily implemented by those skilled in the art based on the product specification or the basic knowledge in the art, and thus will not be described in detail.

The culture medium and the formula thereof are as follows:

LB liquid medium: 10g of tryptone, 5g of yeast extract and 10g of sodium chloride are weighed and dissolved in 800mL of ddH ₂ And (3) in O, the volume is fixed to 1L, then the mixture is split into 10 conical flasks and sealed by sealing films, the mixture is sterilized at the high temperature of 121 ℃ for 15min, cooled and then stored at the temperature of 4 ℃.

LB solid medium: weighing 10g of tryptone, 5g of yeast extract, 10g of sodium chloride and 15g of agar powder, dissolving in 800mL of ddH ₂ And (3) in O, the volume is fixed to 1L, the mixture is split into 10 conical flasks and sealed by sealing films, the mixture is sterilized at the high temperature of 121 ℃ for 15min, cooled and then stored at the temperature of 4 ℃. When in use, the mixture is put into a microwave oven to be heated until the mixture is melted, the antibiotics are added when the liquid is cooled to about 50 ℃, and the mixture is immediately poured into a sterile plate after shaking, wherein each plate is about 10mL.

M0 Medium (1L): MS powder 4.4g, sucrose 30g,800ml ddH ₂ Fully dissolving O, regulating the pH value to 5.84-5.88, fixing the volume to 1L, finally adding 10g of coagulant Agar, sterilizing, packaging into sterile plates, and placing into a refrigerator at 4 ℃ for standby.

DM medium (1L): MS powder 4.4g, sucrose 30g,800ml ddH ₂ O is fully dissolved, the pH value is regulated to 5.84-5.88, the volume is fixed to 1L, the AS is added after the culture medium is cooled, 1mL AS (100 mu mol/mL of mother solution) is added into 1L, and the mixture is put into a refrigerator at 4 ℃ for standby.

M1 Medium (1L): MS powder 4.4g, sucrose 30g, mannitol 18g,2, 4-D1mg,KT 0.3mg,800ml ddH ₂ O is fully dissolved, the pH value is regulated to 5.84-5.88, the volume is fixed to 1L, finally, 10g of coagulant agent and 10g of sterilization agent are added, AS is added after the culture medium is quickly cooled, 1mL of AS (mother liquor 100 mu mol/mL) is added into 1L, and then the mixture is packaged into a sterile plate and placed in a refrigerator at 4 ℃ for standby.

M2 medium (1L): MS powder 4.4g, sucrose 30g, mannitol 18g,2,4-D 1mg，KT 0.3mg，800ml ddH ₂ o is fully dissolved, the pH value is regulated to 5.84-5.88, the volume is fixed to 1L, then 10g of coagulant agent, namely, agar is added, and after sterilization, the culture medium is quickly cooled and then added: temeitin 300mg, STS 150. Mu. Mol, kanamycin 25mg, and then split charged into sterile dishes and placed in a refrigerator at 4℃for use.

M3 Medium (1L): MS powder 4.4g, glucose 10g, xylose 0.25g,MES 0.6g,800ml ddH ₂ O is fully dissolved, the pH value is regulated to 5.84-5.88, the volume is fixed to 1L, then 10g of coagulant agent, namely, agar is added, and after sterilization, the culture medium is quickly cooled and then added: ZT 2mg, IAA 0.1mg, timentin 300mg, agNO ₃ 150. Mu. Mol, 25mg kanamycin, and then split into sterile plates and placed in a refrigerator at 4℃for use.

M4 medium (1L): MS powder 4.4g, sucrose 10g,800ml ddH ₂ O is fully dissolved, the pH value is regulated to 5.84-5.88, the volume is fixed to 1L, the coagulant agent is 10g, and after sterilization, the culture medium is added after quick cooling: 300mg of timentin is packaged and put in a refrigerator at 4 ℃ for standby.

STS：[Ag(SO ₃ ) ² ] ^3- In the prior art, the mixture is prepared immediately, and precipitation exists for too long time; mother liquor: sodium thiosulfate, 0.1M (2.48 g in 100ml ddH) ₂ O)；AgNO ₃ 0.1M (1.7 g in 100ml ddH) ₂ O)V _Na2SO3 :V _AgNO3 =4: 1, agNO3 was dissolved in sodium thiosulfate.

2,4-D (1 mg/ml): 1ml of 10mg/ml of mother liquor is taken in a 12ml sterile tube, 9ml of sterilized double distilled water is added, and the mixture is uniformly mixed and stored at the temperature of minus 20 ℃.

KT (1 mg/ml): 0.02g KT was first dissolved in 1M HCL, water was added to a volume of 20mL, and the mixture was stored at-20 ℃.

AS (100 umol/ml): 0.392g AS is firstly dissolved in a small amount of methanol, then dimethyl sulfoxide is added, the volume is fixed to 20m, suction filtration and split charging are carried out, and the mixture is stored at the temperature of minus 20 ℃.

ZT (2 mg/ml): 0.02. 0.02gZT powder is weighed and dissolved in a small amount of 75% alcohol, water is added to a constant volume to 10ml, and the mixture is filtered and split charging is carried out, and the mixture is stored at the temperature of minus 20 ℃.

IAA (1 mg/ml) 0.1g IAA was dissolved in a small amount of 1mol/LNaOH and ddH was added ₂ O is fixed to 100ml, and the mixture is filtered and split charging is carried out, and the mixture is stored at the temperature of minus 20 ℃.

TMT (300 mg/ml) 3.2g of timentin powder was dissolved in 10.66ml of sterilized ddH ₂ And (3) in the step O, shaking, mixing uniformly, carrying out suction filtration, split charging, and storing at the temperature of-20 ℃.

HYG (50 mg/ml): 1g of hygromycin B is dissolved in 20ml of sterilized ddH ₂ And (3) in the step O, shaking, mixing uniformly, carrying out suction filtration, split charging, and storing at the temperature of-20 ℃.

Kana (100 mg/ml): 10g of kana powder is dissolved in 100ml of sterilized ddH2O, mixed evenly by shaking, filtered and split-packed and stored at-20 ℃.

Example 1: construction of CRISPR/Cas9 system-based directed mutation brassica napus BnaFANCM vector

According to sequence information of a reference genome ZS11 in a cabbage type rape reference genome website (http:// cbi.hzau.edu.cn/bnapus /), two FANCM homologous sequences, namely BnaFANCM-C05 and BnaFANCM-A05, are obtained, the nucleotide sequences of which are shown as SEQ ID NO.8 and SEQ ID NO.9, and the amino acid sequences of which are shown as SEQ ID NO.10 and SEQ ID NO. 11.

The specific sequence information of SEQ ID NO.8 and SEQ ID NO.9 is shown in the sequence list.

SEQ ID NO.10：

MGVDGVSYHRVSWGRYKDWAAVRDACKSNSSSSSTHTNDNGTKAKRSTDRDRSTDVVSDSCGTNDNTSVGDTAKTWYVNVRDYATKTASNTVATGGKTAAVVMYNYRWGKVAASRVMACHNVGWTDTGTCSKRASWKTKRVVTVKDSGTCVTNCVCVDAHRAGNYSYCVVVRMAVVRATATGSKTAGDNSTYRNSDHDVCYVHDRKVVGKDADVSKRDVRYAVRKNGVSRDYTSHMARDKRAVGHSHGDVSCAATYHRKSSHGRAYMKGARMSKNADRMTKMRSNGASKSKMVDHYKKDRTSRVSNRGSVRDMDASNGDVVKATGSSGKTKGSKVAVKRSGGNVVATSGGDMVDVCDANVSRMRMGRTGRKNNGRVACGSKNSYMRKKANGAKKHMRNGGMNSNHSRMHVYKVHVKSRGKKDAATAKKKTMDMAKYKNKWRVSAHTSKVHKVMHSRTSDAMHTTTSKSKYGAARDDAGRVGDDKDSDDDVNTSRKAKVVSTSTTTKASSTHCYNSCASVNTGKVVSSSNVGSDYVGRKSSNKSHDVVMDSSSKHRDSCKKGDCANTSSKWHSTDVGKGDNCSGMSSDDDCDSGSTSSRVAHSMTKHTKTKKTHRV

SEQ ID NO.11：

MGVDGDWAAVRDACKSNSSSSSTHTNGNGTKAKRSTDRARADHKYVVSDSCGTNDNTSVGDTAKTWYMNVRDYATKTASNTVATGGKTAAVVMYNYRWGKVAASRVMACHNVGWTDTGTCSKRASWKTKRVVTVKDSGTCVTNCVCVDAHRAGNYSYCVVVRMAVVRATATGSKTAGDNSTYRNSDHDVCYVHDRKVVGKDADVSKRDVRYAVRKNGVSRDYTSHMARDKRAVGHSHGDVSCAATYHRKSSHGRAYMKGARMSKNDRMTKMRSNGASKSKMVDHYKKDRTSRVSNRGSVRDMDASNDVVKATGSSGKTKGSKVAVKRSGGNVVATSGGDMVDVCDANVSRMRMGRTGRKNNGRVVVACGSKNSYMRKKANGAKKHMRNGGMNSNHSRMHVYKVHVKSRGKKDATTAKKKTMDMAKYKNKWRVSAHTSKVHKVMHSRTSDAMHTTTSKSKYGAARDDAGRVGDDKDSSDDDVNTSRKAKSTSTTTKDASSTHCYSSCASVDTGKVVVSSSNVGSDCVGRKSSNKSHTDVVDSSSKHRDNSCKKGDCANTSSKRHSTDVGKGDNCAGMSSDDDCDSRTNKSGVVDSVYDGVAYANRDDTSTNASTKKVHASTANRTKDANTSAVSMWRTANTNASSSASKDWRVSSGKSTRRKKRRRGDCSSAVKNNGAKTDHRSRSRSVKNRGKKKRADNNARAAVSSSMSVDNVDTSDSDSDDGTMTANTACAKVDMMAVYRRSSSARRDVAASSSYSSGKTNSRSDSDKSSSRTTTNNSNKDAVATGDVASTDSRKRKSCNSANVVNNKAHAATKSHGRSNAGASYKDDDDDAYATDDAMAHATSKRSTKTKDASVKHGNRNDGKDGSDGW

Submitting BnaFANCM-C05 gene sequence to CRISPR-P (http:// cbi. Hzau. Edu. Cn/cgi-bin/CRISPR) website, screening to determine that the off-Target rate is low and the Target sequence Target1 (the nucleotide sequence is shown as SEQ ID NO.1, TGG is a PAM sequence), target2 (the nucleotide sequence is shown as SEQ ID NO.2, AGG is a PAM sequence) and sgRNA (the nucleotide sequence is shown as SEQ ID NO.3, TGG is a PAM sequence) of the gene editing Target sequences of BnaFANCM-C05 and Bna FANCM-A05 can be edited simultaneously.

Target1 (nucleotide sequence shown as SEQ ID NO.1, TGG is PAM sequence):

GTTGCTTTACCAACAGGCCTTGG

target2 (nucleotide sequence shown as SEQ ID NO.2, AGG is PAM sequence):

GGTTTGCTTGGTGATCGACGAGG

sgRNA (nucleotide sequence shown as SEQ ID NO.3, TGG is PAM sequence):

GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTT

and designing CRISPR/Cas9 carrier target primers according to the screened targets, wherein the primer sequences are shown in table 1, and ensuring that 2 designed targets can be knocked out of BnaFANCM-C05 and BnaFANCM-A05 simultaneously.

TABLE 1 CRISPR/Cas9 vector target primers

Primer(s)	Sequence 5'-3'
		DT 1 -BsF(SEQ.ID.NO.4)	ATATATGGTCTCGATTGAGTCCACACGAATTACTTAGTT
DT 2 -BsR(SEQ.ID.NO.5)	ATTATTGGTCTCGAAACGCTGAACTTTTTGCGACTGCAA
		DT 1 -F0(SEQ.ID.NO.6)	TGAGTCCACACGAATTACTTAGTTTTAGAGCTAGAAATAGC
DT 2 -R0(SEQ.ID.NO.7)	AACGCTGAACTTTTTGCGACTGCAATCTCTTAGTCGACTCTAC

Followed by entry vector pCBC-DT ₁ T ₂ As templates (from the university of agricultural chemical, china, programming, guo Liang) PCR amplification was performed with the pair of primers 2 shown in Table 1 under the action of high fidelity enzyme 2*Phanta Max Master Mix (available from Nanjinouzan Biotechnology Co., ltd.) and the PCR reaction system was as shown in Table 2.

TABLE 2 high fidelity enzyme PCR amplification reaction system

PCR component	Volume of
		2*Phanta Max Master Mix	25μL
DT 1 -BsF(10μM)	1μL
		DT 2 -BsR(10μM)	1μL
DT 1 -F0(0.5μM)	1μL
		DT 2 -R0(0.5μM)	1μL
pCBC-DT 1 T 2 (100-200ng)	1μL
		ddH 2 O	20μL

The PCR reaction procedure was:

pre-denaturation at 95℃for 3min; denaturation at 95℃for 30s, annealing at 61℃for 30s, elongation at 72℃for 30s, and a total of 34 cycles; finally, the extension is carried out for 5min at 72 ℃.

After the completion of the PCR reaction, the PCR product was subjected to gel electrophoresis in a 1% agarose gel (mass volume fraction) at 120V 400mA for 27min, then photographed under an ultraviolet gel imager, and the result was recorded.

The results showed that there was a 626bp fragment, which was a fragment of the constructed vector target site and gRNA, cut into gel, and purified and recovered (purchased from Nanjinouzan Biotechnology Co., ltd.) using a FastPure Gel DNA Extraction Mini Kit kit. Then, an enzyme digestion connection system is established, and the specific connection system is shown in Table 3.

TABLE 3 cleavage-ligation System

After the reaction was completed, 5. Mu.L of ligation product was used to transform competent E.coli DH 5. Alpha. (purchased from Nanjinouzan Biotechnology Co., ltd.) and the transformed DH 5. Alpha. Was applied to a solid LB plate medium containing 50mg/mL Kan for screening, after overnight culture at 37℃positive clones were picked up in 400. Mu.L of liquid LB medium containing 50mg/mL Kan and shake-cultured in a shaker for 4-6 hours, and then 2. Mu.L of bacterial liquid was used as a template for PCR amplification for identification, the PCR amplification system was shown in Table 4, and the PCR reaction procedure was: pre-denaturation at 94℃for 3min; denaturation at 94℃for 30s, annealing at 57℃for 30s, elongation at 72℃for 40s, 28 cycles total; final extension at 72℃for 10min. The primers U626-IDF and U629R are universal primers, and the specific primer sequences are shown below

U626-IDF:TGTCCCAGGATTAGAATGATTAGGC(SEQ.ID.NO.12)

U629-IDR：AGCCCTCTTCTTTCGATCCATCAAC(SEQ.ID.NO.13)；

TABLE 4 bacterial liquid PCR reaction system

Reaction components	Volume of
		Bacterial liquid	2μL
U626-IDF	1μL
		U629R	1μL
rTaq enzyme	10μL
		ddH 2 O	6μL

The PCR reaction procedure was: pre-denaturation at 94℃for 3min; denaturation at 94℃for 30s, annealing at 57℃for 30s, elongation at 72℃for 40s, 28 cycles total; final extension at 72℃for 10min.

The fragment size obtained after PCR gel running identification is 726bp, the sequence containing the target sequence and the sgRNA is connected to a final vector pKSE401 (from the professor Guo Liang of China agricultural university and available in the market), the fragment length is increased because of the fact that the sgRNA is also arranged on the final vector pKSE401, 150 mu L of positive clone bacterial liquid with correct fragment size is sucked and sent to a biological engineering (Shanghai) stock company for sequencing, and the sequence of the sequencing primers is U626-IDF and U629-IDF, wherein the sequence of the primers is as follows:

U626-IDF：TGTCCCAGGATTAGAATGATTAGGC(SEQ.ID.NO.12)

U629-IDF：TTAATCCAAACTACTGCAGCCTGAC(SEQ.ID.NO.14)；

the correct clone was sequenced, the target was ligated to the sgRNA and present in the final vector, the plasmid was extracted, agrobacterium competent GV3101 (purchased from Shanghai Biotechnology Co., ltd.) was transformed, and a positive monoclonal was selected for Agrobacterium-mediated genetic transformation, and the vector pKSE401-BnafANCM-CRISPR schematic was shown in FIG. 1.

Example 2: transformation of pKSE401-BnaFANCM-CRISPR gene editing recombinant vector into cabbage type rape hypocotyl

(1) Seed disinfection and sowing

Selecting plump fast-growing rape Y127 (from university of agriculture Hong Dengfeng teacher in China) in a 12mL sterile tube, sterilizing with 75% alcohol in an ultra clean bench for 45s, and sterilizing with ddH ₂ O washing seeds for 2-3 times, sterilizing with 15% Bleach solution (prepared as 8.115mL sterile water+1.875 mL sodium hypochlorite+10 μL triton) for 7min30s, and sterilizing with ddH ₂ O cleaning the seeds until no obvious foam is present in the waterFinally, uniformly sowing the sterilized seeds to M ₀ On the medium, dark culture was performed.

(2) Preparation of bacterial liquid

On day 7 after sowing, the GV301 Agrobacterium containing the pKSE401-BnafANCM-CRISPR recombinant vector obtained in example 1 was subjected to expansion culture: mu.L of recombinant bacteria solution was added with 5mL of resistant LB (50 mg/L Kan+50mg/L Gen+50mg/L Rif) and cultured at 28℃for about 14-16h in a shaker at 220 rpm.

(3) Infection and co-cultivation

And (3) measuring the OD value of the bacteria in the resistant LB medium in the step (2) by using a spectrophotometer, wherein the bacterial liquid is better when the OD value is about 0.4, and the bacteria are generally shaken for 14-16 hours. Sucking 2mL of the cultured bacterial liquid into a 2mL sterile centrifuge tube, centrifuging at 5000rpm for 10min, and discarding the supernatant; then 2mL of DM (AS+) solution was added to suspend, centrifuged at 5000rpm for 10min, and the supernatant was discarded; then, 2mL of DM (AS+) was added to the suspension, and the suspension was kept in a refrigerator at 4℃for further use.

Taking out seedlings which are dark-cultured for 7 days, cutting hypocotyls by using forceps and scissors which are sterilized at high temperature, placing the hypocotyls in a disposable plate with 18ml DM (AS+) and cutting the hypocotyls downwards AS quickly AS possible, and ensuring that the incision is flat and the length is 0.8-1 cm. After cutting, adding a prepared bacterial liquid, dip-dyeing for 12min30 s, and shaking for 1 time and 4-5 times at intervals; the DM (AS+) and bacterial liquid are sucked by a gun head, the hypocotyl explant is paved on filter paper sterilized in advance, and the bacterial liquid with excessive surface is sucked. The explants were uniformly swung to M with forceps ₁ On the culture medium, the two ends of the explant are fully contacted with the culture medium when the explant is placed, and the explant is subjected to dark culture at 24 ℃ for 36-48h.

(4) Selective culture and callus induction

M after co-cultivation (co-cultivation of transformed recombinant Agrobacterium with hypocotyl) ₁ Transfer of the intermediate explant to M for selection and callus induction ₂ M on the culture medium ₂ The explants in the culture medium are cultured normally under inverted light, the culture conditions are that the culture is carried out alternately in a mode of 16 hours in the daytime and 8 hours in the evening at 24 ℃, and the callus is induced for 2-3 weeks.

(5) Redifferentiation

Transfer of selected explants to differentiation M ₃ Every 2 to 3 on the culture mediumZhou Jidai dead brown explants are eliminated during this period, preferably those with two enlarged ends and green spots until green buds appear.

(6) Rooting culture

Cutting part of wound on the bud seedling base with high temperature sterilized surgical knife, and transferring into M ₄ Rooting culture is carried out in a culture medium. After rooting, the seedlings can be placed in a culture room for hardening, after the seedling state is stable, the seedlings are taken out from a culture medium, the root systems of the plants are not damaged as much as possible in the seedling taking process, then the root systems are soaked with 1% carbendazim for one time, finally the seedlings are moved into soil for culture, and the transgenic rape waiting for identification can be obtained by using a preservative film to preserve moisture for about 1 week during the culture.

Example 3: transgenic plant editing situation detection

(1) Extraction of transgenic plant DNA

The DNA in the transgenic rape leaves is extracted by adopting a CTAB method, and the specific steps are as follows:

taking thumb cover big and small blades, putting the thumb cover big and small blades into a 1.5mL centrifuge tube, refrigerating in liquid nitrogen, grinding by a grinding gun, adding 600 mu L of CTAB after grinding into dry powder, fully shaking, and then putting a sample into a 65 ℃ water bath for incubation for 60min; after the incubation was completed, 600. Mu.L of chloroform/isoamyl alcohol (24:1 by volume) solution was added to the tube, vigorously shaken, and the protein was removed thoroughly, and then placed in a centrifuge for centrifugation at 12000g for 10min; sequentially placing the centrifuged centrifugal tubes on an operation board, and sucking 400 mu L of supernatant into a new 1.5mL centrifugal tube, wherein the residual tissues below the supernatant are not required to be sucked into the new centrifugal tube; then 400 mu L of isopropanol is added into the supernatant, the mixture is gently inverted and uniformly mixed, and then the sample is placed into a refrigerator with the temperature of minus 20 ℃ to be cooled for at least 10min so as to lead the DNA to be completely precipitated; putting the centrifuge tube into a centrifuge, and centrifuging 12000g for 10min at room temperature; the supernatant was discarded, and the precipitate (pop-up bottom precipitate) was washed with 700. Mu.L of 70% ice-ethanol, 12000g of the solution was spun; discarding the supernatant, sucking the residual liquid by a pipetting gun, and drying and precipitating in an ultra-clean bench for 10min; add 50. Mu.L ddH to centrifuge tube ₂ O is dissolved and precipitated, and the obtained product is put into a water bath kettle at 37 ℃ for 60min to obtain a genome DNA sample; finally 1 mu L of base is takenThe concentration of the group sample was measured, and after the detection was passed (OD ₂₆₀ /OD ₂₈₀ Between 1.6 and 1.8), and placing the genome sample in a refrigerator at-20 ℃ for standby.

(2) Identification of positive seedlings

Using the DNA extracted in the step (1) as a template, and using primers U626-IDF, U626-IDR and Cas9-F, cas-R to perform PCR amplification respectively, wherein the DNA of water and wild type Y127 is used as a negative control, the plasmid pKSE401-BnaFANCM-CRISPR is used as a positive control, the annealing temperature is 57 ℃ and 62 ℃, other PCR amplification reaction procedures and conditions are the same as those of the bacterial liquid PCR reaction of the table 4, and the primer sequences are as follows:

U626-IDF:TGTCCCAGGATTAGAATGATTAGGC(SEQ.ID.NO.12)

U629-IDR:AGCCCTCTTCTTTCGATCCATCAAC(SEQ.ID.NO.13)；

Cas9-F：TGCAGGAGATTTTCTCCAACGA(SEQ.ID.NO.15)

Cas9-R：AGCCTTCGTAATCTCGGTGTTCA(SEQ.ID.NO.16)

after the PCR was completed, the amplified product was electrophoresed in 1% agarose gel, photographed using an ultraviolet gel imager, and the result was recorded. FIG. 2 is a diagram of a PCR identification gel for extracting leaf genome from 3 positive strains obtained from 14 strains through transformation screening; in the figure, WT: wild type; fascm-1, fascm-2, fascm-3: a mutant transgenic plant; +: positive control, pKSE 401-bnafacm-CRISPR plasmid; -: negative control, ddH ₂ O; marker: takara DL2000 DNA Marker; as can be seen from the figures, fancm-1, fancm-2 and fancm-3 are transgenic positive plants.

(3) TA cloning detection positive seedling editing site

The genome of the positive strain successfully identified is subjected to PCR amplification, gel running, gel recovery and pMD19-T vector connection by using high-fidelity enzyme under the action of a primer C05OEF/C4C5R, escherichia coli is transformed, bacterial selection identification is carried out, and monoclonal bacterial liquid is sent to a biological engineering (Shanghai) stock company for sequencing, and specific experimental operation and method are as follows:

the 1000bp fragments near Target1 and Target2 of the BnaFANCM genome were amplified using high fidelity enzyme 2*Phanta Max Master Mix (available from Nanjinouzan Biotechnology Co., ltd.) using leaf DNAs of rape variety Y127 (from Huazhong university of agriculture), fancm-1, fancm-2, fancm-3 as templates, respectively, and PCR reactions were as shown in Table 5.

TABLE 5 high fidelity enzyme amplification BnaFANCM genome reaction System

PCR component	Volume of
		2*Phanta Max Master Mix	25μL
C05OEF(10μM)	2μL
		C4C5R(10μM)	2μL
DNA(100-200ng)	1μL
		ddH 2 O	20μL

The PCR reaction procedure was: pre-denaturation at 95℃for 3min; denaturation at 95℃for 30s, annealing at 57℃for 30s, elongation at 72℃for 1min for 30s, 34 cycles in total; finally, the extension is carried out for 5min at 72 ℃.

After the completion of the PCR reaction, the PCR product was subjected to gel electrophoresis in a 1% agarose gel (mass volume fraction) at 120V 400mA for 27min, then photographed under an ultraviolet gel imager, and the result was recorded. The result shows that the 1322bp fragment is available, the gel is cut, and FastPure Gel DNA Extraction Mini Kit reagent is utilizedThe PCR product was recovered by cassette purification (purchased from Nanjinozan Biotechnology Co., ltd.). Then, the recovered PCR amplified product is subjected to end addition A, and an A adding system is as follows: recovery of the product 7.5. Mu. L, dNTPs 1. Mu.L, PCR Buffer (Mg ⁺ free) 1. Mu. L, rTaq 0.5.5. Mu.L, reaction conditions 72℃for 30min. The addition A product was then ligated to the pMD19-T vector in the following manner: the ligation product (TA cloning reagents were obtained from Takara Bio Inc. were used) was obtained by ligation overnight at 16℃with 4.5. Mu. L, pMD-19T vector 0.5. Mu. L, solution I5. Mu.L.

mu.L of ligation product was added to 30. Mu.L of competent cells of E.coli (purchased from Nanjinouzan Biotechnology Co., ltd.) and transferred into E.coli by heat shock method, positive colonies were screened using LB medium containing Amp at a final concentration of 30mg/mL, 12 single colonies were picked up and shake-cultured for 12-16 hours, 2. Mu.L of bacterial liquid was taken as template for PCR amplification for identification, and the primers were C05OEF/C4C5R, and other PCR reaction conditions and procedures were as follows with reference to Table 4:

C05OEF：GGTACCATGGGACCCGAGTTTCCGAT(SEQ.ID.NO.17)

C4C5R：CTGAAAAATGGCATCCAACAAG(SEQ.ID.NO.18)

the positive monoclonal bacterial liquid is sent to a biological engineering (Shanghai) stock company for sequencing, the obtained sequencing result is analyzed, the sequencing result is summarized as shown in figure 3, more monoclonal bacteria can be found to show T base insertion at a target point 1, so that the further analysis is carried out, and the analysis result is shown in figure 4.

FIG. 4 is a simplified schematic diagram of a frame shift mutation resulting from the insertion of T at the fancm mutant target 1; in the figure, (a) is an alteration of the BanFANCM-C05 gene in the mutant compared to the wild type; (b) Is an alteration of the BanFANCM-A05 gene in the mutant compared to the wild type. As can be seen from the graphs (a) and (b), the frame shift mutation occurs in both the BanFANCM-C05 and BanFANCM-A05 genes of the fascm mutant, so that the translation process of the FANCM gene is terminated in advance, and the FANCM protein cannot be synthesized normally, which proves that the gene editing vector successfully functions at a target point, and the BanFANCM-C05 and BanFANCM-A05 genes are successfully knocked out in brassica napus.

Example 4: phenotype observation of Gene editing plants

The 3-strain gene-edited oilseed rape obtained in example 3 was subjected to self-pollination every day, and after one week, the fancm mutant was found to exhibit a sterile phenotype, as shown in FIG. 5 (a), and to further determine whether the fancm mutant was male sterile or female sterile, a positive and negative crossing experiment was performed on the mutant material. As shown in FIG. 5 (b), the delivery of the mutant material pollen to the Y127 column head of the recipient material was non-horn yielding, and the delivery of Y127 pollen to the mutant was horn yielding, demonstrating that the Bnafacm mutant was male sterile. The number of the positive and negative fruits is shown in Table 6.

TABLE 6 statistics of the number of orthogonal results of fascm mutants and Wild Type (WT)

	Seed WT (fruit number of fruit/emasculation number)	Male WT (fruit number/emasculation number)
			fancm-1	0/5	4/6
fancm-2	0/5	4/5
			fancm-3	0/5	4/5

It should be understood that the above-described embodiments are merely illustrative of or explanatory of the general principles of the invention, and the invention is not limited to the above-described embodiments, but may be variously changed and modified without departing from the spirit and scope of the invention, which is defined by the appended claims and their equivalents.

Sequence listing

<110> university of Jiangsu

<120> BnaFANCM gene, application and method for obtaining male sterile mutant of rape

<160> 18

<170> SIPOSequenceListing 1.0

<210> 1

<211> 23

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 1

gttgctttac caacaggcct tgg 23

<210> 2

<211> 23

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 2

ggtttgcttg gtgatcgacg agg 23

<210> 3

<211> 83

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 3

gttttagagc tagaaatagc aagttaaaat aaggctagtc cgttatcaac ttgaaaaagt 60

ggcaccgagt cggtgctttt ttt 83

<210> 4

<211> 39

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 4

atatatggtc tcgattgagt ccacacgaat tacttagtt 39

<210> 5

<211> 39

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 5

attattggtc tcgaaacgct gaactttttg cgactgcaa 39

<210> 6

<211> 41

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 6

tgagtccaca cgaattactt agttttagag ctagaaatag c 41

<210> 7

<211> 43

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 7

aacgctgaac tttttgcgac tgcaatctct tagtcgactc tac 43

<210> 8

<211> 2922

<212> DNA

<213> cabbage type rape (Brassica napus)

<400> 8

atgggacccg agtttccgat cgaactcgtt gaagaagaag atggagtgag ttaccaccga 60

gtctctttct ggctgggtca attcagattt ccttatttaa aattattttt gtttttgcag 120

ttcgattggg aagcagcagt cagagaaatc gacttggctt gcctcaaatc cttaaaccct 180

tcttcttctt cttcgaccca tttcaccaac gacaatggca ctaaacctgc taaaagacaa 240

tctactctcg atcgattcat cgatcgatct actccggatc ctcctgttgt ttccgacccg 300

agtttcgagt gtggtactaa cgacaacact cccagcgtcg ggattgatcc tgagacagct 360

aaaacttgga tttatccagt aaacgttcct ctaagagatt atcagtttgc tataaccaag 420

actgctttgt tttcaaacac attagttgct ttaccaacag gccttggtaa aacgctcata 480

gctgcagttg taatgtataa ttacttcaga tggtttccac aaggtaaaat tgtctttgcc 540

gcaccttcta ggcctcttgt gatgcagcag attgaggcct gccataatat cgtggggata 600

ccacaagaat ggacgattga cttgacgggt cagacttgcc cttccaaaag agcttccttg 660

tggaaaacca aaagggtttt cttcgtcact ccacaagttc ttgagaagga tatacagtca 720

ggaacgtgtg ttaccaactg cttggtttgc ttggtgatcg acgaggcaca tcgagcttta 780

gggaattatt cttattgtgt tgtagttcgt gagttgatgg cagtaccagt gcagttgaga 840

atattggctc ttactgcaac tcctggatca aagacacagg ccatacaggg tatccttgat 900

aatttgcaga tatcaacact tgaatatcga aacgagagtg accatgatgt ctgcccttat 960

gtccacgaca gaaaagtaga actaatcgag gttcccttgg gtaaagatgc agatgaggta 1020

tctaaacgcc tattagatgt tatacgtcca tatgcagtca ggcttaaaaa tttcggggtc 1080

attctaagca gggattatca aactttgagt ccacacgaat tacttatggc aagggataag 1140

tttcgtgaag cacctgtacc aggcattccc catataagtc acggagatgt agaatcttgc 1200

tttgcagctc ttatcacgct ttatcacatt cgcaagcttc tttctagtca tggaataagg 1260

ccagcgtatg agatgcttga agaaaaactc caggaagggc catttgctag gttgatgagt 1320

aagaatgcag atattaggat gacgaagctt ttgatgcagc aaaggttgtc gaacggagca 1380

ccaagcccga aattgtccaa gatgttggag attctagttg atcactacaa aataaaagat 1440

ccgaggacat cacgggtcat tattttctcg aatttcagag gaagcgtaag agacataatg 1500

gacgcattaa gtaatattgg agatgttgtc aaagcaactg agtttattgg tcaaagttca 1560

ggtaagacac tgaagggaca gtcgcaaaaa gttcagcagg ctgttctgga gaaatttaga 1620

tctggtgggt ttaatgttat tgttgcaaca tctatcggcg aagaaggctt ggatatcatg 1680

gaagtcgact tagttatatg ttttgatgct aatgtatccc ctctgaggat gatccaacgc 1740

atgggaagaa ctggaaggaa aaataatggc cgacctttac tagttcttgc ttgtgaagga 1800

tctgaaaaga atagctatat gcgaaagaaa gcaaatggcc aagccattaa aaaacacatg 1860

cggaatggag gaatgaatag ttttaatttt catcctagtc caaggatgat tccccatgtt 1920

tataagccag aagttcagca tgttaagttt tcgatcgagc aattcattcc acgtggaaag 1980

aagctacaag atgagcctgc cgctgagact ccagctttca agaaaaagct tacaccggaa 2040

gagatggata tgctcgccaa gtatttcaaa cccaacgagg aaaagtggag agtttccttg 2100

attgctttcc ctcacttcca aacattgcca tccaaagtgc acaaagtaat gcattcacgc 2160

caaacaagca tattaattga tgctatgcag catctgcaag agacaacttt gacagagcaa 2220

agtaaaagct tcttcattaa gtatggagct cctttggctg aaagagatga gcttgacgca 2280

ggtctgaggg ttggtgatga tccgaaagat ttaccctctt tcgatgattt ggatgtcaac 2340

acatcacaga gaaaggcaaa acaagttgta gaatctccca caagcacatt agagactaca 2400

gagaaggaat tcgaagcatc ttcaccaaca cactgttatc ttttcaattc ggaatgtgcg 2460

tccgttaata ctctggggaa ggtctttata ttgccggttc ctctttcatt atcttctaat 2520

gtaccagggt cagactatgt gggaagagaa aaagaacttt cttccccgaa taaatcccac 2580

attgacgttg ttccgatgga tagttcctca aaacatcggc aagatagtat tccatgcaag 2640

ttaaagcaag gattcttgcc agattgtgcc aacgagactt tggagtccca aagccttttg 2700

aaatggcact ccaccgatgt aggtaaagga gatatagaga attgttctgg agaaattatg 2760

atatcatcgg atgaagaaga cgactgtgag gatttggagc ttagtcaagg ctcactaact 2820

tcatcaagag tggcgttgtt ccagattcac ctgtctatga ccaaggagtt gcatacgaag 2880

caaacagaga agaagacctt gatcttccac ccacgagttt aa 2922

<210> 9

<211> 3993

<212> DNA

<213> cabbage type rape (Brassica napus)

<400> 9

atgggacccg agtttccgat cgaactcgtt gaagaagaag atggattcga ttgggaagca 60

gcagtcagag aaatcgactt ggcttgcctc aaatccttaa acccttcttc ttcttcttcg 120

acccatttca ccaacggcaa tggcactaaa cctgctaaaa gacaatctac tcttgatcga 180

ttcatcgcaa gagccgacca caagcctcct cctccgtatc ctcctgttgt ttccgacccg 240

agtttcgagt gtggtactaa cgacaacact cccagcgtcg ggattgatcc tgagacagct 300

aaaacttgga tttatccaat gaacgttcct ctaagagatt atcagtttgc tataacgaag 360

actgctttgt tttcaaacac attagttgct ttaccaacag gccttggtaa aacgctcata 420

gctgcagttg taatgtataa ttacttcaga tggtttccac aaggtaaaat tgtctttgcc 480

gcaccttcta ggcctcttgt gatgcagcag attgaggcct gccataatat cgtggggata 540

ccacaagaat ggacgattga cttgacgggt cagacttgcc cttccaaaag agcttccttg 600

tggaaaacca aaagggtttt cttcgtcact ccacaagttc ttgagaagga tatacagtca 660

ggaacgtgtg ttaccaactg cttggtttgc ttggtgatcg acgaggcaca tcgagcttta 720

gggaattatt cttattgtgt tgtagttcgt gagttgatgg cagtaccagt gcagttgaga 780

atattggctc ttactgcaac tcctggatca aagacacagg ccatacaggg tatccttgat 840

aatttgcaga tatcaacact tgaatatcga aacgagagtg accatgatgt ctgcccttat 900

gtccacgaca gaaaagtaga actaatcgag gttcccttgg gtaaagatgc agatgaggta 960

tctaaacgcc tattagatgt tatacgtcca tatgctgtca ggcttaaaaa tttcggggtc 1020

attctaagca gggattatca aactttgagt ccacacgaat tacttatggc aagggataag 1080

tttcgtgaag cacctgtacc aggcattccc catataagtc acggagatgt agaatcttgc 1140

tttgcagctc ttatcacgct ttatcacatt cgcaagcttc tttctagtca tggaataagg 1200

ccagcgtatg agatgcttga agaaaaactt caggaagggc catttgctag gttgatgagt 1260

aagaatgaag atattaggat gacgaagctt ttgatgcagc aaaggttgtc gaacggagca 1320

ccaagcccga aattgtccaa gatgttggag attctagttg atcactacaa aataaaagat 1380

ccgaggacat cacgggtcat tattttctcg aatttcagag gaagcgtaag agacataatg 1440

gacgcattaa gtaatattga agatgttgtc aaagcaactg agtttattgg tcaaagttca 1500

ggtaagacac tgaagggaca gtcgcaaaaa gttcagcagg ctgttctgga gaaatttaga 1560

tctggtgggt ttaatgttat tgttgcaaca tctatcggcg aagaaggctt ggatatcatg 1620

gaagtcgact tagttatatg ttttgatgct aatgtatccc ctctgaggat gatccaacgc 1680

atgggaagaa ctggaaggaa aaataatggc cgagttgtag ttcttgcttg tgaaggatct 1740

gaaaagaata gctatatgcg aaagaaagca aatggccaag ccattaaaaa acacatgcgg 1800

aatggaggaa tgaatagttt taattttcat cctagtccaa ggatgattcc ccatgtttat 1860

aagccagaag ttcagcatgt taagttttcg atcgagcaat tcattccacg tggaaagaag 1920

ctacaagatg agcctgccac tgagactcca gctttcaaga aaaagcttac accggaagag 1980

atggatatgc tcgccaagta tttcaaaccc aacgaggaaa agtggagagt ttccttgatt 2040

gctttccctc acttccaaac attgccatcc aaagtgcaca aagtaatgca ttcacgccaa 2100

acaagcatat taattgatgc tatgcagcat ctgcaagaga caactttgac agagcaaagt 2160

aaaagtttct tcattaagta tggagctcct ttggctgaaa gagatgagct tgacgcaggt 2220

ctgagggttg gtgatgatcc gaaagattta ccctcttccg atgatttgga tgtcaacaca 2280

tcacagagaa aggcaaaaca aattttagaa tctcccacaa gcacattaga gactacagag 2340

aaggatttcg aagcatcttc acccacacac tgttatcttt tcagttcaga atgtgcgtcc 2400

gttgatactc tggggaaggt ctttgtattg ccggttcctc tctcattctc ttctaatgta 2460

ccagggtcag actgcgtggg aagagaaaaa gaactttctt ccccgaataa gtcccacact 2520

gacgttgttc cgatagatag ttcctcaaaa catcggcaag ataatatttc atgcaagtta 2580

aagcaaggat tcttgccaga ttgtgccaac gagactttgg agtcccaaag ccttttgaaa 2640

aggcactcca ccgatgtagg taaaggagat atagagaatt gtgctggaga aattatgata 2700

tcatcggatg aagaagacga ctgtgaggat ttggagctta gtccaaggct cactaacttc 2760

atcaagagtg gcgttgttcc agattcacct gtctatgacc aaggagttgc atacgaagca 2820

aacagagaag aagaccttga tcttccaccc acgagtttaa ctaatgaatt ggcagaagag 2880

ccatcgacac ctgagaaaaa ggttcacatt gcttctacgg ccaatgaatt cagaactcct 2940

cagaaggaag aagatttagc caacgaaaca gaaagcttcg ctgtttctcc aatgcctgag 3000

gagtggagaa ctcccttggc gaatatcacc aacgcaagca gcagcgctag caaagattgg 3060

cgcgtgagtt cgggagaaaa gtcagaaact cttcgacagc ctcgcaagtt gaagagactt 3120

cgtagacttg gagattgctc gagtgctgtg aaggagaata atcctggtat tgcaaagaca 3180

gaccatatca gatctcgttc tcgcagtgta aagaacataa gaggcaagaa gaagatacgc 3240

gcggataata atgctagaat cttcattgaa gcggaagctg aggtgtcttc ggaatcagaa 3300

atgtcggttg atgagaacgt agatttgacc agcgattcat ttgaagatag cttcatagat 3360

gacggtacaa tgcctacagc aaatactcaa gccgagtgtg ctaaagttga catgatggcc 3420

gtttacagac gttctctact cagccaatca ccattaccgg caagatttcg tgatgtagct 3480

gcatcaagtc cgagtcctta ttcttctggt ctcttgaaga caataaatga gagcagaagc 3540

gactcagata aatcattgtc ttctcttaga accccacaaa caacgaacaa cgagtcaaac 3600

aaggatgcag tggccacagg agactttttg gtagcacaaa tctcaacaga cagccggaaa 3660

aggaaattca gcttatgcaa ctcagcgaat gtcccagtga ttaacttgga aaacaagttt 3720

gaagctcatg cacaagccac ggagaaggaa agccatgaag gtccgagaag caatgcaggt 3780

gcatcacagt acaaggatga ggatgaagat gatgatgcat tctacgcgac actggacttt 3840

gatgccatgg aagcgcatgc gacattgcta ttgtcgaaac aaaggtcaga aacgaaaaca 3900

aaagaagatg catcggtgaa acctcatttg ggcaatcaga ggaatgatgg tttgccgaag 3960

gatgggccat cttttgatct tggtttgtgg tga 3993

<210> 10

<211> 615

<212> PRT

<213> cabbage type rape (Brassica napus)

<400> 10

Met Gly Val Asp Gly Val Ser Tyr His Arg Val Ser Trp Gly Arg Tyr

1 5 10 15

Lys Asp Trp Ala Ala Val Arg Asp Ala Cys Lys Ser Asn Ser Ser Ser

20 25 30

Ser Ser Thr His Thr Asn Asp Asn Gly Thr Lys Ala Lys Arg Ser Thr

35 40 45

Asp Arg Asp Arg Ser Thr Asp Val Val Ser Asp Ser Cys Gly Thr Asn

50 55 60

Asp Asn Thr Ser Val Gly Asp Thr Ala Lys Thr Trp Tyr Val Asn Val

65 70 75 80

Arg Asp Tyr Ala Thr Lys Thr Ala Ser Asn Thr Val Ala Thr Gly Gly

85 90 95

Lys Thr Ala Ala Val Val Met Tyr Asn Tyr Arg Trp Gly Lys Val Ala

100 105 110

Ala Ser Arg Val Met Ala Cys His Asn Val Gly Trp Thr Asp Thr Gly

115 120 125

Thr Cys Ser Lys Arg Ala Ser Trp Lys Thr Lys Arg Val Val Thr Val

130 135 140

Lys Asp Ser Gly Thr Cys Val Thr Asn Cys Val Cys Val Asp Ala His

145 150 155 160

Arg Ala Gly Asn Tyr Ser Tyr Cys Val Val Val Arg Met Ala Val Val

165 170 175

Arg Ala Thr Ala Thr Gly Ser Lys Thr Ala Gly Asp Asn Ser Thr Tyr

180 185 190

Arg Asn Ser Asp His Asp Val Cys Tyr Val His Asp Arg Lys Val Val

195 200 205

Gly Lys Asp Ala Asp Val Ser Lys Arg Asp Val Arg Tyr Ala Val Arg

210 215 220

Lys Asn Gly Val Ser Arg Asp Tyr Thr Ser His Met Ala Arg Asp Lys

225 230 235 240

Arg Ala Val Gly His Ser His Gly Asp Val Ser Cys Ala Ala Thr Tyr

245 250 255

His Arg Lys Ser Ser His Gly Arg Ala Tyr Met Lys Gly Ala Arg Met

260 265 270

Ser Lys Asn Ala Asp Arg Met Thr Lys Met Arg Ser Asn Gly Ala Ser

275 280 285

Lys Ser Lys Met Val Asp His Tyr Lys Lys Asp Arg Thr Ser Arg Val

290 295 300

Ser Asn Arg Gly Ser Val Arg Asp Met Asp Ala Ser Asn Gly Asp Val

305 310 315 320

Val Lys Ala Thr Gly Ser Ser Gly Lys Thr Lys Gly Ser Lys Val Ala

325 330 335

Val Lys Arg Ser Gly Gly Asn Val Val Ala Thr Ser Gly Gly Asp Met

340 345 350

Val Asp Val Cys Asp Ala Asn Val Ser Arg Met Arg Met Gly Arg Thr

355 360 365

Gly Arg Lys Asn Asn Gly Arg Val Ala Cys Gly Ser Lys Asn Ser Tyr

370 375 380

Met Arg Lys Lys Ala Asn Gly Ala Lys Lys His Met Arg Asn Gly Gly

385 390 395 400

Met Asn Ser Asn His Ser Arg Met His Val Tyr Lys Val His Val Lys

405 410 415

Ser Arg Gly Lys Lys Asp Ala Ala Thr Ala Lys Lys Lys Thr Met Asp

420 425 430

Met Ala Lys Tyr Lys Asn Lys Trp Arg Val Ser Ala His Thr Ser Lys

435 440 445

Val His Lys Val Met His Ser Arg Thr Ser Asp Ala Met His Thr Thr

450 455 460

Thr Ser Lys Ser Lys Tyr Gly Ala Ala Arg Asp Asp Ala Gly Arg Val

465 470 475 480

Gly Asp Asp Lys Asp Ser Asp Asp Asp Val Asn Thr Ser Arg Lys Ala

485 490 495

Lys Val Val Ser Thr Ser Thr Thr Thr Lys Ala Ser Ser Thr His Cys

500 505 510

Tyr Asn Ser Cys Ala Ser Val Asn Thr Gly Lys Val Val Ser Ser Ser

515 520 525

Asn Val Gly Ser Asp Tyr Val Gly Arg Lys Ser Ser Asn Lys Ser His

530 535 540

Asp Val Val Met Asp Ser Ser Ser Lys His Arg Asp Ser Cys Lys Lys

545 550 555 560

Gly Asp Cys Ala Asn Thr Ser Ser Lys Trp His Ser Thr Asp Val Gly

565 570 575

Lys Gly Asp Asn Cys Ser Gly Met Ser Ser Asp Asp Asp Cys Asp Ser

580 585 590

Gly Ser Thr Ser Ser Arg Val Ala His Ser Met Thr Lys His Thr Lys

595 600 605

Thr Lys Lys Thr His Arg Val

610 615

<210> 11

<211> 872

<212> PRT

<213> cabbage type rape (Brassica napus)

<400> 11

Met Gly Val Asp Gly Asp Trp Ala Ala Val Arg Asp Ala Cys Lys Ser

1 5 10 15

Asn Ser Ser Ser Ser Ser Thr His Thr Asn Gly Asn Gly Thr Lys Ala

20 25 30

Lys Arg Ser Thr Asp Arg Ala Arg Ala Asp His Lys Tyr Val Val Ser

35 40 45

Asp Ser Cys Gly Thr Asn Asp Asn Thr Ser Val Gly Asp Thr Ala Lys

50 55 60

Thr Trp Tyr Met Asn Val Arg Asp Tyr Ala Thr Lys Thr Ala Ser Asn

65 70 75 80

Thr Val Ala Thr Gly Gly Lys Thr Ala Ala Val Val Met Tyr Asn Tyr

85 90 95

Arg Trp Gly Lys Val Ala Ala Ser Arg Val Met Ala Cys His Asn Val

100 105 110

Gly Trp Thr Asp Thr Gly Thr Cys Ser Lys Arg Ala Ser Trp Lys Thr

115 120 125

Lys Arg Val Val Thr Val Lys Asp Ser Gly Thr Cys Val Thr Asn Cys

130 135 140

Val Cys Val Asp Ala His Arg Ala Gly Asn Tyr Ser Tyr Cys Val Val

145 150 155 160

Val Arg Met Ala Val Val Arg Ala Thr Ala Thr Gly Ser Lys Thr Ala

165 170 175

Gly Asp Asn Ser Thr Tyr Arg Asn Ser Asp His Asp Val Cys Tyr Val

180 185 190

His Asp Arg Lys Val Val Gly Lys Asp Ala Asp Val Ser Lys Arg Asp

195 200 205

Val Arg Tyr Ala Val Arg Lys Asn Gly Val Ser Arg Asp Tyr Thr Ser

210 215 220

His Met Ala Arg Asp Lys Arg Ala Val Gly His Ser His Gly Asp Val

225 230 235 240

Ser Cys Ala Ala Thr Tyr His Arg Lys Ser Ser His Gly Arg Ala Tyr

245 250 255

Met Lys Gly Ala Arg Met Ser Lys Asn Asp Arg Met Thr Lys Met Arg

260 265 270

Ser Asn Gly Ala Ser Lys Ser Lys Met Val Asp His Tyr Lys Lys Asp

275 280 285

Arg Thr Ser Arg Val Ser Asn Arg Gly Ser Val Arg Asp Met Asp Ala

290 295 300

Ser Asn Asp Val Val Lys Ala Thr Gly Ser Ser Gly Lys Thr Lys Gly

305 310 315 320

Ser Lys Val Ala Val Lys Arg Ser Gly Gly Asn Val Val Ala Thr Ser

325 330 335

Gly Gly Asp Met Val Asp Val Cys Asp Ala Asn Val Ser Arg Met Arg

340 345 350

Met Gly Arg Thr Gly Arg Lys Asn Asn Gly Arg Val Val Val Ala Cys

355 360 365

Gly Ser Lys Asn Ser Tyr Met Arg Lys Lys Ala Asn Gly Ala Lys Lys

370 375 380

His Met Arg Asn Gly Gly Met Asn Ser Asn His Ser Arg Met His Val

385 390 395 400

Tyr Lys Val His Val Lys Ser Arg Gly Lys Lys Asp Ala Thr Thr Ala

405 410 415

Lys Lys Lys Thr Met Asp Met Ala Lys Tyr Lys Asn Lys Trp Arg Val

420 425 430

Ser Ala His Thr Ser Lys Val His Lys Val Met His Ser Arg Thr Ser

435 440 445

Asp Ala Met His Thr Thr Thr Ser Lys Ser Lys Tyr Gly Ala Ala Arg

450 455 460

Asp Asp Ala Gly Arg Val Gly Asp Asp Lys Asp Ser Ser Asp Asp Asp

465 470 475 480

Val Asn Thr Ser Arg Lys Ala Lys Ser Thr Ser Thr Thr Thr Lys Asp

485 490 495

Ala Ser Ser Thr His Cys Tyr Ser Ser Cys Ala Ser Val Asp Thr Gly

500 505 510

Lys Val Val Val Ser Ser Ser Asn Val Gly Ser Asp Cys Val Gly Arg

515 520 525

Lys Ser Ser Asn Lys Ser His Thr Asp Val Val Asp Ser Ser Ser Lys

530 535 540

His Arg Asp Asn Ser Cys Lys Lys Gly Asp Cys Ala Asn Thr Ser Ser

545 550 555 560

Lys Arg His Ser Thr Asp Val Gly Lys Gly Asp Asn Cys Ala Gly Met

565 570 575

Ser Ser Asp Asp Asp Cys Asp Ser Arg Thr Asn Lys Ser Gly Val Val

580 585 590

Asp Ser Val Tyr Asp Gly Val Ala Tyr Ala Asn Arg Asp Asp Thr Ser

595 600 605

Thr Asn Ala Ser Thr Lys Lys Val His Ala Ser Thr Ala Asn Arg Thr

610 615 620

Lys Asp Ala Asn Thr Ser Ala Val Ser Met Trp Arg Thr Ala Asn Thr

625 630 635 640

Asn Ala Ser Ser Ser Ala Ser Lys Asp Trp Arg Val Ser Ser Gly Lys

645 650 655

Ser Thr Arg Arg Lys Lys Arg Arg Arg Gly Asp Cys Ser Ser Ala Val

660 665 670

Lys Asn Asn Gly Ala Lys Thr Asp His Arg Ser Arg Ser Arg Ser Val

675 680 685

Lys Asn Arg Gly Lys Lys Lys Arg Ala Asp Asn Asn Ala Arg Ala Ala

690 695 700

Val Ser Ser Ser Met Ser Val Asp Asn Val Asp Thr Ser Asp Ser Asp

705 710 715 720

Ser Asp Asp Gly Thr Met Thr Ala Asn Thr Ala Cys Ala Lys Val Asp

725 730 735

Met Met Ala Val Tyr Arg Arg Ser Ser Ser Ala Arg Arg Asp Val Ala

740 745 750

Ala Ser Ser Ser Tyr Ser Ser Gly Lys Thr Asn Ser Arg Ser Asp Ser

755 760 765

Asp Lys Ser Ser Ser Arg Thr Thr Thr Asn Asn Ser Asn Lys Asp Ala

770 775 780

Val Ala Thr Gly Asp Val Ala Ser Thr Asp Ser Arg Lys Arg Lys Ser

785 790 795 800

Cys Asn Ser Ala Asn Val Val Asn Asn Lys Ala His Ala Ala Thr Lys

805 810 815

Ser His Gly Arg Ser Asn Ala Gly Ala Ser Tyr Lys Asp Asp Asp Asp

820 825 830

Asp Ala Tyr Ala Thr Asp Asp Ala Met Ala His Ala Thr Ser Lys Arg

835 840 845

Ser Thr Lys Thr Lys Asp Ala Ser Val Lys His Gly Asn Arg Asn Asp

850 855 860

Gly Lys Asp Gly Ser Asp Gly Trp

865 870

<210> 12

<211> 25

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 12

tgtcccagga ttagaatgat taggc 25

<210> 13

<211> 25

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 13

agccctcttc tttcgatcca tcaac 25

<210> 14

<211> 25

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 14

ttaatccaaa ctactgcagc ctgac 25

<210> 15

<211> 22

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 15

tgcaggagat tttctccaac ga 22

<210> 16

<211> 23

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 16

agccttcgta atctcggtgt tca 23

<210> 17

<211> 26

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 17

ggtaccatgg gacccgagtt tccgat 26

<210> 18

<211> 22

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 18

ctgaaaaatg gcatccaaca ag 22

Claims (9)

1. The application of the gene BnaFANCM in male sterile breeding of rape is editing the BnaFANCM gene; the edit type is that insertion of a T base results in a frameshift mutation in the gene.

2. A gene editing vector pKSE 401-binafancm-CRISPR, the gene editing vector comprising a binafancm gene sequence and a binafancm gene edited CRISPR/Cas9 system sequence element set comprising U6-26p-Target1-gRNA, U6-26p-Target2-gRNA and a Cas9 gene optimized according to codons and a resistance gene Kana;

the nucleotide sequence of Target1 is shown as SEQ.ID.NO. 1; the nucleotide sequence of Target2 is shown as SEQ ID No. 2; the nucleotide sequence of sgRNA is shown as SEQ.ID.NO. 3.

3. A genetically engineered bacterium for site-directed mutagenesis of the bnafacm gene, the genetically engineered bacterium comprising the gene editing vector pKSE 401-bnafacm-CRISPR of claim 2, the host bacterium of the genetically engineered bacterium being agrobacterium GV3101.

4. A method for obtaining male sterile mutants of brassica napus, which is characterized in that the method utilizes a CRISPR/Cas9 system to edit the BnaFANCM gene of brassica napus; the edit type is that insertion of a T base results in a frameshift mutation in the gene.

5. The method according to claim 4, characterized in that the method comprises:

(1) Designing and screening sgRNA targets Target1 and Target2 aiming at BnaFANCM gene sequences, wherein the nucleotide sequence of Target1 is shown as SEQ ID No.1, the nucleotide sequence of Target2 is shown as SEQ ID No.2, and synthesizing primers required for constructing a vector;

(2) Constructing a double-target CRISPR/Cas9 gene editing vector pKSE401-BnaFANCM-CRISPR;

(3) Extracting plasmid, transforming host bacteria to obtain genetically engineered bacteria containing gene editing expression vector pKSE401-BnaFANCM-CRISPR;

(4) The pKSE401-BnaFANCM-CRISPR vector is transferred into a receptor material by using an agrobacterium-mediated transformation mode to obtain a transgenic plant.

6. The method of claim 5, wherein the primer sequence in step (1) is as follows:

DT1-BsF(SEQ.ID.NO.4)：

ATATATGGTCTCGATTGAGTCCACACGAATTACTTAGTT

DT2-BsR(SEQ.ID.NO.5)：

ATTATTGGTCTCGAAACGCTGAACTTTTTGCGACTGCAA

DT1-F0(SEQ.ID.NO.6)：

TGAGTCCACACGAATTACTTAGTTTTAGAGCTAGAAATAGC

DT2-R0(SEQ.ID.NO.7)：

AACGCTGAACTTTTTGCGACTGCAATCTCTTAGTCGACTCTAC。

7. the method according to claim 5, wherein the BnaFANCM gene comprises BnaFANCM-C05 and BnaFANCM-A05, the nucleotide sequence of the sgRNA is shown in SEQ ID No.3, and the Target1 and the Target2 are common targets of the BnaFANCM-C05 and the BnaFANCM-A05.

8. The method of claim 5, wherein the host bacterium in step (3) is agrobacterium GV3101.

9. The method of claim 5, wherein the acceptor material in step (4) is Y127.