CN114990130B

CN114990130B - Application of OsABA ox2 gene in regulating and controlling weak granule grouting and improving seed aging resistance and seedling cold resistance

Info

Publication number: CN114990130B
Application number: CN202110740333.8A
Authority: CN
Inventors: 叶能辉; 滕振宁; 段美娟; 郑芹; 张建华
Original assignee: Hunan Agricultural University
Current assignee: Hunan Agricultural University
Priority date: 2021-07-01
Filing date: 2021-07-01
Publication date: 2024-06-14
Anticipated expiration: 2041-07-01
Also published as: CN114990130A

Abstract

The invention relates to the field of gene editing, in particular to an application of OsABA ox2 gene in regulating and controlling weak granule grouting and improving seed aging resistance and seedling cold resistance. The application of OsABA ox2 gene in gene editing rice target gene, and the nucleotide sequence of OsABA ox2 gene is shown in SEQ ID No. 2. According to the invention, by knocking out OsABA ox2 genes, osABA ox2 genes cannot be expressed normally, so that the effects of regulating and controlling rice weak granule grouting and improving seed aging resistance and seedling cold resistance can be achieved.

Description

Application of OsABA ox2 gene in regulating and controlling weak granule grouting and improving seed aging resistance and seedling cold resistance

Technical Field

The invention relates to the field of gene editing, in particular to an application of OsABA ox2 gene in regulating and controlling weak granule grouting and improving seed aging resistance and seedling cold resistance.

Background

China is the biggest rice producer and consumer worldwide, and the hybrid rice cultivated by utilizing plant heterosis in the 70 th century increases the total yield of rice in China by nearly 4.5 times from 60 th to 90 th, and achieves the aim of cultivating more than 20% of population by virtue of cultivated land area accounting for 7% of the total world and water resource accounting for 5% of the total world. However, the growth of the global population has always presented new challenges to grain yield. The difference of strong and weak grain grouting is common in cereal crops, wherein the difference is more obvious in large-spike rice varieties and high-nitrogen planting environments. For example, the setting rate and thousand grain weight of the super rice are respectively 20.7% and 7.2g higher than those of the weak rice, and the setting rate of the conventional rice is respectively 6.3% and 3.0g, so that the grouting rate of the super rice is obviously lower than that of the conventional rice in grouting efficiency, and on the whole, the fact that the difference of strong and weak grain grouting has a non-negligible influence on the rice yield has become one of main reasons for restricting the rice to exert high yield potential.

The vigor of the seeds directly influences the growth condition of seedlings, the vigor of the rice seeds can be gradually reduced in the storage process, and huge economic loss is caused by seed aging in China every year. In addition, more serious, the activity of the aged seeds is reduced, and the germination rate is reduced; moreover, rice originates in tropical and subtropical areas and is particularly sensitive to cold stress. The low temperature in high latitude and high altitude areas severely restricts the production of rice, and in addition, the extremely low temperature weather greatly affects the production of early rice, especially the production of direct seeding early rice is quite limited in the early rice season in the middle and lower reaches of Yangtze river. Therefore, improving the aging resistance of seeds has important significance for seed storage and cold resistance of seedlings in agricultural production.

Disclosure of Invention

In order to solve the problems, the invention provides an application of OsABA ox2 gene in regulating and controlling weak granule grouting and improving seed aging resistance and seedling cold resistance. According to the invention, by knocking out OsABA ox2 genes, osABA ox2 protein cannot be expressed normally, so that the effects of regulating and controlling rice weak granule grouting and improving seed aging resistance and seedling cold resistance can be achieved.

In order to achieve the above object, the present invention provides the following technical solutions:

the invention provides an application of OsABA ox2 gene in serving as a target gene of gene editing rice, wherein the nucleotide sequence of OsABA ox2 gene is shown as SEQ ID No. 2.

Preferably, the nucleotide sequence further includes a nucleotide sequence having 80% or more identity with the OsABA ox2 gene described above.

Preferably, the amino acid sequence of the protein encoded by the OsABA ox2 gene is shown as SEQ ID No. 1.

The invention provides a targeting knockout or silencing OsABA ox2 gene sgRNA sequence, and the nucleotide sequence of the sgRNA sequence is shown as SEQ ID NO. 3.

The invention provides a CRISPR/Cas9 vector for targeted knockout or silencing OsABA ox2 genes, wherein the CRISPR/Cas9 vector contains the sgRNA sequence.

The invention provides the use of OsABA ox2 gene expression inhibition in the following, characterized in that the use comprises: a: regulating and controlling the grouting of weak rice grains, wherein b is the aging resistance of seeds, and c is the cold resistance of seedlings.

Preferably, the method of inhibition comprises RNAi interference, gene site-directed editing, homologous recombination, or CRISPR/Cas9 gene knockout.

Preferably, the method of application is to introduce the above CRISPR/Cas9 vector into rice.

The beneficial effects are that: the invention provides an application of OsABA ox2 gene in serving as a target gene of gene editing rice, wherein the nucleotide sequence of OsABA ox2 gene is shown as SEQ ID No. 2. According to the invention, by knocking out OsABA ox2 genes, osABA ox2 genes cannot be expressed normally, ABA degradation in plants is blocked, so that the ABA content of rice weakness grains is increased, the grouting rate of the weakness grains is increased, the weight of the weakness grains is increased, and the yield is increased; ABA degradation in plants can be blocked, so that the ABA content of rice kernels is increased, the aging resistance of seeds is improved, and the rice kernels are more resistant to storage; the ABA content of the rice seedlings can be improved, the seedlings are more cold-resistant when subjected to low-temperature stress in the seedling stage, and the survival rate is improved. The OsABA ox2 gene is a newly discovered key gene for causing the difference of rice strong and weak grain grouting, is also a main gene for degrading the seed ABA, can improve the grain weight of the weak grains through genetic improvement, and can obtain a new variety with consistent strong and weak grain grouting, and simultaneously, the seeds are resistant to storage and seedlings are resistant to cold, so that the application prospect is wide.

Drawings

FIG. 1 shows the difference in expression of OsABA ox2 gene in rice grains with strong and weak vigour, wherein the difference between 0.05 and 0.01 levels is significant;

FIG. 2 is a OsABA ox2 knockout (KO-3, KO-11) strain identification;

FIG. 3 is a graph showing the ABA content of 9d weakness after the OsABA ox2 knockout mutant KO-3 flowers, wherein the x indicates that KO-3 and ZH11 differ significantly at 0.01 level;

FIG. 4 shows the length and width of the strong and weak lines of the OsABA ox2 knockout (KO-3, KO-11) line, in which (a) and (b) wild type and OsABA ox2 different transgenic lines were strong and weak, and (c) wild type and OsABA ox2 different transgenic lines were rice ears, and the red arrow indicated the degenerated weak on the OsABA ox2 gene over-expressed line OE-26 ears.

FIG. 5 shows the weakness grain weight and individual yield of OsABA ox2 knockout and overexpression (KO-3, KO-11, OE-26) lines, where (a) is the weakness grain weight and (b) is the individual yield;

FIG. 6 shows other agronomic traits of OsABA ox2 transgenic material, wherein (a) is wild type and the strong grain weight of the OsABA ox2 different transgenic lines, (b) is seed setting rate, (c) is plant height, (d) is effective tillering, (e) is grain number per ear, which indicates significant difference in 0.05 level compared to ZH11, which indicates significant difference in 0.01 level compared to ZH 11;

FIG. 7 shows the grouting dynamics and grouting rate of OsABA ox2 gene knockout (KO-3, KO-11) strain, wherein (a) is grouting dynamics and (b) is grouting rate;

FIG. 8 shows the aging survival of OsABA ox2 knockout (KO-3, KO-11) line and ZH11 seeds;

FIG. 9 is a comparison of pre-treatment and post-treatment patterns of OsABA ox2 gene knockout and over-expression (KO-3, KO-11, OE-26) lines and ZH11, where (a) is the pre-treatment phenotype of the OsABA ox2 different transgenic lines, (b) is the phenotype after 48h treatment at 4℃and (c) is the phenotype after 7 days of normal culture;

FIG. 10 shows survival rates of OsABA ox2 knockout (KO-3, KO-11) line and ZH11 seed after low temperature stress.

Detailed Description

The invention provides an application of OsABA ox2 gene in serving as a target gene of gene editing rice, wherein the nucleotide sequence of OsABA ox2 gene is shown as SEQ ID No. 2 and ：atggctttcttgctcttctttgtctttgtgacagctgcagtgctgtgcttcgtcgtcccggcgttcttgctgctctgcacgagcgtgcagaggaggagagatgttggacagggtggagggcgagattggcagaagaagaagaagctcaggcttcctccgggatccatgggctggccgtacgtcggcgagacgctccagctctactcccaggaccccaacgtcttcttcgcctccaagcagaagaggtacggcgagatattcaagacgaatctgctggggtgcccgtgcgtgatgctggcgagcccggaggcggcgaggttcgtgctggtgtcgcaggcgaggctgttcaagccgacgtacccgccgagcaaggagcggatgatcgggccgtcggcgctcttcttccaccagggcgagtaccacctccgcctccgccgcctcgtccaggccgccctcgccccggactccctccgcgccctcgtcccggacgtcgacgccgccgtcgccgccacgctcgccgcctggtccggcggccacgtcgccagcaccttccacgccatgaagaagctctcgttcgacgtcggcgtcgtgaccatcttcggcggccggctcggccgccggcacagggaggagctgaggacgaactactccgtcgtggagagaggctacaactgcttccccaaccgcttcccggggacgctctaccacaaggcgatccaggcgaggaagcggctgcgcgcgatcctgagcgagatcgtggcggagcggcgggcgcgcggcggcggcggcggcggcggcggcgacgacctcctcggcggcctcatgcggtcgcgcgacgacggcaccgccggcgcggtggcgctgctcaccgacgaccagatcgccgacaacgtcgtcggcgtgctgttcgcggcgcaggacaccaccgccagcgtcctcacctggatcctcaagtacctccacgactcgccgaagcttctcgaagccgtcaaggcggagcagatggcgatctacgtggccaacgagggcgggaagcggccgctgacgtggacgcagacgaggagcatgacactcacgcatcaggttatactggagagcttgaggatggcgagcataatctccttcacgttcagagaggcagtcgccgacgtggagtacaaaggtttcctgattccaaaggggtggaaggtgatgcctctgttcaggaacatccatcacaacccggactacttccaggatccacaaaagtttgatccttctagattcaaggtggcgccgcgtccaagcacgttcctgccgttcgggagcggcgtgcacgcgtgcccgggcaacgagctggccaagctggagatgctcgtcctcgtccaccgcctcgtcaccgcctacaggtgggagatcgtcggggcgagcgacgaggtggagtacagcccgttcccggtgccgaggggcgggctcaacgccaagctgtggaagcaggaggcggaggaggacatgtacatggccatgggcaccatcacagcagcaggtgcttga;, and the amino acid sequence of OsABA ox2 gene encoded protein is shown as SEQ ID No. 1 ：Met Ala Phe Leu Leu Phe Phe Val Phe Val Thr Ala Ala Val Leu Cys Phe Val Val Pro Ala Phe Leu Leu Leu Cys Thr Ser Val Gln Arg Arg Arg Asp Val Gly Gln Gly Gly Gly Arg Asp Trp Gln Lys Lys Lys Lys Leu Arg Leu Pro Pro Gly Ser Met Gly Trp Pro Tyr Val Gly Glu Thr Leu Gln Leu Tyr Ser Gln Asp Pro Asn Val Phe Phe Ala Ser Lys Gln Lys Arg Tyr Gly Glu Ile Phe Lys ThrAsn Leu Leu Gly Cys Pro Cys Val Met Leu Ala Ser Pro Glu Ala Ala Arg Phe Val Leu Val Ser Gln Ala Arg Leu Phe Lys Pro Thr Tyr Pro Pro Ser Lys Glu Arg Met Ile Gly Pro Ser Ala Leu Phe Phe His Gln Gly Glu Tyr His Leu Arg Leu Arg Arg Leu Val Gln Ala Ala Leu Ala Pro Asp Ser Leu Arg Ala Leu Val Pro Asp Val Asp Ala Ala Val Ala Ala Thr Leu Ala Ala Trp Ser Gly Gly His Val Ala Ser Thr Phe His Ala Met Lys Lys Leu Ser Phe Asp Val Gly Val Val Thr Ile Phe Gly Gly Arg Leu Gly Arg Arg His Arg Glu Glu Leu Arg Thr Asn Tyr Ser Val Val Glu Arg Gly Tyr Asn Cys Phe Pro Asn Arg Phe Pro Gly Thr Leu Tyr His Lys Ala Ile Gln Ala Arg Lys Arg Leu Arg Ala Ile Leu Ser Glu Ile Val Ala Glu Arg Arg Ala Arg Gly Gly Gly Gly Gly Gly Gly Gly Asp Asp Leu Leu Gly Gly Leu Met Arg Ser Arg Asp Asp Gly Thr Ala Gly Ala Val Ala Leu Leu Thr Asp Asp Gln Ile Ala Asp Asn Val Val Gly Val Leu Phe Ala Ala Gln Asp Thr Thr Ala Ser Val Leu Thr Trp Ile Leu Lys Tyr Leu His Asp Ser Pro Lys.

In the present invention, the nucleotide sequence may preferably be a sequence subjected to directed evolution and point mutation, and a nucleotide sequence artificially modified or having 80% or more identity with the OsABA ox2 gene, such as OsABA ox3 gene, in addition to the above-mentioned sequences.

The invention provides a targeting knockout or silencing OsABA ox2 gene sgRNA sequence, and the nucleotide sequence of the sgRNA sequence is shown as SEQ ID NO. 3: GAGGCTTCCTCCGGGATCCA.

The difference of strong and weak grain grouting has a non-negligible effect on the yield of gramineous crops, and the difference of weak grain grouting has become one of main reasons for restricting the rice to exert high yield potential. The ABA content in the grain grouting process shows a tendency of rising and falling, and the ABA content in the strong grain is higher than that in the weak grain. ABA promotes starch synthesis by improving the activity of enzymes related to the conversion of sucrose into starch, has extremely high correlation with indexes such as grain grouting rate, grain weight and the like, and is the most important plant hormone for regulating and controlling grain grouting. Therefore, the grouting rate and grain weight of the weak grains can be effectively improved by improving the endogenous ABA content of the grains or externally spraying low-concentration ABA. ABA 8' -carboxylase belongs to OsABA ox gene family, and its coding protein is a key enzyme for ABA decomposition, and is involved in regulating and controlling ABA homeostasis in plants. OsABA8ox2 is a major degradation gene of grain ABA, and is expressed in the weak grains significantly higher than the strong grains (FIG. 1), resulting in a difference in the levels of strong and weak grain ABA. According to the invention, through changing the expression condition of OsABA ox2 protein in rice grains, the endogenous ABA content is improved to a certain extent, the weak grain grouting can be effectively promoted, and the yield is improved; seed dormancy is a beneficial biological process for plants and is a self-protection mechanism of seeds against adverse environments, and this adaptation is the result of natural selection of plants during long-term evolution. Research shows that ABA induces seed dormancy in the seed maturation process, and simultaneously inhibits seed germination. During the storage process of the seeds, ABA in the seeds is continuously decomposed, the vitality of the seeds is gradually lost, the vitality of the aged seeds is reduced, and the germination rate is reduced. Under the low-temperature environment, the ABA content of the rice seedlings can be gradually increased, and the cold-resistant varieties have higher ABA content than the sensitive varieties. The externally applied ABA can improve the cold resistance of rice seedlings and improve the survival rate.

According to the invention, by knocking out OsABA ox2 genes, the content and/or activity of OsABA ox2 genes in the obtained knocked-out rice strain are reduced, so that each organ including seeds and seeds has higher ABA content, thereby improving the weak granule grouting rate, increasing the granule weight and improving the yield of the rice progeny, and simultaneously improving the ageing resistance of the seeds and the cold resistance of seedlings.

Therefore, the rice weak granule grouting can be regulated and controlled by inhibiting OsABA ox2 gene expression, and the ageing resistance of seeds and the cold resistance of seedlings can be improved.

The invention provides the use of OsABA ox2 gene expression inhibition in the following, characterized in that the use comprises: a: regulating and controlling the grouting of weak rice grains, wherein b is the aging resistance of seeds, and c is the cold resistance of seedlings. In the present invention, the methods of inhibition preferably include RNAi interference, gene site-directed editing, homologous recombination, and CRISPR/Cas9 gene knockout.

The method for inhibiting OsABA ox2 gene expression in regulating and controlling rice weak granule grouting and improving seed aging resistance and seedling cold resistance is preferably to introduce the recombinant vector into rice. The method of introduction is not limited in any way, and may be any method known to those skilled in the art.

Test results of specific embodiments prove that the method constructs a OsABA ox2 gene knockout vector and converts rice, so that the rice OsABA ox2 gene cannot be expressed normally, ABA degradation is inhibited, the ABA content of each organ of rice plants and seeds is improved, the grain filling rate and grain weight of weak grains are increased, the yield is improved, and the seed aging resistance and the seedling low temperature resistance are achieved. Under the condition that normal growth and development of rice are not affected, grouting can be promoted, and crop tolerance is improved, the OsABA ox2 gene is taken as a starting point, a method capable of simultaneously promoting weak grain grouting and improving seed aging resistance and seedling cold resistance is provided, and resources are provided for rice breeding.

For further explanation of the present invention, the use of OsABA ox2 gene provided in the present invention for controlling weak granule grouting and improving seed aging resistance and seedling cold resistance will be described in detail with reference to the accompanying drawings and examples, but they should not be construed as limiting the scope of the present invention.

Example 1

OsABA8ox2 gene knockout mutant and identification

To obtain the CRISPR/Cas9 mutant of OsABA ox2 (loc_os08g 36860) gene, biogle CRISPR/Cas kit (BGK 03, http:// www.biogle.cn /) was used and the CRISPR/Cas9 vector was constructed according to the specification. The target sequence is shown as SEQ ID No. 4: 5'-CAGGCTTCCTCCGGGATCCA-3' the gRNA sequence is shown as SEQ ID No. 3 at 147-166 bp of the OsABA ox2 gene full length CDS sequence (SEQ ID No. 2). Oligo was synthesized according to the 8ox2-ko-UP and 8ox2-ko-LOW sequences (Table 1). Oligo dimers were prepared and the dimers were constructed into CRISPR/Cas vectors, e.coli transformed, CRISPR/Cas9 vector Pbgk-OsABA ox2 was obtained and transformed into agrobacterium EHA105 and wild medium flower 11 (ZH 11), genetic transformation was done by the huntington biotechnology limited.

The transgenic seeds harvested from the T ₀ generation were planted to give plants of the T ₁ generation, and the T ₁ generation was subjected to PCR using 8ox2-T ₀ -F and 8ox2-T ₀ -R (Table 1), and sequenced to obtain two homozygous mutants of KO-3 and KO-11 (FIG. 2). KO-3 lacks 1A at 162bp of the full-length CDS sequence, resulting in a frame shift mutation, forming a stop codon at 291 bp. KO-11 inserts a T between 163bp and 164bp, and also forms a stop codon at 1255 bp. As shown in fig. 2 and 3, the amino acid sequences after mutation are shown as SEQ ID No:5(atggctttcttgctcttctttgtctttgtgacagctgcagtgctgtgcttcgtcgtcccggcgttcttgctgctctgcacgagcgtgcagaggaggagagatgttggacagggtggagggcgagattggcagaagaagaagaagctcaggcttcctccgggtccatgggctggccgtacgtcggcgagacgctccagctctactcccaggaccccaacgtcttcttcgcctccaagcagaagaggtacggcgagatattcaagacgaatctgctggggtgcccgtgcgtgatgctggcgagcccggaggcggcgaggttcgtgctggtgtcgcaggcgaggctgttcaagccgacgtacccgccgagcaaggagcggatgatcgggccgtcggcgctcttcttccaccagggcgagtaccacctccgcctccgccgcctcgtccaggccgccctcgccccggactccctccgcgccctcgtcccggacgtcgacgccgccgtcgccgccacgctcgccgcctggtccggcggccacgtcgccagcaccttccacgccatgaagaagctctcgttcgacgtcggcgtcgtgaccatcttcggcggccggctcggccgccggcacagggaggagctgaggacgaactactccgtcgtggagagaggctacaactgcttccccaaccgcttcccggggacgctctaccacaaggcgatccaggcgaggaagcggctgcgcgcgatcctgagcgagatcgtggcggagcggcgggcgcgcggcggcggcggcggcggcggcggcgacgacctcctcggcggcctcatgcggtcgcgcgacgacggcaccgccggcgcggtggcgctgctcaccgacgaccagatcgccgacaacgtcgtcggcgtgctgttcgcggcgcaggacaccaccgccagcgtcctcacctggatcctcaagtacctccacgactcgccgaagcttctcgaagccgtcaaggcggagcagatggcgatctacgtggccaacgagggcgggaagcggccgctgacgtggacgcagacgaggagcatgacactcacgcatcaggttatactggagagcttgaggatggcgagcataatctccttcacgttcagagaggcagtcgccgacgtggagtacaaaggtttcctgattccaaaggggtggaaggtgatgcctctgttcaggaacatccatcacaacccggactacttccaggatccacaaaagtttgatccttctagattcaaggtggcgccgcgtccaagcacgttcctgccgttcgggagcggcgtgcacgcgtgcccgggcaacgagctggccaagctggagatgctcgtcctcgtccaccgcctcgtcaccgcctacaggtgggagatcgtcggggcgagcgacgaggtggagtacagcccgttcccggtgccgaggggcgggctcaacgccaagctgtggaagcaggaggcggaggaggacatgtacatggccatgggcaccatcacagcagcaggtgcttga,KO-3) and SEQ ID No:6(atggctttcttgctcttctttgtctttgtgacagctgcagtgctgtgcttcgtcgtcccggcgttcttgctgctctgcacgagcgtgcagaggaggagagatgttggacagggtggagggcgagattggcagaagaagaagaagctcaggcttcctccgggattccatgggctggccgtacgtcggcgagacgctccagctctactcccaggaccccaacgtcttcttcgcctccaagcagaagaggtacggcgagatattcaagacgaatctgctggggtgcccgtgcgtgatgctggcgagcccggaggcggcgaggttcgtgctggtgtcgcaggcgaggctgttcaagccgacgtacccgccgagcaaggagcggatgatcgggccgtcggcgctcttcttccaccagggcgagtaccacctccgcctccgccgcctcgtccaggccgccctcgccccggactccctccgcgccctcgtcccggacgtcgacgccgccgtcgccgccacgctcgccgcctggtccggcggccacgtcgccagcaccttccacgccatgaagaagctctcgttcgacgtcggcgtcgtgaccatcttcggcggccggctcggccgccggcacagggaggagctgaggacgaactactccgtcgtggagagaggctacaactgcttccccaaccgcttcccggggacgctctaccacaaggcgatccaggcgaggaagcggctgcgcgcgatcctgagcgagatcgtggcggagcggcgggcgcgcggcggcggcggcggcggcggcggcgacgacctcctcggcggcctcatgcggtcgcgcgacgacggcaccgccggcgcggtggcgctgctcaccgacgaccagatcgccgacaacgtcgtcggcgtgctgttcgcggcgcaggacaccaccgccagcgtcctcacctggatcctcaagtacctccacgactcgccgaagcttctcgaagccgtcaaggcggagcagatggcgatctacgtggccaacgagggcgggaagcggccgctgacgtggacgcagacgaggagcatgacactcacgcatcaggttatactggagagcttgaggatggcgagcataatctccttcacgttcagagaggcagtcgccgacgtggagtacaaaggtttcctgattccaaaggggtggaaggtgatgcctctgttcaggaacatccatcacaacccggactacttccaggatccacaaaagtttgatccttctagattcaaggtggcgccgcgtccaagcacgttcctgccgttcgggagcggcgtgcacgcgtgcccgggcaacgagctggccaagctggagatgctcgtcctcgtccaccgcctcgtcaccgcctacaggtgggagatcgtcggggcgagcgacgaggtggagtacagcccgttcccggtgccgaggggcgggctcaacgccaagctgtggaagcaggaggcggaggaggacatgtacatggccatgggcaccatcacagcagcaggtgcttga,KO-11), so that OsABA ox2 gene cannot be expressed normally, and the content of mutant weak seed ABA is significantly higher than that of wild-type medium flower 11 (ZH 11) in the peak period of filling (9 d after flowers).

TABLE 1 primers required for example 1

Example 2

OsABA8ox2 transgenic material weak granule grouting and yield character statistics

OsABA8ox2 transgenic materials (KO-3 and KO-11 mutant lines) are normally planted in Hunan Changsha in spring and autumn of 2020, and OsABA ox2 over-expression materials (OE-26) are planted in addition to the mutants to reversely prove the effect of OsABA ox2 genes in weak granule grouting.

In the initial flowering period of the rice, the rice ears which are grown uniformly and flowering on the same day are marked with a label, and each material is marked with 300 ears. From post-flowers to mature harvest, each treatment was sampled 1 time every 3 days, 8 ears per treatment, and a total of 3 replicates were taken for grouting dynamics and grouting rate calculation. The strong and weak grains were harvested individually. The first branch at the top of the rice spike is the grain strong grain, and the last flowering grain of the second branch at the base of the rice spike is weak grain. And in the mature period, 10-15 single plants are harvested per treatment and used for counting yield traits, including effective spike number, grain number per spike, fruiting rate, grain weight of strong and weak vigour and single plant yield, and the results are shown in table 2, table 3 and fig. 4-7.

TABLE 2 spring agronomic trait statistics for OsABA8ox2 transgenic materials

TABLE 3 autumn agronomic trait statistics for OsABA8ox2 transgenic materials

The OsABA ox2 knockout mutants KO-3 and KO-11 had both increased grain width (FIG. 4 (a)) and grain length (FIG. 4 (b)) compared to ZH11, and OsABA ox2 gene overexpression material OE-26 showed poor grouting, and a part of the weak grains had severe degeneration (FIG. 4 (c)). In the planting in the early and late seasons, the agronomic characters are shown in table 2, table 3, fig. 5 and fig. 6, the grain weight of the OsABA ox2 gene mutant is increased by 7.09% -20.26%, the obvious or extremely obvious level is achieved, the final single plant yield is increased by 6.71% -12.46%, the OE-26 weak grain is reduced by 10.41%, and the yield is reduced by 12.59%. OsABA8ox2 knockout mutants KO-3 and KO-11 mainly have the advantages of improving the filling degree of the weak granules and having no obvious influence on the strong granules. The seed setting rate of the mutant is not different in early rice, but the seed setting rate is obviously improved by 10.26-12.53% when the late rice is planted. The heights of the mutant KO-3 and KO-11 are reduced by 10.46% -16.79% compared with ZH11, the levels are extremely remarkable, and the over-expression material OE-26 is obviously improved by 19.93% compared with ZH 11. The related materials have no difference in tillering and grain number.

The weak grain weight dynamics of both wild type and OsABA ox2 knockout mutants KO-3, KO-11 (FIG. 7 (a)) were counted and fitted using the Richards equation to give a grouting rate curve (FIG. 7 (b)). As can be seen, the OsABA ox2 knockout mutants KO-3 and KO-11 have obviously increased grain weight compared with ZH11, the grouting rate is increased compared with ZH11, and the grouting peak period is 3 days earlier than ZH 11. It shows that knocking-out OsABA ox2 gene can raise the grouting speed of weak grain, raise grain weight and raise yield.

Example 3

Analysis of aging resistance of OsABA ox2 mutant

We oven dried the new harvested seeds of wild type (Zhonghua 11, ZH 11) and OsABA ox2 mutants (KO-3 and KO-11 mutant lines) at 42℃for 3 days to equilibrate the moisture and break dormancy. An artificial aging method is adopted for aging test, specifically, water is added into a heat preservation box, seeds are spread in a water-proof culture dish, a constant temperature incubator is placed, the temperature is 50 ℃, the humidity is 100%, and aging treatment is carried out. Samples were taken at 72h and 96h for germination tests, 50 seeds were placed in a petri dish with a filter paper laid thereon, kept wet with water, placed at 28 ℃, and germinated in an incubator with alternating light and dark for 14h/10h at 70% relative humidity, each treatment was repeated for 3 days, and after 7 days, the germination rate was counted, and the survival rate was calculated, with the results shown in table 4 and fig. 8.

TABLE 4 seed aging survival (%)

Variety of species	72h	96h
			ZH11	68.33±5.20	0
KO-3	87.5±2.5*	45.0±6.61**
			KO-11	86.67±10.41*	44.17±8.04**

As can be seen from Table 4 and FIG. 8, the artificial aging treatment of wild-type ZH11 and OsABA ox2 gene knockout materials revealed that the seed of the knockout mutant had enhanced aging resistance, and the survival rate of the wild-type seed was reduced to 68.33% after 72 hours of artificial aging treatment, and the mutant still maintained over 85% survival rate; after 96h of aging, the wild-type ZH11 is completely inactivated, and the mutant still maintains about 45% of survival rate, which indicates that the mutant is more shelf-stable.

Example 4

OsABA8ox2 protein for regulating and controlling cold resistance of seedlings

To investigate the effect of OsABA ox2 protein on seedling cold resistance, osABA ox2 mutant, over-expression material (OE-26) and wild flower 11 (ZH 11) were soaked and sprouted simultaneously, and then placed at 28℃with 70% relative humidity, and a culture box with alternating light and dark for 14h/10h was used for normal hydroponic culture. Seedlings were transferred to a 4℃light incubator for 48 hours after 7 days and the statistical survival rate was recovered after 7d incubation at room temperature, and the results are shown in Table 5 and FIGS. 9 and 10.

TABLE 5 survival rate of seedlings at Low temperature treatment (%)

Variety of species	Survival rate
		ZH11	4.17±4.17
KO-3	54.17±12.5**
		KO-11	52.78±8.67**

As can be seen from Table 5, FIG. 9 and FIG. 10, osABA ox2 mutant KO-11 had a stronger tolerance to low temperature stress, whereas the over-expression material OE-26 was more sensitive to low temperature stress. Repeated experiments on OsABA ox2 mutant show that the survival rate of KO-3 and KO-11 mutant is obviously improved compared with ZH 11. Therefore, the knocking-out OsABA ox2 gene can improve the resistance of rice seedlings to low-temperature stress.

While the invention has been described in terms of preferred embodiments, it is not intended to be limited thereto, but rather to enable any person skilled in the art to make various changes and modifications without departing from the spirit and scope of the present invention, which is therefore to be limited only by the appended claims.

Sequence listing

<110> Hunan agricultural university

Application of <120> OsABA ox2 gene in regulating and controlling weak granule grouting and improving seed aging resistance and seedling cold resistance

<160> 10

<170> SIPOSequenceListing 1.0

<210> 1

<211> 325

<212> PRT

<213> Artificial sequence (ARTIFICIAL SEQUENCE)

<400> 1

Met Ala Phe Leu Leu Phe Phe Val Phe Val Thr Ala Ala Val Leu Cys

1 5 10 15

Phe Val Val Pro Ala Phe Leu Leu Leu Cys Thr Ser Val Gln Arg Arg

20 25 30

Arg Asp Val Gly Gln Gly Gly Gly Arg Asp Trp Gln Lys Lys Lys Lys

35 40 45

Leu Arg Leu Pro Pro Gly Ser Met Gly Trp Pro Tyr Val Gly Glu Thr

50 55 60

Leu Gln Leu Tyr Ser Gln Asp Pro Asn Val Phe Phe Ala Ser Lys Gln

65 70 75 80

Lys Arg Tyr Gly Glu Ile Phe Lys Thr Asn Leu Leu Gly Cys Pro Cys

85 90 95

Val Met Leu Ala Ser Pro Glu Ala Ala Arg Phe Val Leu Val Ser Gln

100 105 110

Ala Arg Leu Phe Lys Pro Thr Tyr Pro Pro Ser Lys Glu Arg Met Ile

115 120 125

Gly Pro Ser Ala Leu Phe Phe His Gln Gly Glu Tyr His Leu Arg Leu

130 135 140

Arg Arg Leu Val Gln Ala Ala Leu Ala Pro Asp Ser Leu Arg Ala Leu

145 150 155 160

Val Pro Asp Val Asp Ala Ala Val Ala Ala Thr Leu Ala Ala Trp Ser

165 170 175

Gly Gly His Val Ala Ser Thr Phe His Ala Met Lys Lys Leu Ser Phe

180 185 190

Asp Val Gly Val Val Thr Ile Phe Gly Gly Arg Leu Gly Arg Arg His

195 200 205

Arg Glu Glu Leu Arg Thr Asn Tyr Ser Val Val Glu Arg Gly Tyr Asn

210 215 220

Cys Phe Pro Asn Arg Phe Pro Gly Thr Leu Tyr His Lys Ala Ile Gln

225 230 235 240

Ala Arg Lys Arg Leu Arg Ala Ile Leu Ser Glu Ile Val Ala Glu Arg

245 250 255

Arg Ala Arg Gly Gly Gly Gly Gly Gly Gly Gly Asp Asp Leu Leu Gly

260 265 270

Gly Leu Met Arg Ser Arg Asp Asp Gly Thr Ala Gly Ala Val Ala Leu

275 280 285

Leu Thr Asp Asp Gln Ile Ala Asp Asn Val Val Gly Val Leu Phe Ala

290 295 300

Ala Gln Asp Thr Thr Ala Ser Val Leu Thr Trp Ile Leu Lys Tyr Leu

305 310 315 320

His Asp Ser Pro Lys

325

<210> 2

<211> 1533

<212> DNA

<213> Artificial sequence (ARTIFICIAL SEQUENCE)

<400> 2

atggctttct tgctcttctt tgtctttgtg acagctgcag tgctgtgctt cgtcgtcccg 60

gcgttcttgc tgctctgcac gagcgtgcag aggaggagag atgttggaca gggtggaggg 120

cgagattggc agaagaagaa gaagctcagg cttcctccgg gatccatggg ctggccgtac 180

gtcggcgaga cgctccagct ctactcccag gaccccaacg tcttcttcgc ctccaagcag 240

aagaggtacg gcgagatatt caagacgaat ctgctggggt gcccgtgcgt gatgctggcg 300

agcccggagg cggcgaggtt cgtgctggtg tcgcaggcga ggctgttcaa gccgacgtac 360

ccgccgagca aggagcggat gatcgggccg tcggcgctct tcttccacca gggcgagtac 420

cacctccgcc tccgccgcct cgtccaggcc gccctcgccc cggactccct ccgcgccctc 480

gtcccggacg tcgacgccgc cgtcgccgcc acgctcgccg cctggtccgg cggccacgtc 540

gccagcacct tccacgccat gaagaagctc tcgttcgacg tcggcgtcgt gaccatcttc 600

ggcggccggc tcggccgccg gcacagggag gagctgagga cgaactactc cgtcgtggag 660

agaggctaca actgcttccc caaccgcttc ccggggacgc tctaccacaa ggcgatccag 720

gcgaggaagc ggctgcgcgc gatcctgagc gagatcgtgg cggagcggcg ggcgcgcggc 780

ggcggcggcg gcggcggcgg cgacgacctc ctcggcggcc tcatgcggtc gcgcgacgac 840

ggcaccgccg gcgcggtggc gctgctcacc gacgaccaga tcgccgacaa cgtcgtcggc 900

gtgctgttcg cggcgcagga caccaccgcc agcgtcctca cctggatcct caagtacctc 960

cacgactcgc cgaagcttct cgaagccgtc aaggcggagc agatggcgat ctacgtggcc 1020

aacgagggcg ggaagcggcc gctgacgtgg acgcagacga ggagcatgac actcacgcat 1080

caggttatac tggagagctt gaggatggcg agcataatct ccttcacgtt cagagaggca 1140

gtcgccgacg tggagtacaa aggtttcctg attccaaagg ggtggaaggt gatgcctctg 1200

ttcaggaaca tccatcacaa cccggactac ttccaggatc cacaaaagtt tgatccttct 1260

agattcaagg tggcgccgcg tccaagcacg ttcctgccgt tcgggagcgg cgtgcacgcg 1320

tgcccgggca acgagctggc caagctggag atgctcgtcc tcgtccaccg cctcgtcacc 1380

gcctacaggt gggagatcgt cggggcgagc gacgaggtgg agtacagccc gttcccggtg 1440

ccgaggggcg ggctcaacgc caagctgtgg aagcaggagg cggaggagga catgtacatg 1500

gccatgggca ccatcacagc agcaggtgct tga 1533

<210> 3

<211> 20

<212> DNA

<213> Artificial sequence (ARTIFICIAL SEQUENCE)

<400> 3

gaggcttcct ccgggatcca 20

<210> 4

<211> 20

<212> DNA

<213> Artificial sequence (ARTIFICIAL SEQUENCE)

<400> 4

caggcttcct ccgggatcca 20

<210> 5

<211> 1532

<212> DNA

<213> Artificial sequence (ARTIFICIAL SEQUENCE)

<400> 5

atggctttct tgctcttctt tgtctttgtg acagctgcag tgctgtgctt cgtcgtcccg 60

gcgttcttgc tgctctgcac gagcgtgcag aggaggagag atgttggaca gggtggaggg 120

cgagattggc agaagaagaa gaagctcagg cttcctccgg gtccatgggc tggccgtacg 180

tcggcgagac gctccagctc tactcccagg accccaacgt cttcttcgcc tccaagcaga 240

agaggtacgg cgagatattc aagacgaatc tgctggggtg cccgtgcgtg atgctggcga 300

gcccggaggc ggcgaggttc gtgctggtgt cgcaggcgag gctgttcaag ccgacgtacc 360

cgccgagcaa ggagcggatg atcgggccgt cggcgctctt cttccaccag ggcgagtacc 420

acctccgcct ccgccgcctc gtccaggccg ccctcgcccc ggactccctc cgcgccctcg 480

tcccggacgt cgacgccgcc gtcgccgcca cgctcgccgc ctggtccggc ggccacgtcg 540

ccagcacctt ccacgccatg aagaagctct cgttcgacgt cggcgtcgtg accatcttcg 600

gcggccggct cggccgccgg cacagggagg agctgaggac gaactactcc gtcgtggaga 660

gaggctacaa ctgcttcccc aaccgcttcc cggggacgct ctaccacaag gcgatccagg 720

cgaggaagcg gctgcgcgcg atcctgagcg agatcgtggc ggagcggcgg gcgcgcggcg 780

gcggcggcgg cggcggcggc gacgacctcc tcggcggcct catgcggtcg cgcgacgacg 840

gcaccgccgg cgcggtggcg ctgctcaccg acgaccagat cgccgacaac gtcgtcggcg 900

tgctgttcgc ggcgcaggac accaccgcca gcgtcctcac ctggatcctc aagtacctcc 960

acgactcgcc gaagcttctc gaagccgtca aggcggagca gatggcgatc tacgtggcca 1020

acgagggcgg gaagcggccg ctgacgtgga cgcagacgag gagcatgaca ctcacgcatc 1080

aggttatact ggagagcttg aggatggcga gcataatctc cttcacgttc agagaggcag 1140

tcgccgacgt ggagtacaaa ggtttcctga ttccaaaggg gtggaaggtg atgcctctgt 1200

tcaggaacat ccatcacaac ccggactact tccaggatcc acaaaagttt gatccttcta 1260

gattcaaggt ggcgccgcgt ccaagcacgt tcctgccgtt cgggagcggc gtgcacgcgt 1320

gcccgggcaa cgagctggcc aagctggaga tgctcgtcct cgtccaccgc ctcgtcaccg 1380

cctacaggtg ggagatcgtc ggggcgagcg acgaggtgga gtacagcccg ttcccggtgc 1440

cgaggggcgg gctcaacgcc aagctgtgga agcaggaggc ggaggaggac atgtacatgg 1500

ccatgggcac catcacagca gcaggtgctt ga 1532

<210> 6

<211> 1534

<212> DNA

<213> Artificial sequence (ARTIFICIAL SEQUENCE)

<400> 6

atggctttct tgctcttctt tgtctttgtg acagctgcag tgctgtgctt cgtcgtcccg 60

gcgttcttgc tgctctgcac gagcgtgcag aggaggagag atgttggaca gggtggaggg 120

cgagattggc agaagaagaa gaagctcagg cttcctccgg gattccatgg gctggccgta 180

cgtcggcgag acgctccagc tctactccca ggaccccaac gtcttcttcg cctccaagca 240

gaagaggtac ggcgagatat tcaagacgaa tctgctgggg tgcccgtgcg tgatgctggc 300

gagcccggag gcggcgaggt tcgtgctggt gtcgcaggcg aggctgttca agccgacgta 360

cccgccgagc aaggagcgga tgatcgggcc gtcggcgctc ttcttccacc agggcgagta 420

ccacctccgc ctccgccgcc tcgtccaggc cgccctcgcc ccggactccc tccgcgccct 480

cgtcccggac gtcgacgccg ccgtcgccgc cacgctcgcc gcctggtccg gcggccacgt 540

cgccagcacc ttccacgcca tgaagaagct ctcgttcgac gtcggcgtcg tgaccatctt 600

cggcggccgg ctcggccgcc ggcacaggga ggagctgagg acgaactact ccgtcgtgga 660

gagaggctac aactgcttcc ccaaccgctt cccggggacg ctctaccaca aggcgatcca 720

ggcgaggaag cggctgcgcg cgatcctgag cgagatcgtg gcggagcggc gggcgcgcgg 780

cggcggcggc ggcggcggcg gcgacgacct cctcggcggc ctcatgcggt cgcgcgacga 840

cggcaccgcc ggcgcggtgg cgctgctcac cgacgaccag atcgccgaca acgtcgtcgg 900

cgtgctgttc gcggcgcagg acaccaccgc cagcgtcctc acctggatcc tcaagtacct 960

ccacgactcg ccgaagcttc tcgaagccgt caaggcggag cagatggcga tctacgtggc 1020

caacgagggc gggaagcggc cgctgacgtg gacgcagacg aggagcatga cactcacgca 1080

tcaggttata ctggagagct tgaggatggc gagcataatc tccttcacgt tcagagaggc 1140

agtcgccgac gtggagtaca aaggtttcct gattccaaag gggtggaagg tgatgcctct 1200

gttcaggaac atccatcaca acccggacta cttccaggat ccacaaaagt ttgatccttc 1260

tagattcaag gtggcgccgc gtccaagcac gttcctgccg ttcgggagcg gcgtgcacgc 1320

gtgcccgggc aacgagctgg ccaagctgga gatgctcgtc ctcgtccacc gcctcgtcac 1380

cgcctacagg tgggagatcg tcggggcgag cgacgaggtg gagtacagcc cgttcccggt 1440

gccgaggggc gggctcaacg ccaagctgtg gaagcaggag gcggaggagg acatgtacat 1500

ggccatgggc accatcacag cagcaggtgc ttga 1534

<210> 7

<211> 26

<212> DNA

<213> Artificial sequence (ARTIFICIAL SEQUENCE)

<400> 7

tgtgtgcagg cttcctccgg gatcca 26

<210> 8

<211> 26

<212> DNA

<213> Artificial sequence (ARTIFICIAL SEQUENCE)

<400> 8

aaactggatc ccggaggaag cctgca 26

<210> 9

<211> 20

<212> DNA

<213> Artificial sequence (ARTIFICIAL SEQUENCE)

<400> 9

caccccagca gattcgtctt 20

<210> 10

<211> 20

<212> DNA

<213> Artificial sequence (ARTIFICIAL SEQUENCE)

<400> 10

aggagacaca cacatggctt 20

Claims

1. Use of an sgRNA sequence or a CRISPR/Cas9 vector that inhibits OsABA ox2 gene expression in a subject comprising: improving seed aging resistance and improving seedling cold resistance;

The nucleotide sequence of the sgRNA sequence is shown as SEQ ID NO. 3;

the CRISPR/Cas9 vector contains the sgRNA sequence.