CN114949217A

CN114949217A - Cancer targets and uses thereof

Info

Publication number: CN114949217A
Application number: CN202110204100.6A
Authority: CN
Inventors: 季红斌; 金宇娟; 赵琪琪; 胡良
Original assignee: Center for Excellence in Molecular Cell Science of CAS
Current assignee: Center for Excellence in Molecular Cell Science of CAS
Priority date: 2021-02-23
Filing date: 2021-02-23
Publication date: 2022-08-30
Anticipated expiration: 2041-02-23
Also published as: CN114949217B

Abstract

Cancer targets and uses thereof. The invention relates to an agent for up-regulating WWTR1, a pharmaceutical composition and use thereof in preventing or treating cancer.

Description

Cancer targets and uses thereof

Technical Field

The invention belongs to the field of tumor research in life science, and particularly relates to discovery and application of a novel target molecule for diagnosing and treating small cell lung cancer.

Background

The small cell lung cancer accounts for about 15 percent of all lung cancers, the prognosis is poor, and the five-year survival rate of small cell patients is less than 7 percent. The main reason for this is that, because of the very strong metastatic potential of small cell lung cancer, over 70% of small cell lung cancer patients have extensive metastasis when they were first diagnosed. Therefore, there is an urgent need to enhance the research on the molecular mechanism of small cell lung cancer metastasis and provide help for the clinical treatment of small cell lung cancer patients.

Previous studies have shown that about 90% of human small cell lung cancer samples have double deletions or inactivating mutations of the cancer suppressor genes Rb1 and Trp 53. In 2003, Meuwissen et al successfully induced the generation of small cell lung cancer by simultaneously knocking out two genes, namely Rb1 and Trp53, in mouse epithelial cells, and well simulated the occurrence and development processes of human diseases. To this end, the first mouse small cell lung cancer model was successfully established that expresses neuroendocrine related molecular markers including Neural Cell Adhesion Molecule (NCAM) and achaete-score complex homolog 1(ASCL1) and is highly metastatic to distant tissue organs including the liver. Later researches show that on the basis of the mouse model, the Rb1 related gene P130 or the cancer suppressor gene Pten is knocked out simultaneously, so that malignant progression and metastasis of tumors can be accelerated remarkably.

The transcription coactivator YAP/TAZ (WWTR1) plays a role as a protooncogene in a variety of tumors of epithelial origin. The YAP/TAZ protein can promote abnormal cell proliferation by activating cell cycle and DNA replication, and can resist anoikis caused by cell shedding. Moreover, YAP/TAZ can maintain the ability of cells to self-renew and tumor initiation, and promote malignant progression and metastasis of tumors by promoting epithelial-to-mesenchymal transition (EMT) of cells. In addition, YAP/TAZ plays an important role in regulating the interaction between tumors and the tumor microenvironment, and affects the recruitment and activation of immune cells in the microenvironment. Clinical studies have found that the expression of YAP/TAZ is also closely related to poor prognosis in patients with non-small cell lung cancer. In the case of DNA damage, YAP enhances expression of pro-apoptosis related genes by interacting with P73. However, the function of YAP/TAZ in small cell lung cancer metastasis is unknown and needs to be studied urgently.

Disclosure of Invention

The inventor finds that WWTR1 plays a role in inhibiting cancer in small cell lung cancer and can inhibit the development and metastasis of tumors.

The invention aims to provide a cancer drug target and a reagent and a method for preventing and treating cancer, in particular WWTR 1-mediated cancer.

The invention provides application of an agent for up-regulating expression and/or activity of WWTR1 gene in preparing a medicament for preventing or treating cancer, inhibiting growth of tumor cells, inhibiting invasion capacity of tumor cells, inhibiting cloning formation capacity of tumor cells and inhibiting anti-anoikis capacity of tumor cells.

In one or more embodiments, the cancer is a WWTR1(TAZ) -mediated cancer.

In one or more embodiments, the cancer is a cancer with decreased expression of WWTR 1.

In one or more embodiments, the cancer is a cancer that benefits from upregulation of WWTR1 expression.

In one or more embodiments, the cancer is small cell lung cancer. Preferably, the small cell lung cancer has reduced expression of WWTR 1.

In one or more embodiments, the tumor cell is a tumor cell with decreased expression of WWTR 1.

In one or more embodiments, the tumor cell is a small cell lung cancer cell. Preferably, the small cell lung cancer cell has reduced expression of WWTR 1.

In one or more embodiments, the activity is nuclear entry activity of the WWTR1 protein.

In one or more embodiments, the agent that upregulates the expression and/or activity of the WWTR1 gene is selected from

(1) WWTR1 gene or WWTR1 activation variant gene,

(2) the protein encoded by the protein of (1),

(3) the nucleic acid construct comprising (1), or,

(4) a promoter of WWTR1 expression and/or activity.

In one or more embodiments, the WWTR1 gene includes a cDNA sequence, a genomic sequence, or a combination thereof.

In one or more embodiments, the WWTR1 gene is from a mammal, preferably a human.

In one or more embodiments, the amino acid sequence of the protein encoded by the WWTR1 gene is selected from the group consisting of:

(a) a polypeptide having a sequence as set forth in any one of SEQ ID NOs 1-3;

(b) a polypeptide derived from (a) by substituting, deleting or adding one or more (e.g., 1-20; preferably 1-10; more preferably 1-5) amino acid residues to the sequence shown in any one of SEQ ID NOS: 1-3, and having the function of the polypeptide of (a); or

(c) A polypeptide derived from (a) having more than 90% (preferably 93%; more preferably 95% or 98%) homology to the polypeptide sequence of (a) and having the function of the polypeptide of (a).

In one or more embodiments, the nucleic acid sequence of the WWTR1 gene is selected from the group consisting of:

(1) a polynucleotide encoding a polypeptide as set forth in any one of SEQ ID NOs 1-3;

(2) a polynucleotide as set forth in SEQ ID NO. 9 or a polynucleotide having 80% (preferably 90%; more preferably 95% or 98%) or more homology thereto;

(3) a polynucleotide in which 1 to 60 (preferably 1 to 30, more preferably 1 to 10) nucleotides are truncated or added at the 5 'end and/or 3' end of the polynucleotide shown in SEQ ID NO. 9;

(4) a polynucleotide complementary to the polynucleotide of any one of (1) to (3).

In one or more embodiments, the amino acid sequence of the protein encoding the WWTR1 activating variant gene is selected from the group consisting of:

(a) a polypeptide having a sequence as set forth in any one of SEQ ID NOs 4-8;

(b) a polypeptide derived from (a) by substituting, deleting or adding one or more (e.g., 1-20; preferably 1-10; more preferably 1-5) amino acid residues to the sequence shown in any one of SEQ ID NOS: 4-8, and having the function of the polypeptide of (a); or

In one or more embodiments, the nucleic acid sequence of said WWTR1 activating variant gene is selected from the group consisting of:

(1) a polynucleotide encoding a polypeptide as set forth in any one of SEQ ID NOS 4-8;

(2) 10 or a polynucleotide having 80% (preferably 90%; more preferably 95% or 98%) or more homology thereto;

(3) a polynucleotide in which 1 to 60 (preferably 1 to 30, more preferably 1 to 10) nucleotides are truncated or added at the 5 'end and/or 3' end of the polynucleotide shown in SEQ ID NO. 10;

In one or more embodiments, the nucleic acid construct is an expression vector or an integration vector.

In one or more embodiments, the promoter of WWTR1 expression and/or activity is selected from the group consisting of: a small molecule compound, a nucleic acid molecule, or a combination thereof.

In one or more embodiments, said promoter of expression and/or activity of WWTR1 is a compound of formula I:

wherein R1-R6 are each independently selected from C1-C4 alkyl, hydroxy, halogen or amino, and n is an integer from 1 to 9.

In one or more embodiments, R1, R2, and R4 are each independently selected from C1-C4 alkyl or hydroxy.

In one or more embodiments, R1, R2, and R4 are each independently selected from C1-C4 alkyl.

In one or more embodiments, R1, R2, and R4 are methyl.

In one or more embodiments, R3, R5, and R6 are each independently selected from hydroxy or halogen.

In one or more embodiments, R3, R5, and R6 are hydroxy.

In one or more embodiments, n is an integer from 2 to 6, preferably 3.

In one or more embodiments, said promoter of expression and/or activity of WWTR1 is:

the invention also provides a nucleic acid construct comprising the WWTR1 gene or the WWTR1 activation variant gene, or a host cell comprising said nucleic acid construct. The nucleic acid construct may be an expression vector or an integration vector. The host cell includes prokaryotic cells and eukaryotic cells.

The invention also provides pharmaceutical compositions comprising the nucleic acid constructs and/or cells described herein, and a pharmaceutically acceptable excipient.

In another aspect of the present invention, there is provided a method for screening a potential substance for preventing or treating cancer, inhibiting tumor cell growth, inhibiting tumor cell invasion ability, inhibiting tumor cell clonogenic ability, and inhibiting tumor cell anti-anoikis ability, the method comprising:

(1) contacting a system expressing WWTR1 or an activated variant thereof with a candidate agent; and

(2) detecting the expression or activity of WWTR1 in said system.

In one or more embodiments, if the candidate agent can promote the expression or activity of WWTR1, it indicates that the candidate agent is a potential agent for preventing or treating cancer, inhibiting tumor cell growth, inhibiting tumor cell invasion ability, inhibiting tumor cell clonogenic ability, and inhibiting tumor cell anti-anoikis ability.

In one or more embodiments, the cancer is a WWTR 1-mediated cancer.

In one or more embodiments, the tumor cell is a small cell lung cancer cell. Preferably, the expression of WWTR1 is reduced in small cell lung cancer cells.

In one or more embodiments, step (1) comprises: in the test group, the candidate substance was added to a system expressing WWTR1 or an activated variant thereof.

In one or more embodiments, step (2) comprises: detecting the expression or activity of WWTR1 in the system of the test group and comparing it with a control group, wherein said control group is a system expressing WWTR1 or an activating variant thereof without the addition of said candidate substance.

In one or more embodiments, if the expression or activity of WWTR1 or an activating variant thereof in the test group is statistically higher (preferably significantly higher, e.g., more than 20% higher, preferably more than 50% higher, more preferably more than 80% higher) than in the control group, it is indicated that the candidate is a potential agent for preventing or treating cancer, inhibiting tumor cell growth, inhibiting tumor cell invasiveness, inhibiting tumor cell clonality, and inhibiting tumor cell anti-anoikis ability.

In one or more embodiments, said system expressing WWTR1 or an activating variant thereof is selected from the group consisting of: cell systems (or cell culture systems), subcellular systems, solution systems, tissue systems, organ systems, or animal systems.

In one or more embodiments, the system expressing WWTR1 or an activating variant thereof is a cancer cell or a solution system.

In another aspect, the present invention provides a method for preventing or treating cancer in a subject, the method comprising: up-regulating the expression and/or activity of the WWTR1 gene of said subject.

In one or more embodiments, the method comprises administering to a patient in need thereof a promoter of WWTR1 gene or a protein encoding thereof, a WWTR1 activating variant gene or a protein encoding thereof, or WWTR1 expression and/or activity.

In one or more embodiments, the other features of the method are as described in the first aspect herein.

In another aspect, the present invention provides the use of an agent that detects the expression or activity of WWTR1 in the manufacture of a kit for the diagnosis of cancer or prognosis thereof.

In one or more embodiments, the cancer is a WWTR 1-mediated cancer.

In one or more embodiments, the agent for detecting expression or activity of WWTR1 comprises:

(1) a primer or probe targeting WWTR1 or a transcript thereof, or

(2) An antibody or ligand that specifically binds WWTR 1.

In one or more embodiments, the kit further comprises reagents required for RT-PCR, such as reverse transcriptase, RNA extraction reagents, nucleic acid polymerase, dntps, PCR buffer, and the like.

In one or more embodiments, the kit further comprises reagents required for Northern, such as RNA extraction reagents, ribonuclease inhibitors, Northern buffers, and the like.

In one or more embodiments, the kit further comprises reagents required for Western blotting, such as protein extraction reagents, acrylamide, guanidinium isothiocyanate, Tris, SDS, TEMED, and the like.

In one or more embodiments, the sequence of the WWTR1 gene, its transcript, protein is as described herein in the first aspect.

In another aspect of the present invention, there is provided a method for diagnosing cancer or prognosis thereof, said method comprising detecting expression or activity of WWTR1 in a subject.

In one or more embodiments, the method comprises:

(1) a sample of the subject is obtained and,

(2) detecting expression or activity of WWTR1 in a subject sample, and

(3) comparing the expression or activity of WWTR1 in the subject with the expression or activity of WWTR1 of a healthy control, if the expression or activity of WWTR1 in the subject is decreased, the subject is diagnosed with cancer or with a poor prognosis of cancer.

In one or more embodiments, the sample is a bodily fluid or tissue biopsy.

In one or more embodiments, the cancer is a WWTR 1-mediated cancer.

The invention also provides the use of a compound of formula I for up-regulating the expression and/or activity of WWTR 1:

In one or more embodiments, R1, R2, and R4 are methyl.

In one or more embodiments, R3, R5, and R6 are hydroxy.

In one or more embodiments, n is an integer from 2 to 6, preferably 3.

Drawings

FIG. 1 shows that SMC has a stronger liver metastasis ability.

A: photographs of liver metastases in subcutaneous neoplasia experiments in Non-SMC and SMC nude mice. Green arrows indicate metastases.

B: percentage of liver metastases in subcutaneous tumor experiments in Non-SMC and SMC nude mice. Three cell lines per group. Each cell line was inoculated with 5 nude mice.

FIG. 2 shows that TAZ is significantly upregulated in Non-SMCs.

A: RNA-seq and ATAC-seq integration analysis scheme. Specific TF networks in SMCs and Non-SMCs were established according to the PECA2 model.

B: expression of Taz in SMC and Non-SMC.

C: quantitative PCR detects mRNA expression of TAZ in SMC and Non-SMC.

Figure 3 shows that knockdown of TAZ promotes malignant progression and metastasis of small cell lung cancer.

A: schematic representation of comparative analysis between Non-SMC knockdown TAZ and control cell lines.

B: 3-D cell culture experiments detect the difference of invasion capacity before and after Non-SMC knockdown of TAZ. A scale: 100 μm.

C: the soft agarose cloning experiment detects the difference of the proliferation capacity before and after the Non-SMC knockdown of TAZ. Representative plot of clone growth (left), statistical analysis (right), scale: 100 μm.

D: the immunoblotting experiment detects the difference of anti-anoikis ability before and after Non-SMC knockdown TAZ. CC3 cleaved caspase 3. Internal reference: TUBULIN.

E: Non-SMC reduced the percentage of liver metastases in nude mice before and after TAZ knockdown.

F: immunohistochemical staining examined the protein expression level of NCAM in the liver of nude mice subcutaneously inoculated with Non-SMC-shTaz or control cells. Scale: 100 μm.

FIG. 4 shows that overexpression of TAZ-4SA inhibits malignant progression and metastasis of small cell lung cancer.

A: schematic representation of comparative analysis between SMC over-expressing TAZ-4SA and control cell lines.

B: 3-D cell culture experiments detected the difference of invasion capacity before and after the overexpression of TAZ-4SA by SMC. A scale: 100 μm.

C: the soft agarose cloning experiment detects the difference of the proliferation capacity of Non-SMC before and after the TAZ knockdown. Representative plot of clone growth (left), statistical analysis (right), scale: 100 μm.

D: the difference of anti-anoikis ability before and after the overexpression of TAZ-4SA by SMC is detected by an immunoblotting experiment. CC3: cleared caspase 3. Internal reference: TUBULIN.

E: percentage of liver metastases in nude mice before and after overexpression of TAZ-4SA by SMC.

F: immunohistochemical staining examined the protein expression level of NCAM in the liver of nude mice subcutaneously inoculated with SMC-TAZ-4SA or control cells. A scale: 100 μm.

FIG. 5 shows that Digitoxin treatment activates TAZ significantly inhibiting small cell lung cancer malignant progression and metastasis.

A: immunohistochemical staining examined protein expression levels of TAZ in subcutaneous tumors of nude mice subcutaneously inoculated with SMC-TAZ-4SA or control cells. A scale: 100 μm.

B: SMC nude mice were inoculated subcutaneously and the percentage of liver metastases in the control group after administration of the TAZ activator Digitoxin treatment.

FIG. 6 shows that low expression levels of TAZ correlate with poor prognosis of small cell lung cancer.

A: immunohistochemical staining detects protein expression levels of TAZ in surgical tumor samples from clinical small cell lung cancer patients. A scale: 100 μm.

B: survival (OS) of small cell lung cancer patients with different levels of TAZ protein expression.

Detailed Description

Through comprehensive analysis of human clinical samples, cell lines and genetically engineered mouse models with cancer as background, the inventors prove that TAZ plays a role in inhibiting cancer in the development and metastasis of small cell lung cancer and can be used as a potential target for clinical treatment. In addition, analysis of human small cell lung cancer samples confirmed that low expression levels of TAZ correlated with poor prognosis in the patients.

WWTR1, variants thereof and promoters thereof

As used herein, the polypeptide encoded by the WWTR1 (or TAZ) gene is designated "WWTR 1" or "TAZ". In the present invention, the term "WWTR 1" refers to a polypeptide having the sequence shown in any one of SEQ ID NOS: 1 to 3 and having WWTR1 activity. The term also includes variants of the sequence shown in any of SEQ ID NOs 1-3 having the same function as WWTR 1. These variants include (but are not limited to): deletion, insertion and/or substitution of several (usually 1 to 50, preferably 1 to 30, 1 to 20, 1 to 10, 1 to 8, 1 to 5) amino acids, and addition or deletion of one or several (usually up to 20, preferably up to 10, more preferably up to 5) amino acids at the C-terminal and/or N-terminal. For example, in the art, substitutions with amino acids of similar or similar properties will not generally alter the function of the protein. Amino acids with similar properties are often referred to in the art as families of amino acids with similar side chains, which are well defined in the art. These families include amino acids with basic side chains (e.g., lysine, arginine, histidine), acidic side chains (e.g., aspartic acid, glutamic acid), uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine), nonpolar side chains (e.g., alanine, valine, leucine, isoleucine, lactic acid, phenylalanine, methionine, tryptophan), beta-branched side chains (e.g., threonine, valine, isoleucine) and aromatic side chains (e.g., tyrosine, phenylalanine tryptophan, histidine). Also, for example, the addition of one or more amino acids at the amino-and/or carboxy-terminus will not generally alter the function of the polypeptide or protein. Conservative amino acid substitutions for many commonly known non-genetically encoded amino acids are known in the art. Conservative substitutions of other non-coding amino acids may be determined based on a comparison of their physical properties with those of genetically coded amino acids.

Variants of the polypeptides include: homologous sequences, conservative variants, allelic variants, natural mutants, induced mutants, activated variants.

Any polypeptide having a high homology to said WWTR1 (such as 70% or more homology to the sequence as shown in any of SEQ ID NOs: 1-3; preferably 80% or more homology; more preferably 90% or more homology, such as 95%, 98% or 99%) and having a similar or identical function to WWTR1 is also encompassed by the present invention. The "same or similar functions" mainly refer to the functions of inhibiting the growth, invasion and metastasis of tumor cells.

The invention also includes analogs of the claimed polypeptides. These analogs may differ from native WWTR1 by amino acid sequence differences, by modifications that do not affect the sequence, or by both. Analogs of these proteins include natural or induced genetic variants. Induced variants can be obtained by various techniques, such as random mutagenesis by irradiation or exposure to mutagens, site-directed mutagenesis, or other well-known biological techniques. Analogs also include analogs having residues other than the natural L-amino acids (e.g., D-amino acids), as well as analogs having non-naturally occurring or synthetic amino acids (e.g., beta, gamma-amino acids). It is to be understood that the proteins of the present invention are not limited to the representative proteins exemplified above.

The present invention also includes activating variants of WWTR 1. The activating variant has a similar sequence to WWTR1 but higher activity. Any activating variant of WWTR1 known in the art can be used in the present invention to increase the activity of WWTR1 of a cell (e.g., a tumor cell), thereby inhibiting growth, invasion, metastasis of a tumor cell (e.g., a cell of small cell lung cancer). Exemplary activating variants known in the art include, but are not limited to, TAZ-4SA, TAZs89A, TAZs66A, TAZs117A, TAZs311A, the amino acid sequence of which is set forth in any one of SEQ ID nos. 4-8.

The polypeptide fragment, derivative or analogue of the invention may also be: (i) a polypeptide formed by fusing a mature polypeptide to another compound (such as a compound that increases the half-life of the polypeptide, e.g., polyethylene glycol); or (ii) a polypeptide in which an additional amino acid sequence is fused to the polypeptide sequence (e.g., a leader or secretory sequence or a sequence used to purify the polypeptide or a proprotein sequence, or a fusion protein). Such fragments, derivatives and analogs are within the purview of those skilled in the art in view of the definitions herein.

The invention also relates to a polynucleotide sequence encoding the WWTR1 of the invention or a variant, analogue or derivative thereof. The polynucleotide may be in the form of DNA or RNA. The form of DNA includes cDNA, genomic DNA or artificially synthesized DNA. The DNA may be single-stranded or double-stranded. The DNA may be the coding strand or the non-coding strand. The sequence of the coding region encoding the mature polypeptide may be identical to the sequence of the coding region shown in SEQ ID NO. 9 or 10 or may be a degenerate variant.

The present invention also relates to variants of the above polynucleotides encoding fragments, analogs and derivatives of the polypeptides having the same amino acid sequence as the present invention. The variant of the polynucleotide may be a naturally occurring allelic variant or a non-naturally occurring variant. These nucleotide variants include substitution variants, deletion variants and insertion variants. As is known in the art, an allelic variant is a substitution of a polynucleotide, which may be a substitution, deletion, or insertion of one or more nucleotides, without substantially altering the function of the polypeptide encoded thereby. As used herein, degenerate variants refer in the present invention to nucleic acid sequences which encode a protein having any one of SEQ ID NOs 1-8, but differ in the sequence of the coding region as set forth in SEQ ID NOs 9 or 10. A "polynucleotide encoding a polypeptide" may be a polynucleotide comprising a sequence encoding the polypeptide, or may be a polynucleotide further comprising additional coding and/or non-coding sequences.

The present invention also relates to polynucleotides which hybridize to the sequences described above and which have at least 50%, preferably at least 70%, more preferably at least 80% identity between the two sequences. The present invention particularly relates to polynucleotides which hybridize under stringent conditions to the polynucleotides of the present invention. In the present invention, "stringent conditions" refer to (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2 XSSC, 0.1% SDS, 60 ℃; or (2) adding denaturant during hybridization, such as 50% (v/v) formamide, 0.1% calf serum/0.1% Ficoll, 42 deg.C, etc.; or (3) hybridization occurs only when the identity between two sequences is at least 90% or more, preferably 95% or more. And, the polypeptides encoded by the hybridizable polynucleotides have the same biological functions and activities as the mature polypeptides represented by any one of SEQ ID NOs 1 to 8.

The full-length WWTR1 nucleotide sequence or its fragment (e.g., primer or probe) of the present invention can be obtained by PCR amplification, recombination, or artificial synthesis. For PCR amplification, primers can be designed based on the nucleotide sequences disclosed herein, particularly open reading frame sequences, and the sequences can be amplified using a commercially available DNA library or a cDNA library prepared by conventional methods known to those skilled in the art as a template. When the sequence is long, two or more PCR amplifications are often required, and then the amplified fragments are spliced together in the correct order. Once the sequence of interest has been obtained, it can be obtained in large quantities by recombinant methods. Usually, it is cloned into a vector, transferred into a cell, and then isolated from the propagated host cell by a conventional method to obtain the relevant sequence. Methods known in the art for designing Primer and probe sequences are all useful herein, for example by software Primer Express.

In addition, the sequence can be synthesized by artificial synthesis, especially when the fragment length is short. Generally, fragments with long sequences are obtained by first synthesizing a plurality of small fragments and then ligating them. At present, the DNA sequence encoding the protein of the present invention (or its fragment, or its derivative) can be obtained completely by chemical synthesis. The DNA sequence may then be introduced into various existing DNA molecules (or vectors, for example) and cells known in the art. Furthermore, mutations can also be introduced into the protein sequences of the invention by chemical synthesis.

The present invention also provides a recombinant vector comprising the gene of the present invention. Common recombinant vectors include expression vectors and integration vectors. The expression vector is used to express the gene in a host, and expression may be inducible (e.g., using an inducible promoter) or constitutive (e.g., using a constitutive promoter). The integration vector is used to integrate the gene into the genome of the host. In a preferred embodiment, the promoter downstream of the recombinant vector comprises a multiple cloning site or at least one cleavage site. When it is desired to express the target gene of the present invention, the target gene is ligated into a suitable multiple cloning site or restriction enzyme site, thereby operably linking the target gene with the promoter. As another preferred mode, the recombinant vector comprises (in the 5 'to 3' direction): a promoter, a gene of interest, and a terminator. If desired, the recombinant vector may further comprise an element selected from the group consisting of: a 3' polyadenylation signal; an untranslated nucleic acid sequence; transport and targeting nucleic acid sequences; resistance selection markers (dihydrofolate reductase, neomycin resistance, hygromycin resistance, green fluorescent protein, etc.); an enhancer; or operator.

One of ordinary skill in the art can use well-known methods to construct expression vectors containing the genes described herein. These methods include in vitro recombinant DNA techniques, DNA synthesis techniques, in vivo recombinant techniques, and the like. When the gene of the invention is used for constructing a recombinant expression vector, any enhanced, constitutive, tissue-specific or inducible promoter can be added in front of the transcription initiation nucleotide. The expression vector may be a bacterial plasmid, a bacteriophage, a yeast plasmid, a plant cell virus, a mammalian cell virus, or other vector. In general, any plasmid and vector may be used as long as they are capable of replication and stability in the host.

Vectors comprising the gene, expression cassette or gene of the invention may be used to transform appropriate host cells to allow the host to express the protein. The host cell may be a prokaryotic cell, such as E.coli, Streptomyces, Agrobacterium; or lower eukaryotic cells, such as yeast cells; or higher eukaryotic cells, such as animal cells. It will be clear to one of ordinary skill in the art how to select an appropriate vector and host cell. Transformation of a host cell with recombinant DNA can be carried out using conventional techniques well known to those skilled in the art. When the host is a prokaryote (e.g., Escherichia coli), CaCl may be used ₂ By electroporation, or by electroporationAnd (6) rows. When the host is a eukaryote, the following DNA transfection methods may be used: calcium phosphate coprecipitation, conventional mechanical methods (e.g., microinjection, electroporation, liposome encapsulation, etc.). When expressed in higher eukaryotic cells, the polynucleotide will provide enhanced transcription when enhancer sequences are inserted into the vector. Enhancers are cis-acting elements of DNA, usually about 10 to 300 bp in length, that act on a promoter to increase gene transcription.

The methods may be carried out using any suitable conventional means, including reagents, temperature, pressure conditions, and the like. Other methods of increasing expression of WWTR1 are known in the art. For example, expression of WWTR1 can be enhanced by driving with a strong promoter. Or the expression of the WWTR1 gene is enhanced by an enhancer. Strong promoters suitable for use in the methods of the invention include, but are not limited to: 35s promoter, Ubi promoter of rice and corn, etc. It will be clear to one of ordinary skill in the art how to select appropriate vectors, promoters, enhancers and host cells.

The polypeptides described herein may be expressed intracellularly, or on the cell membrane, or secreted extracellularly. If necessary, the recombinant protein can be isolated and purified by various separation methods using its physical, chemical and other properties. These methods are well known to those skilled in the art. Examples of such methods include (but are not limited to): conventional renaturation treatment, treatment with a protein precipitant (such as salt precipitation), centrifugation, cell lysis by osmosis, sonication, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography, High Performance Liquid Chromatography (HPLC), and other various liquid chromatography techniques, and combinations thereof.

The present invention also relates to an agent that up-regulates the expression and/or activity of WWTR1 gene. These agents inhibit tumor growth by affecting WWTR1, thereby preventing and treating cancer (e.g., small cell lung cancer), inhibiting tumor cell growth, inhibiting tumor cell invasion ability, inhibiting tumor cell clonogenic ability, and inhibiting tumor cell anti-anoikis ability. Any substance that can increase the activity of WWTR1, improve its stability, promote its expression, prolong its effective action time, or promote the transcription and translation of its gene may be used in the present invention as an agent that up-regulates the expression and/or activity of WWTR1 gene. For example, the above-mentioned WWTR1 gene or WWTR1 activating variant gene, its encoding protein, nucleic acid construct expressing said protein are all contained in an agent that up-regulates the expression and/or activity of WWTR1 gene.

The agent that up-regulates the expression and/or activity of WWTR1 gene further includes a promoter of the expression and/or activity of WWTR1, such as a small molecule compound, a nucleic acid molecule, or a combination thereof having the above-described functions. In an exemplary embodiment, said promoter of expression and/or activity of WWTR1 is a compound of formula I:

wherein R1-R6 are each independently selected from C1-C4 alkyl, hydroxy, halogen or amino, and n is an integer from 1 to 9. In certain embodiments, the promoter of expression and/or activity of WWTR1 is:

as used herein, the term "alkyl", alone or in combination with other terms, refers to saturated aliphatic alkyl groups, including straight or branched chain alkyl groups of 1-20 carbon atoms, as well as cyclic groups. Preferably, alkyl means a medium alkyl group containing 1 to 10 carbon atoms, such as methyl, ethyl, propyl, 2-isopropyl, n-butyl, isobutyl, tert-butyl, pentyl and the like. More preferably, it means a lower alkyl group having 1 to 4 carbon atoms, such as methyl, ethyl, propyl, 2-isopropyl, n-butyl, isobutyl, tert-butyl and the like. The cyclic group may be monocyclic or polycyclic, and preferably has 3 to 10 ring carbon atoms. Exemplary cyclic groups include cyclopropyl, cyclopropylmethyl, cyclopentyl, cyclohexyl, adamantyl, and substituted and unsubstituted bornyl, norbornyl, and norbornenyl groups. The alkyl group may be substituted or unsubstituted. When substituted, the number of substituents is 1 or more, preferably 1 to 3, more preferably 1 or 2, and the substituents are independently selected from the group consisting of halogen, carboxyl, hydroxy, lower alkoxy, aryl.

The term "halogen" as used herein refers to F, Cl, Br, or I. The term "hydroxy" denotes an-OH group. The term "oxo" or the group "oxo" denotes an ═ O group. The term "amino" refers to the group-NH 2.

Pharmaceutical composition

The invention also provides a composition comprising an effective amount (e.g., 0.000001-50 wt%, preferably 0.00001-20 wt%, more preferably 0.0001-10 wt%) of an agent that upregulates expression and/or activity of WWTR1, and a pharmaceutically acceptable excipient. The composition can be used for preventing and treating WWTR1 related cancers. Any of the foregoing agents that upregulate expression and/or activity of WWTR1 can be used in the preparation of the composition.

As used herein, the "effective amount" refers to an amount that is functional or active in humans and/or animals and is acceptable to humans and/or animals. The "pharmaceutically acceptable excipient" refers to an excipient for administration of a therapeutic agent, and includes various excipients and diluents. The term refers to pharmaceutical excipients that: they are not essential active ingredients per se and are not unduly toxic after administration. Suitable adjuvants are well known to those of ordinary skill in the art. Pharmaceutically acceptable excipients in the composition may comprise liquids such as water, saline, buffers. In addition, auxiliary substances, such as fillers, lubricants, glidants, wetting or emulsifying agents, pH buffer substances and the like, may also be present in these adjuvants. The auxiliary material can also contain a cell transfection reagent.

Knowing the use of the agent that upregulates the expression and/or activity of WWTR1, a variety of methods well known in the art can be employed to administer the agent (e.g., gene, protein, small molecule compound) or pharmaceutical composition thereof to a mammal. Including but not limited to: subcutaneous injection, intramuscular injection, transdermal administration, topical administration, implantation, sustained release administration, and the like; preferably, the mode of administration is parenteral.

Preferably, it can be carried out by means of gene therapy. For example, an agent that upregulates expression and/or activity of WWTR1 can be administered directly to a subject by a method such as injection; alternatively, expression units (e.g., expression vectors or viruses) carrying agents that upregulate the expression and/or activity of WWTR1 can be delivered to a target (e.g., tumor cell) and caused to express an active upregulating agent, in a manner that depends on the type of agent, as is well known to those skilled in the art.

The effective amount of an agent that upregulates the expression and/or activity of WWTR1 in accordance with the invention may vary depending on the mode of administration and the severity of the condition being treated, among other things. The selection of a preferred effective amount can be determined by one of ordinary skill in the art based on a variety of factors (e.g., by clinical trials). Such factors include, but are not limited to: pharmacokinetic parameters such as bioavailability, metabolism, half-life, etc., of said agent that upregulates expression and/or activity of WWTR 1; the severity of the disease to be treated by the patient, the weight of the patient, the immune status of the patient, the route of administration, and the like. In general, satisfactory results are obtained when an agent of the invention that upregulates expression and/or activity of WWTR1 is administered daily at a dosage of about 0.00001mg to about 50mg per kg of animal body weight (e.g., about 0.0001mg to about 10mg per kg of animal body weight). For example, divided doses may be administered several times per day, or the dose may be proportionally reduced, as may be required by the urgency of the condition being treated.

Drug screening

After the close association of WWTR1 with the relevant cancer is known, substances that up-regulate the expression or activity of WWTR1 can be screened based on this feature. From said substances, a drug useful for preventing or treating WWTR 1-related cancers can be found.

Accordingly, the present invention provides a method for screening a potential substance for preventing or treating WWTR 1-related cancer, said method comprising: contacting a system expressing WWTR1 or an activated variant thereof with a candidate agent; and (2) detecting the expression or activity of WWTR1 in said system. If the candidate substance can promote the expression or activity of WWTR1, it is an indication that the candidate substance is a potential substance for preventing or treating cancer.

Said system expressing WWTR1 or an activating variant thereof may be, for example, a cell (or cell culture) system, said cell may be a cell endogenously expressing WWTR1 or an activating variant thereof; or may be a cell recombinantly expressing WWTR1 or an activated variant thereof. The system for expressing WWTR1 or an activated variant thereof may also be a subcellular system, a solution system, a tissue system, an organ system, or an animal system (e.g., an animal model, preferably a non-human mammalian animal model, such as mouse, rabbit, sheep, monkey, etc.), and the like.

In a preferred mode of the present invention, in order to make it easier to observe a change in the expression or activity of MCP-1 in the screening, a control group may be provided, which may be a system expressing WWTR1 or an activated variant thereof without adding the candidate substance.

The present invention is not particularly limited with respect to the method for detecting the expression, activity, amount of presence or secretion of WWTR1 or an activator variant thereof. Conventional protein quantitative or semi-quantitative detection techniques may be employed, such as (but not limited to): SDS-PAGE, Western-Blot, etc.

Diagnostics and kits

Based on the fact that WWTR1 can inhibit the growth and invasion of tumor cells and further inhibit the occurrence and development of tumors, and the fact that the prognosis of tumors with high expression of WWTR1 is poor, the invention also provides a method for diagnosing cancer or the prognosis of cancer, which comprises detecting the expression or activity of WWTR1 in a subject. The method comprises the following steps: (1) obtaining a sample from a subject, (2) detecting WWTR1 expression or activity in the sample from the subject, and (3) comparing the expression or activity of WWTR1 in the subject to the expression or activity of WWTR1 in a healthy control, and if the expression or activity of WWTR1 in the subject is decreased, diagnosing the subject as having cancer or having a poor prognosis of cancer, particularly a WWTR 1-associated cancer. Preferably, the cancer is a cancer with reduced expression of WWTR1 or a cancer that benefits from upregulation of expression of WWTR 1. In a specific embodiment, the cancer is small cell lung cancer.

Typically, reagents used to detect expression or activity of WWTR1 include: (1) a primer or probe that targets WWTR1 or its transcript, or (2) an antibody or ligand that specifically binds WWTR 1. Primers, probes are as described elsewhere herein. Any antibody or ligand known in the art that specifically binds WWTR1 may be used in the present invention. The antibody may be a monoclonal antibody or a polyclonal antibody. Animals, such as rabbits, mice, rats, camels, etc., can be immunized with the WWTR1 protein to produce polyclonal antibodies; various adjuvants may be used to enhance the immune response, including but not limited to Freund's adjuvant and the like. Similarly, cells expressing WWTR1 or antigenic fragments thereof can be used to immunize animals to produce antibodies. The antibody may also be a monoclonal antibody, and such monoclonal antibodies may be prepared using hybridoma technology or single cell screening. Furthermore, after the sequence of the antibody is known, the coding sequence of the antibody may be loaded into an expression vector, whereby the antibody gene is operably linked to a promoter, a terminator, and the like, and expressed in a host cell, thereby producing the antibody. Other components required for expression vectors, such as promoters, terminators, expression vectors may be bacterial plasmids, bacteriophages, yeast plasmids, plant cell viruses, mammalian cell viruses or other vectors. In general, any plasmid and vector may be used as long as they are capable of replication and stability in the host. It will be clear to one of ordinary skill in the art how to select appropriate vectors, promoters, enhancers and host cells.

The reagent for detecting the expression or activity of WWTR1 can be prepared into a kit for diagnosing WWTR1 related cancers. In addition, the kit may further comprise reagents required for RT-PCR, such as reverse transcriptase, RNA extraction reagents, nucleic acid polymerase, dNTP, PCR buffer, and the like; alternatively, the kit may further comprise reagents required for Northern, such as RNA extraction reagents, ribonuclease inhibitors, Northern buffers, and the like; alternatively, the kit further comprises reagents required for Western blotting, such as protein extraction reagents, acrylamide, guanidinium isothiocyanate, Tris, SDS, TEMED and the like.

The invention will be further illustrated with reference to the following specific examples. It should be understood that these examples are for illustrative purposes only and are not intended to limit the scope of the present invention. Experimental procedures without specific conditions noted in the following examples, molecular cloning is generally performed according to conventional conditions such as Sambrook et al: conditions described in the laboratory Manual (New York: ColdSpringHarbor laboratory Press, 2002), or according to the manufacturer's recommendations. Unless otherwise indicated, percentages and parts are by weight.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. In addition, any methods and materials similar or equivalent to those described herein can be used in the practice of the present invention. The preferred embodiments and materials described herein are intended to be exemplary only.

Examples

Materials and methods

1. Protein

NCAM (Cat # A0393, Abclonal), TAZ (23306-1-AP, Proteintech), TAZ (Cat #4883S, CST), cleaved cysteine protease 3 (cleared caspase 3) (Cat # #9661, CST), TUBLIN (Cat #1699, Bioworld).

2. Cell culture

293T was purchased from ATCC and the passaged cell line was cultured in 8% FBS (Gibco) high-glucose DMEM medium (Hyclone). Mouse primary cell lines were cultured in RPMI1640 medium (Hyclone) containing 8% fbs (gibco).

3. Real-time fluorescent quantitative PCR detection

After extraction of RNA, cDNA was synthesized using a reverse transcription kit (Invitrogen, Carlsbad, Calif.) and detected using ABI 7500(Perkin Elmer Life Science, Shelton, CT). The primer sequences are as follows:

gene	Forward primer (5'-3')	Reverse primer (5'-3')
			Gapdh	ACCCAGAAGACTGTGGATGG	CACATTGGGGGTAGGAACAC
Taz	GAAGGTGATGAATCAGCCTCTG	GTTCTGAGTCGGGTGGTTCTG

Western Blot detection

Carrying out electrophoresis after cell or tissue lysis, sealing 5% milk of a PVDF membrane after electrotransfer, carrying out DAB color development when primary antibody is over night and secondary antibody is incubated for 1 hour at room temperature, carrying out X-ray film pressing, carrying out immersion in a developing solution for 5-10min, then washing with ionized water, and observing a strip.

4. Interference sequences

mouse-shTaz#1:CAGCCGAATCTCGCAATGAAT

mouse-shTaz#2:CATGAGCACAGATATGAGAT

5. Subcutaneous tumor formation of nude mice

In nude mice tumorigenesis experiments, we will 5X 10 ⁶ Individual tumor cells were inoculated subcutaneously into nude mice. Tumor size was measured every other day thereafter, and tumors were collected at 10 weeks after inoculation and analyzed for liver metastasis in nude mice.

6. Tissue section staining

Dewaxing and hydrating the tissue slices, treating the tissue slices with 3% hydrogen peroxide at room temperature for 15min, sequentially carrying out high fire treatment for 5min, unfreezing for 2min, carrying out microwave antigen retrieval at medium and low temperature for 20min, sealing with sealing liquid, standing overnight for the first time, incubating at 37 ℃ for 30min for the second time, carrying out DAB (digital audio broadcasting) color development for 5min, carrying out hematoxylin counterstaining, and dehydrating and drying. And sealing the neutral resin and observing.

Matrigel invasion assay, agarose gel cloning and anoikis assay

In the invasion experiment, 10,000 cells were seeded into 2% matrigel (BD biosciences) and photographed for 2-3 weeks after culture. In the agarose gel cloning experiment, 1 ml of 1% agarose was added to the bottom of a 6-well plate in advance, and after coagulation, 1 ml of 0.4% agarose mixed with 5,000 cell-seeded cells was added to the upper layer. After the colonies were formed, they were stained with 0.005% crystal violet and counted. In the anoikis experiment, 6 wells were prepared in advancePlates were coated with 3% low melting point agarose gel. Then 1x10 ⁶ The Non-SMC-Ctrl and Non-SMC-shTaz or SMC-Ctrl and SMC-TAZ-4SA cells are paved into a coated 6-well plate, and after 24 hours of culture, protein samples are collected, quantified and the protein expression level of the cleared caspase 3 is detected.

Example 1 significant downregulation of TAZ in highly metastatic mouse small cell lung cancer cell lines

First, with Rb1 ^L/L ,Trp53 ^L/L A series of small cell lung cancer cell lines of mice are successfully established by a small cell lung cancer mouse model. Thereafter, the nude mice were subjected to subcutaneous tumor formation experiments using these cell lines, and it was found that there was a significant difference in the metastatic ability of these cell lines (fig. 1). The cell line with high transfer capacity was named SMC (small cell cloning cancer measuring cells), and the other cell line was named Non-SMC (Non-small cell cloning cancer measuring cells).

To find the molecular mechanisms associated with small cell lung cancer metastasis, we established a network of transcription factor regulation in SMCs and Non-SMCs by performing an integrative analysis of RNA-seq and ATAC-seq data (FIG. 2, A). Gene Set Enrichment Analysis (GSEA) based on RNA-seq data showed that TAZ was significantly differentially expressed in Non-SMC and SMC (FIG. 2, B). We also later confirmed by quantitative PCR techniques that TAZ expression levels were significantly reduced in high transfer-competent SMC (fig. 2, C). These results suggest that TAZ may play an inhibitory role in the metastasis of small cell lung cancer.

Example 2 knocking down TAZ promotes metastasis of Small cell Lung cancer in mice

To verify the role of TAZ in small cell lung cancer metastasis, we knocked down TAZ in Non-SMC and then examined the effect of TAZ on its metastatic ability through a series of in vitro and in vivo experiments (fig. 3, a). In vitro experiments, we found that knocking down TAZ in Non-SMC significantly promoted tumor cell invasiveness, clonogenic capacity and anoikis resistance (fig. 3, B-D).

Next, to verify the effect of knocking down TAZ in vivo, we inoculated Non-SMC knocking down TAZ and control cells subcutaneously into nude mice. The results indicate that TAZ knockdown increased the percentage of tumorigenic liver metastases, promoting metastasis of small cell lung cancer (fig. 3, E). We performed tissue section staining and showed that these metastases expressed the molecular marker NCAM for small cell lung cancer (fig. 3, F).

Example 3 overexpression of TAZ-4SA significantly inhibits metastasis of small cell lung carcinoma in mice

We then examined the effect of TAZ by overexpressing an activating mutant of TAZ, TAZ-4SA, in a high transfer-competent SMC cell line (fig. 4, a). The results of in vitro functional experiments show that after TAZ-4SA is over-expressed, the invasion capacity, the clonogenic capacity and the anoikis resistance of SMC are all remarkably inhibited (FIG. 4, B-D).

Next, we inoculated SMC cell lines that over-expressed TAZ-4SA and control cell lines subcutaneously into nude mice. The results showed that the incidence of liver metastasis in nude mice was significantly reduced with TAZ-4SA over-expressed SMCs compared to the control group (fig. 4, E). We performed histological staining of liver tissue and showed that these metastases all expressed the molecular marker NCAM for small cell lung cancer (fig. 4, F).

Example 4 Digitoxin treatment activated TAZ significantly inhibited the metastatic potential of small cell lung cancer in mice

Firstly, the nude mice are inoculated with SMC cell line subcutaneously, when subcutaneous tumor grows to 200mm ³ On the other hand, Digitoxin (1mg/kg) treatment was started by intraperitoneal administration, and administered once every other day. By immunohistochemical staining of subcutaneous tumors, we found that Digitoxin treatment could indeed increase the expression level of TAZ in the nucleus (fig. 5, a). More importantly, Digitoxin treatment significantly inhibited hepatic metastatic capacity of SMC in nude mice (fig. 5, B). These results suggest that Digitoxin can activate TAZ in SMC, promote its entry into the nucleus, and inhibit the hepatic metastatic capacity of small cell lung cancer. The discovery provides a potential target for treating the small cell lung cancer.

Example 5, low expression levels of TAZ correlate with poor prognosis in clinical small cell lung cancer.

To analyze whether our study was clinically relevant, we collected and analyzed 101 surgical tumor samples of chinese small cell lung cancer patients by cooperation with a hospital. First, we examined the expression level of TAZ in these samples by immunohistochemical staining (fig. 6, a). By analyzing the overall survival of these patients, we found that the survival of patients with low expression of TAZ was significantly shorter than that of patients with high expression (fig. 6, B). These results indicate that TAZ functions as an oncogene inhibitor during malignant progression and metastasis of small cell lung cancer and may be a potential target for clinical treatment of small cell lung cancer.

Summary and discussion

(1) We find that TAZ may play the function of cancer suppressor gene in the malignant progression of small cell lung cancer by using small cell lung cancer cell strain derived from primary lung cancer mouse model and related biological information analysis. (2) Functional experiments prove that the TAZ can be knocked down to enhance the transfer capacity of the small cell lung cancer. In contrast, activation mutants that overexpress TAZ, or activators thereof, are effective in inhibiting the metastatic potential of small cell lung cancer. We further demonstrated that low expression levels of TAZ are associated with poor prognosis in patients analyzed from human small cell lung cancer samples. Combining the results of these experiments, our studies confirm that TAZ is an important cancer suppressor gene in small cell lung cancer, and propose that targeted activation of TAZ can be a potential strategy for diagnosis and treatment of small cell lung cancer.

Sequence listing

<110> center of outstanding innovation in molecular cell science of Chinese academy of sciences

<120> cancer targets and uses thereof

<130> 20A193

<160> 16

<170> SIPOSequenceListing 1.0

<210> 1

<211> 400

<212> PRT

<213> Homo sapiens

<400> 1

Met Asn Pro Ala Ser Ala Pro Pro Pro Leu Pro Pro Pro Gly Gln Gln

1 5 10 15

Val Ile His Val Thr Gln Asp Leu Asp Thr Asp Leu Glu Ala Leu Phe

20 25 30

Asn Ser Val Met Asn Pro Lys Pro Ser Ser Trp Arg Lys Lys Ile Leu

35 40 45

Pro Glu Ser Phe Phe Lys Glu Pro Asp Ser Gly Ser His Ser Arg Gln

50 55 60

Ser Ser Thr Asp Ser Ser Gly Gly His Pro Gly Pro Arg Leu Ala Gly

65 70 75 80

Gly Ala Gln His Val Arg Ser His Ser Ser Pro Ala Ser Leu Gln Leu

85 90 95

Gly Thr Gly Ala Gly Ala Ala Gly Ser Pro Ala Gln Gln His Ala His

100 105 110

Leu Arg Gln Gln Ser Tyr Asp Val Thr Asp Glu Leu Pro Leu Pro Pro

115 120 125

Gly Trp Glu Met Thr Phe Thr Ala Thr Gly Gln Arg Tyr Phe Leu Asn

130 135 140

His Ile Glu Lys Ile Thr Thr Trp Gln Asp Pro Arg Lys Ala Met Asn

145 150 155 160

Gln Pro Leu Asn His Met Asn Leu His Pro Ala Val Ser Ser Thr Pro

165 170 175

Val Pro Gln Arg Ser Met Ala Val Ser Gln Pro Asn Leu Val Met Asn

180 185 190

His Gln His Gln Gln Gln Met Ala Pro Ser Thr Leu Ser Gln Gln Asn

195 200 205

His Pro Thr Gln Asn Pro Pro Ala Gly Leu Met Ser Met Pro Asn Ala

210 215 220

Leu Thr Thr Gln Gln Gln Gln Gln Gln Lys Leu Arg Leu Gln Arg Ile

225 230 235 240

Gln Met Glu Arg Glu Arg Ile Arg Met Arg Gln Glu Glu Leu Met Arg

245 250 255

Gln Glu Ala Ala Leu Cys Arg Gln Leu Pro Met Glu Ala Glu Thr Leu

260 265 270

Ala Pro Val Gln Ala Ala Val Asn Pro Pro Thr Met Thr Pro Asp Met

275 280 285

Arg Ser Ile Thr Asn Asn Ser Ser Asp Pro Phe Leu Asn Gly Gly Pro

290 295 300

Tyr His Ser Arg Glu Gln Ser Thr Asp Ser Gly Leu Gly Leu Gly Cys

305 310 315 320

Tyr Ser Val Pro Thr Thr Pro Glu Asp Phe Leu Ser Asn Val Asp Glu

325 330 335

Met Asp Thr Gly Glu Asn Ala Gly Gln Thr Pro Met Asn Ile Asn Pro

340 345 350

Gln Gln Thr Arg Phe Pro Asp Phe Leu Asp Cys Leu Pro Gly Thr Asn

355 360 365

Val Asp Leu Gly Thr Leu Glu Ser Glu Asp Leu Ile Pro Leu Phe Asn

370 375 380

Asp Val Glu Ser Ala Leu Asn Lys Ser Glu Pro Phe Leu Thr Trp Leu

385 390 395 400

<210> 2

<211> 452

<212> PRT

<213> Mus musculus

<400> 2

Met His Asn Ser Thr Ala Pro Leu Ser Ala Arg Leu Phe Pro Lys Gly

1 5 10 15

Gly Ser Leu Leu Gln Thr Leu Phe Met Gly Gln Ser Gly Ser Arg Gly

20 25 30

Gly Cys Ala Arg Leu Arg Leu Leu Cys Arg Leu Leu Ala Gln Trp Glu

35 40 45

Arg Pro Arg Pro Val Pro Gly Ile Lys Met Asn Pro Ser Ser Val Pro

50 55 60

His Pro Leu Pro Pro Pro Gly Gln Gln Val Ile His Val Thr Gln Asp

65 70 75 80

Leu Asp Thr Asp Leu Glu Ala Leu Phe Asn Ser Val Met Asn Pro Lys

85 90 95

Pro Ser Ser Trp Arg Lys Lys Ile Leu Pro Glu Ser Phe Phe Lys Glu

100 105 110

Pro Asp Ser Gly Ser His Ser Arg Gln Ser Ser Thr Asp Ser Ser Gly

115 120 125

Gly His Pro Gly Pro Arg Leu Ala Gly Gly Ala Gln His Val Arg Ser

130 135 140

His Ser Ser Pro Ala Ser Leu Gln Leu Gly Thr Gly Ala Gly Ala Ala

145 150 155 160

Gly Gly Pro Ala Gln Gln His Ala His Leu Arg Gln Gln Ser Tyr Asp

165 170 175

Val Thr Asp Glu Leu Pro Leu Pro Pro Gly Trp Glu Met Thr Phe Thr

180 185 190

Ala Thr Gly Gln Arg Tyr Phe Leu Asn His Ile Glu Lys Ile Thr Thr

195 200 205

Trp Gln Asp Pro Arg Lys Val Met Asn Gln Pro Leu Asn His Val Asn

210 215 220

Leu His Pro Ser Ile Thr Ser Thr Ser Val Pro Gln Arg Ser Met Ala

225 230 235 240

Val Ser Gln Pro Asn Leu Ala Met Asn His Gln His Gln Gln Val Val

245 250 255

Ala Thr Ser Leu Ser Pro Gln Asn His Pro Thr Gln Asn Gln Pro Thr

260 265 270

Gly Leu Met Ser Val Pro Asn Ala Leu Thr Thr Gln Gln Gln Gln Gln

275 280 285

Gln Lys Leu Arg Leu Gln Arg Ile Gln Met Glu Arg Glu Arg Ile Arg

290 295 300

Met Arg Gln Glu Glu Leu Met Arg Gln Glu Ala Ala Leu Cys Arg Gln

305 310 315 320

Leu Pro Met Glu Thr Glu Thr Met Ala Pro Val Asn Thr Pro Ala Met

325 330 335

Ser Thr Asp Met Arg Ser Val Thr Asn Ser Ser Ser Asp Pro Phe Leu

340 345 350

Asn Gly Gly Pro Tyr His Ser Arg Glu Gln Ser Thr Asp Ser Gly Leu

355 360 365

Gly Leu Gly Cys Tyr Ser Val Pro Thr Thr Pro Glu Asp Phe Leu Ser

370 375 380

Asn Met Asp Glu Met Asp Thr Gly Glu Asn Ser Gly Gln Thr Pro Met

385 390 395 400

Thr Val Asn Pro Gln Gln Thr Arg Phe Pro Asp Phe Leu Asp Cys Leu

405 410 415

Pro Gly Thr Asn Val Asp Leu Gly Thr Leu Glu Ser Glu Asp Leu Ile

420 425 430

Pro Leu Phe Asn Asp Val Glu Ser Ala Leu Asn Lys Ser Glu Pro Phe

435 440 445

Leu Thr Trp Leu

450

<210> 3

<211> 395

<212> PRT

<213> Mus musculus

<400> 3

Met Asn Pro Ser Ser Val Pro His Pro Leu Pro Pro Pro Gly Gln Gln

1 5 10 15

Val Ile His Val Thr Gln Asp Leu Asp Thr Asp Leu Glu Ala Leu Phe

20 25 30

Asn Ser Val Met Asn Pro Lys Pro Ser Ser Trp Arg Lys Lys Ile Leu

35 40 45

Pro Glu Ser Phe Phe Lys Glu Pro Asp Ser Gly Ser His Ser Arg Gln

50 55 60

Ser Ser Thr Asp Ser Ser Gly Gly His Pro Gly Pro Arg Leu Ala Gly

65 70 75 80

Gly Ala Gln His Val Arg Ser His Ser Ser Pro Ala Ser Leu Gln Leu

85 90 95

Gly Thr Gly Ala Gly Ala Ala Gly Gly Pro Ala Gln Gln His Ala His

100 105 110

Leu Arg Gln Gln Ser Tyr Asp Val Thr Asp Glu Leu Pro Leu Pro Pro

115 120 125

Gly Trp Glu Met Thr Phe Thr Ala Thr Gly Gln Arg Tyr Phe Leu Asn

130 135 140

His Ile Glu Lys Ile Thr Thr Trp Gln Asp Pro Arg Lys Val Met Asn

145 150 155 160

Gln Pro Leu Asn His Val Asn Leu His Pro Ser Ile Thr Ser Thr Ser

165 170 175

Val Pro Gln Arg Ser Met Ala Val Ser Gln Pro Asn Leu Ala Met Asn

180 185 190

His Gln His Gln Gln Val Val Ala Thr Ser Leu Ser Pro Gln Asn His

195 200 205

Pro Thr Gln Asn Gln Pro Thr Gly Leu Met Ser Val Pro Asn Ala Leu

210 215 220

Thr Thr Gln Gln Gln Gln Gln Gln Lys Leu Arg Leu Gln Arg Ile Gln

225 230 235 240

Met Glu Arg Glu Arg Ile Arg Met Arg Gln Glu Glu Leu Met Arg Gln

245 250 255

Glu Ala Ala Leu Cys Arg Gln Leu Pro Met Glu Thr Glu Thr Met Ala

260 265 270

Pro Val Asn Thr Pro Ala Met Ser Thr Asp Met Arg Ser Val Thr Asn

275 280 285

Ser Ser Ser Asp Pro Phe Leu Asn Gly Gly Pro Tyr His Ser Arg Glu

290 295 300

Gln Ser Thr Asp Ser Gly Leu Gly Leu Gly Cys Tyr Ser Val Pro Thr

305 310 315 320

Thr Pro Glu Asp Phe Leu Ser Asn Met Asp Glu Met Asp Thr Gly Glu

325 330 335

Asn Ser Gly Gln Thr Pro Met Thr Val Asn Pro Gln Gln Thr Arg Phe

340 345 350

Pro Asp Phe Leu Asp Cys Leu Pro Gly Thr Asn Val Asp Leu Gly Thr

355 360 365

Leu Glu Ser Glu Asp Leu Ile Pro Leu Phe Asn Asp Val Glu Ser Ala

370 375 380

Leu Asn Lys Ser Glu Pro Phe Leu Thr Trp Leu

385 390 395

<210> 4

<211> 400

<212> PRT

<213> Artificial Sequence

<400> 4

Met Asn Pro Ala Ser Ala Pro Pro Pro Leu Pro Pro Pro Gly Gln Gln

1 5 10 15

Val Ile His Val Thr Gln Asp Leu Asp Thr Asp Leu Glu Ala Leu Phe

20 25 30

Asn Ser Val Met Asn Pro Lys Pro Ser Ser Trp Arg Lys Lys Ile Leu

35 40 45

Pro Glu Ser Phe Phe Lys Glu Pro Asp Ser Gly Ser His Ser Arg Gln

50 55 60

Ser Ala Thr Asp Ser Ser Gly Gly His Pro Gly Pro Arg Leu Ala Gly

65 70 75 80

Gly Ala Gln His Val Arg Ser His Ala Ser Pro Ala Ser Leu Gln Leu

85 90 95

Gly Thr Gly Ala Gly Ala Ala Gly Ser Pro Ala Gln Gln His Ala His

100 105 110

Leu Arg Gln Gln Ala Tyr Asp Val Thr Asp Glu Leu Pro Leu Pro Pro

115 120 125

Gly Trp Glu Met Thr Phe Thr Ala Thr Gly Gln Arg Tyr Phe Leu Asn

130 135 140

His Ile Glu Lys Ile Thr Thr Trp Gln Asp Pro Arg Lys Ala Met Asn

145 150 155 160

Gln Pro Leu Asn His Met Asn Leu His Pro Ala Val Ser Ser Thr Pro

165 170 175

Val Pro Gln Arg Ser Met Ala Val Ser Gln Pro Asn Leu Val Met Asn

180 185 190

His Gln His Gln Gln Gln Met Ala Pro Ser Thr Leu Ser Gln Gln Asn

195 200 205

His Pro Thr Gln Asn Pro Pro Ala Gly Leu Met Ser Met Pro Asn Ala

210 215 220

Leu Thr Thr Gln Gln Gln Gln Gln Gln Lys Leu Arg Leu Gln Arg Ile

225 230 235 240

Gln Met Glu Arg Glu Arg Ile Arg Met Arg Gln Glu Glu Leu Met Arg

245 250 255

Gln Glu Ala Ala Leu Cys Arg Gln Leu Pro Met Glu Ala Glu Thr Leu

260 265 270

Ala Pro Val Gln Ala Ala Val Asn Pro Pro Thr Met Thr Pro Asp Met

275 280 285

Arg Ser Ile Thr Asn Asn Ser Ser Asp Pro Phe Leu Asn Gly Gly Pro

290 295 300

Tyr His Ser Arg Glu Gln Ala Thr Asp Ser Gly Leu Gly Leu Gly Cys

305 310 315 320

Tyr Ser Val Pro Thr Thr Pro Glu Asp Phe Leu Ser Asn Val Asp Glu

325 330 335

Met Asp Thr Gly Glu Asn Ala Gly Gln Thr Pro Met Asn Ile Asn Pro

340 345 350

Gln Gln Thr Arg Phe Pro Asp Phe Leu Asp Cys Leu Pro Gly Thr Asn

355 360 365

Val Asp Leu Gly Thr Leu Glu Ser Glu Asp Leu Ile Pro Leu Phe Asn

370 375 380

Asp Val Glu Ser Ala Leu Asn Lys Ser Glu Pro Phe Leu Thr Trp Leu

385 390 395 400

<210> 5

<211> 400

<212> PRT

<213> Artificial Sequence

<400> 5

Met Asn Pro Ala Ser Ala Pro Pro Pro Leu Pro Pro Pro Gly Gln Gln

1 5 10 15

Val Ile His Val Thr Gln Asp Leu Asp Thr Asp Leu Glu Ala Leu Phe

20 25 30

Asn Ser Val Met Asn Pro Lys Pro Ser Ser Trp Arg Lys Lys Ile Leu

35 40 45

Pro Glu Ser Phe Phe Lys Glu Pro Asp Ser Gly Ser His Ser Arg Gln

50 55 60

Ser Ala Thr Asp Ser Ser Gly Gly His Pro Gly Pro Arg Leu Ala Gly

65 70 75 80

Gly Ala Gln His Val Arg Ser His Ser Ser Pro Ala Ser Leu Gln Leu

85 90 95

Gly Thr Gly Ala Gly Ala Ala Gly Ser Pro Ala Gln Gln His Ala His

100 105 110

Leu Arg Gln Gln Ser Tyr Asp Val Thr Asp Glu Leu Pro Leu Pro Pro

115 120 125

Gly Trp Glu Met Thr Phe Thr Ala Thr Gly Gln Arg Tyr Phe Leu Asn

130 135 140

His Ile Glu Lys Ile Thr Thr Trp Gln Asp Pro Arg Lys Ala Met Asn

145 150 155 160

Gln Pro Leu Asn His Met Asn Leu His Pro Ala Val Ser Ser Thr Pro

165 170 175

Val Pro Gln Arg Ser Met Ala Val Ser Gln Pro Asn Leu Val Met Asn

180 185 190

His Gln His Gln Gln Gln Met Ala Pro Ser Thr Leu Ser Gln Gln Asn

195 200 205

His Pro Thr Gln Asn Pro Pro Ala Gly Leu Met Ser Met Pro Asn Ala

210 215 220

Leu Thr Thr Gln Gln Gln Gln Gln Gln Lys Leu Arg Leu Gln Arg Ile

225 230 235 240

Gln Met Glu Arg Glu Arg Ile Arg Met Arg Gln Glu Glu Leu Met Arg

245 250 255

Gln Glu Ala Ala Leu Cys Arg Gln Leu Pro Met Glu Ala Glu Thr Leu

260 265 270

Ala Pro Val Gln Ala Ala Val Asn Pro Pro Thr Met Thr Pro Asp Met

275 280 285

Arg Ser Ile Thr Asn Asn Ser Ser Asp Pro Phe Leu Asn Gly Gly Pro

290 295 300

Tyr His Ser Arg Glu Gln Ser Thr Asp Ser Gly Leu Gly Leu Gly Cys

305 310 315 320

Tyr Ser Val Pro Thr Thr Pro Glu Asp Phe Leu Ser Asn Val Asp Glu

325 330 335

Met Asp Thr Gly Glu Asn Ala Gly Gln Thr Pro Met Asn Ile Asn Pro

340 345 350

Gln Gln Thr Arg Phe Pro Asp Phe Leu Asp Cys Leu Pro Gly Thr Asn

355 360 365

Val Asp Leu Gly Thr Leu Glu Ser Glu Asp Leu Ile Pro Leu Phe Asn

370 375 380

Asp Val Glu Ser Ala Leu Asn Lys Ser Glu Pro Phe Leu Thr Trp Leu

385 390 395 400

<210> 6

<211> 400

<212> PRT

<213> Artificial Sequence

<400> 6

Met Asn Pro Ala Ser Ala Pro Pro Pro Leu Pro Pro Pro Gly Gln Gln

1 5 10 15

Val Ile His Val Thr Gln Asp Leu Asp Thr Asp Leu Glu Ala Leu Phe

20 25 30

Asn Ser Val Met Asn Pro Lys Pro Ser Ser Trp Arg Lys Lys Ile Leu

35 40 45

Pro Glu Ser Phe Phe Lys Glu Pro Asp Ser Gly Ser His Ser Arg Gln

50 55 60

Ser Ser Thr Asp Ser Ser Gly Gly His Pro Gly Pro Arg Leu Ala Gly

65 70 75 80

Gly Ala Gln His Val Arg Ser His Ala Ser Pro Ala Ser Leu Gln Leu

85 90 95

Gly Thr Gly Ala Gly Ala Ala Gly Ser Pro Ala Gln Gln His Ala His

100 105 110

Leu Arg Gln Gln Ser Tyr Asp Val Thr Asp Glu Leu Pro Leu Pro Pro

115 120 125

Gly Trp Glu Met Thr Phe Thr Ala Thr Gly Gln Arg Tyr Phe Leu Asn

130 135 140

His Ile Glu Lys Ile Thr Thr Trp Gln Asp Pro Arg Lys Ala Met Asn

145 150 155 160

Gln Pro Leu Asn His Met Asn Leu His Pro Ala Val Ser Ser Thr Pro

165 170 175

Val Pro Gln Arg Ser Met Ala Val Ser Gln Pro Asn Leu Val Met Asn

180 185 190

His Gln His Gln Gln Gln Met Ala Pro Ser Thr Leu Ser Gln Gln Asn

195 200 205

His Pro Thr Gln Asn Pro Pro Ala Gly Leu Met Ser Met Pro Asn Ala

210 215 220

Leu Thr Thr Gln Gln Gln Gln Gln Gln Lys Leu Arg Leu Gln Arg Ile

225 230 235 240

Gln Met Glu Arg Glu Arg Ile Arg Met Arg Gln Glu Glu Leu Met Arg

245 250 255

Gln Glu Ala Ala Leu Cys Arg Gln Leu Pro Met Glu Ala Glu Thr Leu

260 265 270

Ala Pro Val Gln Ala Ala Val Asn Pro Pro Thr Met Thr Pro Asp Met

275 280 285

Arg Ser Ile Thr Asn Asn Ser Ser Asp Pro Phe Leu Asn Gly Gly Pro

290 295 300

Tyr His Ser Arg Glu Gln Ser Thr Asp Ser Gly Leu Gly Leu Gly Cys

305 310 315 320

Tyr Ser Val Pro Thr Thr Pro Glu Asp Phe Leu Ser Asn Val Asp Glu

325 330 335

Met Asp Thr Gly Glu Asn Ala Gly Gln Thr Pro Met Asn Ile Asn Pro

340 345 350

Gln Gln Thr Arg Phe Pro Asp Phe Leu Asp Cys Leu Pro Gly Thr Asn

355 360 365

Val Asp Leu Gly Thr Leu Glu Ser Glu Asp Leu Ile Pro Leu Phe Asn

370 375 380

Asp Val Glu Ser Ala Leu Asn Lys Ser Glu Pro Phe Leu Thr Trp Leu

385 390 395 400

<210> 7

<211> 400

<212> PRT

<213> Artificial Sequence

<400> 7

Met Asn Pro Ala Ser Ala Pro Pro Pro Leu Pro Pro Pro Gly Gln Gln

1 5 10 15

Val Ile His Val Thr Gln Asp Leu Asp Thr Asp Leu Glu Ala Leu Phe

20 25 30

Asn Ser Val Met Asn Pro Lys Pro Ser Ser Trp Arg Lys Lys Ile Leu

35 40 45

Pro Glu Ser Phe Phe Lys Glu Pro Asp Ser Gly Ser His Ser Arg Gln

50 55 60

Ser Ser Thr Asp Ser Ser Gly Gly His Pro Gly Pro Arg Leu Ala Gly

65 70 75 80

Gly Ala Gln His Val Arg Ser His Ser Ser Pro Ala Ser Leu Gln Leu

85 90 95

Gly Thr Gly Ala Gly Ala Ala Gly Ser Pro Ala Gln Gln His Ala His

100 105 110

Leu Arg Gln Gln Ala Tyr Asp Val Thr Asp Glu Leu Pro Leu Pro Pro

115 120 125

Gly Trp Glu Met Thr Phe Thr Ala Thr Gly Gln Arg Tyr Phe Leu Asn

130 135 140

His Ile Glu Lys Ile Thr Thr Trp Gln Asp Pro Arg Lys Ala Met Asn

145 150 155 160

Gln Pro Leu Asn His Met Asn Leu His Pro Ala Val Ser Ser Thr Pro

165 170 175

Val Pro Gln Arg Ser Met Ala Val Ser Gln Pro Asn Leu Val Met Asn

180 185 190

His Gln His Gln Gln Gln Met Ala Pro Ser Thr Leu Ser Gln Gln Asn

195 200 205

His Pro Thr Gln Asn Pro Pro Ala Gly Leu Met Ser Met Pro Asn Ala

210 215 220

Leu Thr Thr Gln Gln Gln Gln Gln Gln Lys Leu Arg Leu Gln Arg Ile

225 230 235 240

Gln Met Glu Arg Glu Arg Ile Arg Met Arg Gln Glu Glu Leu Met Arg

245 250 255

Gln Glu Ala Ala Leu Cys Arg Gln Leu Pro Met Glu Ala Glu Thr Leu

260 265 270

Ala Pro Val Gln Ala Ala Val Asn Pro Pro Thr Met Thr Pro Asp Met

275 280 285

Arg Ser Ile Thr Asn Asn Ser Ser Asp Pro Phe Leu Asn Gly Gly Pro

290 295 300

Tyr His Ser Arg Glu Gln Ser Thr Asp Ser Gly Leu Gly Leu Gly Cys

305 310 315 320

Tyr Ser Val Pro Thr Thr Pro Glu Asp Phe Leu Ser Asn Val Asp Glu

325 330 335

Met Asp Thr Gly Glu Asn Ala Gly Gln Thr Pro Met Asn Ile Asn Pro

340 345 350

Gln Gln Thr Arg Phe Pro Asp Phe Leu Asp Cys Leu Pro Gly Thr Asn

355 360 365

Val Asp Leu Gly Thr Leu Glu Ser Glu Asp Leu Ile Pro Leu Phe Asn

370 375 380

Asp Val Glu Ser Ala Leu Asn Lys Ser Glu Pro Phe Leu Thr Trp Leu

385 390 395 400

<210> 8

<211> 400

<212> PRT

<213> Artificial Sequence

<400> 8

Met Asn Pro Ala Ser Ala Pro Pro Pro Leu Pro Pro Pro Gly Gln Gln

1 5 10 15

Val Ile His Val Thr Gln Asp Leu Asp Thr Asp Leu Glu Ala Leu Phe

20 25 30

Asn Ser Val Met Asn Pro Lys Pro Ser Ser Trp Arg Lys Lys Ile Leu

35 40 45

Pro Glu Ser Phe Phe Lys Glu Pro Asp Ser Gly Ser His Ser Arg Gln

50 55 60

Ser Ser Thr Asp Ser Ser Gly Gly His Pro Gly Pro Arg Leu Ala Gly

65 70 75 80

Gly Ala Gln His Val Arg Ser His Ser Ser Pro Ala Ser Leu Gln Leu

85 90 95

Gly Thr Gly Ala Gly Ala Ala Gly Ser Pro Ala Gln Gln His Ala His

100 105 110

Leu Arg Gln Gln Ser Tyr Asp Val Thr Asp Glu Leu Pro Leu Pro Pro

115 120 125

Gly Trp Glu Met Thr Phe Thr Ala Thr Gly Gln Arg Tyr Phe Leu Asn

130 135 140

His Ile Glu Lys Ile Thr Thr Trp Gln Asp Pro Arg Lys Ala Met Asn

145 150 155 160

Gln Pro Leu Asn His Met Asn Leu His Pro Ala Val Ser Ser Thr Pro

165 170 175

Val Pro Gln Arg Ser Met Ala Val Ser Gln Pro Asn Leu Val Met Asn

180 185 190

His Gln His Gln Gln Gln Met Ala Pro Ser Thr Leu Ser Gln Gln Asn

195 200 205

His Pro Thr Gln Asn Pro Pro Ala Gly Leu Met Ser Met Pro Asn Ala

210 215 220

Leu Thr Thr Gln Gln Gln Gln Gln Gln Lys Leu Arg Leu Gln Arg Ile

225 230 235 240

Gln Met Glu Arg Glu Arg Ile Arg Met Arg Gln Glu Glu Leu Met Arg

245 250 255

Gln Glu Ala Ala Leu Cys Arg Gln Leu Pro Met Glu Ala Glu Thr Leu

260 265 270

Ala Pro Val Gln Ala Ala Val Asn Pro Pro Thr Met Thr Pro Asp Met

275 280 285

Arg Ser Ile Thr Asn Asn Ser Ser Asp Pro Phe Leu Asn Gly Gly Pro

290 295 300

Tyr His Ser Arg Glu Gln Ala Thr Asp Ser Gly Leu Gly Leu Gly Cys

305 310 315 320

Tyr Ser Val Pro Thr Thr Pro Glu Asp Phe Leu Ser Asn Val Asp Glu

325 330 335

Met Asp Thr Gly Glu Asn Ala Gly Gln Thr Pro Met Asn Ile Asn Pro

340 345 350

Gln Gln Thr Arg Phe Pro Asp Phe Leu Asp Cys Leu Pro Gly Thr Asn

355 360 365

Val Asp Leu Gly Thr Leu Glu Ser Glu Asp Leu Ile Pro Leu Phe Asn

370 375 380

Asp Val Glu Ser Ala Leu Asn Lys Ser Glu Pro Phe Leu Thr Trp Leu

385 390 395 400

<210> 9

<211> 5030

<212> DNA

<213> Homo sapiens

<400> 9

gacacactcc tctacaacac cagagactcc caaacacaag gccttatatt gactcatttc 60

agctcacatc ctggcgactc tcaagagaga aacctcagag tgactaaaat ctccataatg 120

agaagacatg tacattcagt atctattttg gcattttccc caatacatct ctgctcatct 180

gactcttatc ttggcatctg cttcctggtg gatctgaact gacccataag ccacgcttac 240

tagtgatttt ccagaagatg aatccggcct cggcgccccc tccgctcccg ccgcctgggc 300

agcaagtgat ccacgtcacg caggacctag acacagacct cgaagccctc ttcaactctg 360

tcatgaatcc gaagcctagc tcgtggcgga agaagatcct gccggagtct ttctttaagg 420

agcctgattc gggctcgcac tcgcgccagt ccagcaccga ctcgtcgggc ggccacccgg 480

ggcctcgact ggctgggggt gcccagcatg tccgctcgca ctcgtcgccc gcgtccctgc 540

agctgggcac cggcgcgggt gctgcgggta gccccgcgca gcagcacgcg cacctccgcc 600

agcagtccta cgacgtgacc gacgagctgc cactgccccc gggctgggag atgaccttca 660

cggccactgg ccagaggtac ttcctcaatc acatagaaaa aatcaccaca tggcaagacc 720

ctaggaaggc gatgaatcag cctctgaatc atatgaacct ccaccctgcc gtcagttcca 780

caccagtgcc tcagaggtcc atggcagtat cccagccaaa tctcgtgatg aatcaccaac 840

accagcagca gatggccccc agtaccctga gccagcagaa ccaccccact cagaacccac 900

ccgcagggct catgagtatg cccaatgcgc tgaccactca gcagcagcag cagcagaaac 960

tgcggcttca gagaatccag atggagagag aaaggattcg aatgcgccaa gaggagctca 1020

tgaggcagga agctgccctc tgtcgacagc tccccatgga agctgagact cttgccccag 1080

ttcaggctgc tgtcaaccca cccacgatga ccccagacat gagatccatc actaataata 1140

gctcagatcc tttcctcaat ggagggccat atcattcgag ggagcagagc actgacagtg 1200

gcctggggtt agggtgctac agtgtcccca caactccgga ggacttcctc agcaatgtgg 1260

atgagatgga tacaggagaa aacgcaggac aaacacccat gaacatcaat ccccaacaga 1320

cccgtttccc tgatttcctt gactgtcttc caggaacaaa cgttgactta ggaactttgg 1380

aatctgaaga cctgatcccc ctcttcaatg atgtagagtc tgctctgaac aaaagtgagc 1440

cctttctaac ctggctgtaa tcactaccat tgtaacttgg atgtagccat gaccttacat 1500

ttcctgggcc tcttggaaaa agtgatggag cagagcaagt ctgcaggtgc accacttccc 1560

gcctccatga ctcgtgctcc ctccttttta tgttgccagt ttaatcattg cctggttttg 1620

attgagagta acttaagtta aacataaata aatattctat tttcattttc tgcaagcctg 1680

cgttcttgtg acagattata cagaattgtg tctgcaggat tgattatgca gaatactttt 1740

ctctttcttc tctgctgccc catggctaag ctttatgggt gttaattgaa atttatacac 1800

caattgattt taaaccataa aaagctgacc acaggcagtt acttctgagg gcatcttggt 1860

ccaggaaatg tgcacaaaat tcgacctgat ttacagtttc aaaaactgta ttgatgacag 1920

tagtaccaaa tgctttaaaa actatttaac ttgagcttta aaaatcattg tatggatagt 1980

aaaattctac tgtatggaat acaatgtaat tttgaatcca tgctggctct gatggctctt 2040

attagtctgt atttataaag gcacacagtc ctattgtagc ttatctttcg ttattttact 2100

gcagagcatc tagacaactt agtccctcca gcgggaaagt agcagcagca gcattagtca 2160

caggtcttac actacagatc ttgtgaaaga gaccagtttg gtactaatta tgagcatttt 2220

attcaaacaa aagtttttga aatattacaa ctggggattt aaaaaattgc agcttagaat 2280

ctgatggttt ttttttttct tgatgttgtt tgtttgtttt tgagatcgag ttttgctctt 2340

gttgtccagg ctggaatgca atggcacaat ctcggctcac tgcaacctct gccttctggg 2400

ttcaagcgat tctcctgcct tagcctcccg agtagctggg attacaggca cctgccacca 2460

cgtccggcta attttttgta ttttgagtag agacggggtt tcaccataat ggtcaggctg 2520

ttctcaaact cctgatctca ggtgatccac ccatctcggc ctcccaaagt gctgggatta 2580

ctggcgtgag ccaccgcacc cggccttgat gtttatttta taaagcactg taattttgta 2640

gctgatgaca aaaggcagcc aaatgttttt gataaatcag tggcaactgt atttttgtct 2700

tttgaaataa ctctgaaaac atcaggacaa catagatttc aacctgatag cacaccacac 2760

acagtgagct gttgcttttt aaattctgaa gccttgtcag gtttgcttcc tagatttcaa 2820

gtgtttaaaa taattctatc tatgaaactg aaggatgaag cagatctctg actgacatgt 2880

aaaaaaaaat gccctttgag ggtgtatggt ggagataaat gtttctgaat tcagtaaaat 2940

tgattcctaa gtatattatc ctaatcctgt ttgctacagt tggtataaaa aggcatgaaa 3000

tatgtattca atacctctta tgtaaccaaa accattttta attagctttt aaggactgag 3060

agagcatcat gttcaactgg catgcagtct gcctgcattg ccaatgaagt cctcaactgt 3120

ttaatatttt gaactaatat tatttataat ctatgaattt aatctttttt gaaagacttt 3180

aataatttga gtctctgaga ggatactttc aatttccatg ggggacttat ttgttgggga 3240

tcttaaataa gattcctttt gatctaccgg aatatacatg tacagagtac attggatcat 3300

gttggaaaga aggcaagtga aaaggtcaga gatgaagtag caaagttatg gaatatcgtg 3360

gaaaggatac tagttgtgaa atggaaagag acaagttata gtaccccaaa agcaaaacaa 3420

gcaggagatg caagagatgc cccaaaagga caaagcaaca attttctgtt gccaccttta 3480

taccggaaga ctctgttgta gaagaaaaga aggctttggt gcaccttatg tgggaggagg 3540

aggggcaggg catgctgatg ctgagcgtac aggcagacaa gagcgtagcc tgctgttgcc 3600

tccatcacta tgaaatgact tattttacct gaaggaccca tggtttatgt tcctctaatt 3660

cctttcactc tccctaagcc ctctgagaga gatgaagata gatgatttta ttgctactaa 3720

attgaaggga gcactatttc tttttgtctt ttgttagcaa aaaattgcaa aaagaattgt 3780

acattcttgc taaaaataaa taaataaata aaaaattaaa aaaacaaggg acctaacaaa 3840

actcagcagt gttactgtat ttttaaaaaa tatttttata gactcatttt caggttatta 3900

aatgtaagag aaacagatac ccctcttttt taaagtaggt aaatcattga tgatttatat 3960

taccaatttt tagaagtaat tttctagtaa gcttgtggca tcagaaaata ctagaagatt 4020

tttttagtta aattagttag aacatttatg aatgaatata ataaatattt tttcagaata 4080

aaatatggac cctttgtgtt tactaataga taaagccaga tataattttt tgtttttaag 4140

gccacaaaat atggcctttg ttaaagaaca ctaaagttag aaatctaaag ttagagcaac 4200

tttttaatgg ctatttccta ttattgtaag tgttaaaacc cctgcagaat tcttgataag 4260

gtgctattta tactatattt cttattataa gataactgtc tttagtcttc ttagtactag 4320

tctttttagt actaaatcaa tcagtaaaca tcatcatttc accccaaaat tttgtcacag 4380

aaaaggcgta tcaaatgaaa aataatttca gagatctttc tttcaagata ttttttcctg 4440

ataaaataca ttgtcttgaa gtaaatacat tgtcaaaacc taattgcaat tctgttaaat 4500

ctaagtaatt tttagacagt gtttcaccgt attatttagg atgtgaaatg ccatttcttt 4560

cactgattac accatataca ggaaacaggt aaaacagtga aaactttatt gtgctggttg 4620

atgccaactt ggttgaaaag ctctctgcag aagaagtgat ctagactgac agaagtgttg 4680

ctaattacaa gttgtgttct catgacgtaa ttagaaagta acttctcaaa gtacaacttt 4740

tatgaaaaaa ataagctgtt aaaaaaagga aatcgtaggt taatttaatt gggaaaatgg 4800

gcaattgaca gagaccattt tcctaacaca tatatgtgct agtactttaa ctttttaaaa 4860

ttttacttct acgttttgta atataaaaat ttctatttta agtttagaat gttatacgta 4920

ccgaaagtat gcagccaaat cgatcagatc aaaccatttt acctggagtt tggtactggt 4980

ttttacttct ctgaatctgt ataagaaaaa taaagacaat tgaacttcca 5030

<210> 10

<211> 1200

<212> DNA

<213> Artificial Sequence

<400> 10

atgaacccgg cgagcgcgcc gccgccgctg ccgccgccgg gccagcaggt gattcatgtg 60

acccaggatc tggataccga tctggaagcg ctgtttaaca gcgtgatgaa cccgaaaccg 120

agcagctggc gcaaaaaaat tctgccggaa agctttttta aagaaccgga tagcggcagc 180

catagccgcc agagcgcgac cgatagcagc ggcggccatc cgggcccgcg cctggcgggc 240

ggcgcgcagc atgtgcgcag ccatgcgagc ccggcgagcc tgcagctggg caccggcgcg 300

ggcgcggcgg gcagcccggc gcagcagcat gcgcatctgc gccagcaggc gtatgatgtg 360

accgatgaac tgccgctgcc gccgggctgg gaaatgacct ttaccgcgac cggccagcgc 420

tattttctga accatattga aaaaattacc acctggcagg atccgcgcaa agcgatgaac 480

cagccgctga accatatgaa cctgcatccg gcggtgagca gcaccccggt gccgcagcgc 540

agcatggcgg tgagccagcc gaacctggtg atgaaccatc agcatcagca gcagatggcg 600

ccgagcaccc tgagccagca gaaccatccg acccagaacc cgccggcggg cctgatgagc 660

atgccgaacg cgctgaccac ccagcagcag cagcagcaga aactgcgcct gcagcgcatt 720

cagatggaac gcgaacgcat tcgcatgcgc caggaagaac tgatgcgcca ggaagcggcg 780

ctgtgccgcc agctgccgat ggaagcggaa accctggcgc cggtgcaggc ggcggtgaac 840

ccgccgacca tgaccccgga tatgcgcagc attaccaaca acagcagcga tccgtttctg 900

aacggcggcc cgtatcatag ccgcgaacag gcgaccgata gcggcctggg cctgggctgc 960

tatagcgtgc cgaccacccc ggaagatttt ctgagcaacg tggatgaaat ggataccggc 1020

gaaaacgcgg gccagacccc gatgaacatt aacccgcagc agacccgctt tccggatttt 1080

ctggattgcc tgccgggcac caacgtggat ctgggcaccc tggaaagcga agatctgatt 1140

ccgctgttta acgatgtgga aagcgcgctg aacaaaagcg aaccgtttct gacctggctg 1200

<210> 11

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 11

acccagaaga ctgtggatgg 20

<210> 12

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 12

cacattgggg gtaggaacac 20

<210> 13

<211> 22

<212> DNA

<213> Artificial Sequence

<400> 13

gaaggtgatg aatcagcctc tg 22

<210> 14

<211> 21

<212> DNA

<213> Artificial Sequence

<400> 14

gttctgagtc gggtggttct g 21

<210> 15

<211> 21

<212> DNA

<213> Artificial Sequence

<400> 15

cagccgaatc tcgcaatgaa t 21

<210> 16

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 16

catgagcaca gatatgagat 20

Claims

1. An application of the reagent for up-regulating the expression and/or activity of WWTR1 gene in preparing the medicines for preventing and treating cancer, suppressing the growth of tumor cells, suppressing the invasion power of tumor cells, suppressing the clonogenic power of tumor cells and suppressing the anti-anoikis power of tumor cells,

preferably, the first and second electrodes are formed of a metal,

the cancer is a WWTR1(TAZ) -mediated cancer, and/or

The agent that upregulates the expression and/or activity of WWTR1 gene is selected from the group consisting of:

(1) WWTR1 gene or WWTR1 activating variant gene,

(2) the protein encoded by the protein of (1),

(3) a nucleic acid construct comprising the nucleic acid construct of (1),

(4) a promoter of expression and/or activity of WWTR1,

more preferably still, the first and second liquid crystal compositions are,

the WWTR1 gene is derived from a mammal, and/or,

the nucleic acid construct is an expression vector or an integration vector.

2. The use according to claim 1,

the amino acid sequence of the encoded protein of the WWTR1 gene is selected from the group consisting of:

(a) a polypeptide having a sequence as set forth in any one of SEQ ID NOs 1-3;

(b) 1-3 through one or more amino acid residue substitution, deletion or addition, and has (a) polypeptide function;

(c) a polypeptide having more than 90% homology with the polypeptide sequence of (a) and having the function of the polypeptide of (a), and/or

The amino acid sequence of the encoded protein of the WWTR1 activating variant gene is selected from the group consisting of:

(i) a polypeptide having a sequence as set forth in any one of SEQ ID NOs 4-8;

(ii) a polypeptide which is formed by substituting, deleting or adding one or more amino acid residues of a sequence shown in any one of SEQ ID NO 4-8 and has (i) a polypeptide function; or

(iii) (ii) a polypeptide having more than 90% homology with the polypeptide sequence of (i) and having the function of the polypeptide of (i).

3. The use according to claim 1,

the nucleic acid sequence of the WWTR1 gene is selected from the group consisting of:

(A) a polynucleotide encoding a polypeptide as set forth in any one of SEQ ID NOs 1-3;

(B) the polynucleotide as shown in SEQ ID No. 9 or the polynucleotide with over 80 percent of homology with the polynucleotide;

(C) a polynucleotide in which 1 to 60 nucleotides are truncated or added at the 5 'end and/or 3' end of the polynucleotide shown in SEQ ID NO. 9;

(D) a polynucleotide complementary to any of the polynucleotides of (A) to (C), and/or

The nucleic acid sequence of said WWTR1 activating variant gene is selected from the group consisting of:

(1) a polynucleotide encoding a polypeptide as set forth in any one of SEQ ID NOS 4-8; (ii) a

(2) 10 or a polynucleotide having more than 80% homology with the polynucleotide shown in SEQ ID NO;

(3) 10, or a polynucleotide with 1-60 nucleotides truncated or added at the 5 'end and/or the 3' end of the polynucleotide shown in SEQ ID NO;

(4) a polynucleotide complementary to any one of the polynucleotides described in (1) to (3).

4. Use according to claim 1, wherein said promoter of expression and/or activity of WWTR1 is selected from the group consisting of: a small molecule compound, a nucleic acid molecule, or a combination thereof,

preferably, said promoter of expression and/or activity of WWTR1 comprises a compound of formula I:

5. A nucleic acid construct comprising a WWTR1 gene or a WWTR1 activating variant gene,

preferably, the nucleic acid construct is an expression vector or an integration vector.

6. A host cell comprising the nucleic acid construct of claim 5.

7. A pharmaceutical composition comprising the nucleic acid construct of claim 5 and/or the cell of claim 6, and a pharmaceutically acceptable excipient.

8. A method of screening for potential agents for preventing or treating cancer, inhibiting tumor cell growth, inhibiting tumor cell invasiveness, inhibiting tumor cell clonogenic capacity, and inhibiting tumor cell anoikis resistance, the method comprising:

(2) detecting the expression or activity of WWTR1 in said system,

wherein, if the candidate substance can promote the expression or activity of WWTR1, the candidate substance is a potential substance for preventing or treating cancer, inhibiting the growth of tumor cells, inhibiting the invasion capacity of tumor cells, inhibiting the clonogenic capacity of tumor cells and inhibiting the anti-anoikis capacity of tumor cells,

preferably, the first and second electrodes are formed of a metal,

the cancer is a WWTR 1-mediated cancer, and/or

The tumor cell is a tumor cell with reduced expression of WWTR1, and/or

The step (1) comprises the following steps: in the test group, the candidate substance is added to a system expressing WWTR1 or an activating variant thereof, and/or

The step (2) comprises the following steps: detecting the expression or activity of WWTR1 in the system of the test group and comparing it with a control group, wherein said control group is a system expressing WWTR1 or an activating variant thereof without the addition of said candidate substance, and/or

Said system expressing WWTR1 or an activating variant thereof is selected from the group consisting of: a cell system, a subcellular system, a solution system, a tissue system, an organ system, or an animal system.

9. Use of a reagent for detecting expression or activity of WWTR1 in the manufacture of a kit for the diagnosis or prognosis of cancer,

preferably, the first and second electrodes are formed of a metal,

the cancer is a WWTR 1-mediated cancer, and/or

The reagent for detecting expression or activity of WWTR1 is selected from the group consisting of:

(1) a primer or probe targeting WWTR1 or a transcript thereof,

(2) an antibody or ligand that specifically binds WWTR 1.

10. Use of a compound of formula I for up-regulating expression and/or activity of WWTR 1:

wherein R1-R6 are each independently selected from C1-C4 alkyl, hydroxy, halogen or amino, n is an integer from 1 to 9,

preferably, R1, R2 and R4 are each independently selected from C1-C4 alkyl or hydroxy, and R3, R5 and R6 are each independently selected from hydroxy or halogen.