CN106699892B - DNAH5 fusion gene in lung squamous cell carcinoma and application thereof - Google Patents

Abstract

The invention relates to a DNAH5 fusion gene in lung squamous cell carcinoma and application thereof. Specifically, the invention discloses a novel fusion gene and a fusion protein coded by the same. The fusion protein is composed of a fragment of TRA2B protein and a fragment of DNAH5 protein, wherein the fragment of TRA2B protein is from the N-terminal sequence of TRA2B protein and is positioned at the N-terminal of the fusion protein; and the fragment of the DNAH5 protein is derived from DNAH5 protein and is located at the C-terminus of the fusion protein. The invention also discloses application of the fusion gene and the fusion protein in detecting lung squamous cell carcinoma diseases.

Description

DNAH5 fusion gene in lung squamous cell carcinoma and application thereof

Technical Field

The invention relates to the field of biological medicine, in particular to a DNAH5 fusion gene in lung squamous cell carcinoma and application thereof. More specifically, the invention relates to TRA2B-DNAH5 fusion protein and application thereof in lung squamous carcinoma.

Background

Lung cancer is one of the most prominent cancers worldwide today, and it is statistical that 60 million people die of lung cancer worldwide in 1995, and the mortality published by the World Health Organization (WHO) in 2003 is 110 ten thousand per year. Lung cancer is also a serious disease seriously harming the life health of people in China, and the number of lung cancer patients in China is about 120 ten thousand per year at present. Therefore, the molecular mechanism of lung cancer pathogenesis is researched, and a practical and effective treatment method is found, so that the method has important significance on human health.

Currently, there are three traditional approaches to the treatment of lung cancer: surgical treatment, radiotherapy and chemotherapy. However, most patients are diagnosed at an advanced stage, cancer cells are metastasized and spread, and surgical treatment is not suitable. Radiotherapy and chemotherapy belong to non-selective killing, have large toxic and side effects and are expensive. Previous research work has found some driver genes in lung cancer, which are potential targets for individualized therapy in lung cancer patients clinically, but many more driver genes in lung cancer patients have not been found, and particularly in squamous cell lung cancer patients, only few driver genes have been found, which limits the development of individualized therapy.

The driving genes comprise two major types of gene mutation and fusion gene, so researchers have more researches on the gene mutation, but have less researches on the fusion gene, and only FGFR fusion gene is found in lung squamous cell carcinoma at present.

Therefore, there is an urgent need in the art to develop a target drug for treating squamous cell lung carcinoma.

Disclosure of Invention

The invention aims to provide a TRA2B-DNAH5 fusion protein and application thereof in lung squamous carcinoma.

In a first aspect of the invention, there is provided an isolated fusion protein, the fusion protein being a fusion protein consisting of a fragment of the TRA2B protein and a fragment of the DNAH5 protein, wherein the fragment of the TRA2B protein is derived from the N-terminal sequence of the TRA2B protein and is located at the N-terminus of the fusion protein; and the fragment of the DNAH5 protein is derived from DNAH5 protein and is located at the C-terminus of the fusion protein.

In another preferred embodiment, the fragment of the TRA2B protein comprises 10 to 200, preferably 11 to 100, more preferably 12 to 50 amino acids from the N-terminus of the TRA2B protein.

In another preferred embodiment, the fragment of DNAH5 protein comprises at least 2000, more preferably at least 3000 amino acids from DNAH5 protein after exon 17 (or intron 17).

In another preferred embodiment, the DNAH5 protein fragment consists of all amino acid sequences from exon18 to stop codon of DNAH5 protein.

In another preferred embodiment, the fusion protein comprises the following characteristic sequences:

the amino acid sequence shown in the 9 th to 16 th positions in SEQ ID No. 2 (i.e., YGERDLCV, SEQ ID No. 4);

2, amino acid sequence shown in 4 th-20 th positions of SEQ ID NO; or

2, 1-24 in the sequence of SEQ ID NO.

In another preferred embodiment, the sequence of the fragment of the TRA2B protein is shown in SEQ ID No. 2 at positions 1-12.

In another preferred embodiment, the sequence of the fragment of the DNAH5 protein is shown in SEQ ID NO. 2 at positions 13-3777.

In another preferred embodiment, the fusion protein has a function or activity of promoting the growth of lung squamous carcinoma cells.

In another preferred embodiment, the fusion protein has the structure shown in formula II:

A2-B2 (formula II)

In the formula (I), the compound is shown in the specification,

a2 is the amino acid sequence from the N-terminus (amino terminus) of the TRA2B protein,

b2 is the amino acid sequence from the C-terminus (carboxy-terminus) of DNAH5 protein;

"-" is a peptide bond located between element A2 and element B2.

In another preferred embodiment, element A2 is the amino acid sequence of TRA2B shown in positions 1-n1 of Genebank accession No. 6434, wherein 10. ltoreq. n 1. ltoreq.288 is a positive integer.

In another preferred example, n1 is preferably 12.

In another preferred embodiment, element B2 is the DNAH5 amino acid sequence shown at positions m1-4624 of Genebank accession No. 1767, wherein 1. ltoreq. m 1. ltoreq.4524.

In another preferred embodiment, the B2 element retains or has the ATPase activity of the DNAH5 protein.

In another preferred example, m1 is 859, i.e. element B2 is the amino acid sequence corresponding to all base sequences before the stop codon in exons 18-79, including 3765 amino acids.

In another preferred embodiment, the element A2 is derived from a mammalian (e.g., human) TRA2B protein.

In another preferred embodiment, the element B2 is derived from a mammalian (e.g., human) DNAH5 protein.

In another preferred embodiment, the fusion protein is selected from the group consisting of:

(A) a polypeptide having an amino acid sequence shown in SEQ ID NO. 2;

(B) a polypeptide having homology of 80% or more (preferably 90% or more; etc. preferably 95% or more; most preferably 97% or more, such as 98% or more, 99% or more) with the amino acid sequence shown in SEQ ID NO. 2, and having an activity of promoting the growth of tumor cells (such as squamous cell carcinoma of lung);

(C) 2 by substitution, deletion or addition of 1-15 amino acid residues, and has the activity of promoting the growth of tumor cells (such as lung squamous carcinoma cells).

In another preferred embodiment, the amino acid sequence of the fusion protein is shown as SEQ ID NO. 2.

In another preferred embodiment, the fusion protein has activity in promoting growth of tumor cells (e.g., lung squamous carcinoma cells).

In a second aspect of the invention, there is provided an isolated polynucleotide, the sequence encoding a fusion protein according to the first aspect of the invention.

In another preferred embodiment, the polynucleotide is selected from the group consisting of: DNA sequence, RNA sequence.

In another preferred embodiment, the DNA sequence is selected from the group consisting of: genome sequence and cDNA sequence.

In another preferred embodiment, the polynucleotide is mRNA or cDNA, and the polynucleotide has the structure shown in formula I:

A1-B1 (formula I)

In the formula (I), the compound is shown in the specification,

a1 is the nucleotide sequence coding the A2 element;

b1 is the nucleotide sequence for coding the B2 element;

"-" is the connecting bond between element A1 and element B1.

In another preferred example, the element A1 is a total base sequence of Exon1 in TRA2B-mRNA, including 312 bases.

In another preferred example, element B1 is the entire base sequence of Exon DNAH5-mRNA from Exon18 to the end of the mRNA, including 12969 bases.

In another preferred embodiment, the element A1 is the nucleotide sequence shown in SEQ ID NO. 1 at positions 1-312.

In another preferred embodiment, the element B1 is the nucleotide sequence shown in the positions 313-11607 in SEQ ID NO. 1; or the nucleotide sequence shown in the position 313-13281 in SEQ ID NO. 1.

In another preferred embodiment, the sequence of the polynucleotide is as shown in SEQ ID NO. 1 at positions 1-11607, 277-13281 or 1-13281.

In a third aspect of the invention, there is provided a vector comprising a polynucleotide according to the second aspect of the invention.

In a fourth aspect of the invention, there is provided a host cell comprising a vector or genome according to the third aspect of the invention into which has been integrated a polynucleotide according to the second aspect of the invention.

In a fifth aspect of the invention, there is provided a method of producing a fusion protein according to the first aspect of the invention, comprising the steps of:

culturing the host cell of the fourth aspect of the invention under conditions suitable for expression, thereby expressing the fusion protein of the first aspect of the invention; and

isolating the fusion protein.

In a sixth aspect of the invention, there is provided a specific antibody which is capable of specifically binding to the fusion protein of the first aspect of the invention and which binds neither to TRA2B protein nor to DNAH5 protein.

In another preferred embodiment, the specific antibody binds to the amino acid sequence shown in SEQ ID No. 4.

In another preferred embodiment, the specific antibody binds to a specific binding epitope of the fusion protein, which is the amino acid sequence at positions 3-6 of SEQ ID No. 4: ERDL.

In a seventh aspect of the invention, there is provided a use of a specific antibody according to the sixth aspect of the invention for the manufacture of a medicament for inhibiting tumor cell growth.

In another preferred embodiment, the tumor cell is selected from the group consisting of: squamous cell lung carcinoma or other types of cancer.

In an eighth aspect of the present invention, there is provided a pharmaceutical composition comprising:

a specific antibody according to the sixth aspect of the invention; and a pharmaceutically acceptable carrier.

In another preferred embodiment, the pharmaceutical composition further comprises a compound for down-regulating the expression amount or activity of the fusion protein or a compound for inhibiting the activity of a downstream effector (such as ERK1/2) thereof, such as selumetinib, SL327, PD 98059.

In a ninth aspect of the invention, there is provided a non-diagnostic and non-therapeutic method for detecting the presence of the TRA2B-DNAH5 gene in a test sample, wherein the fusion gene encodes a fusion protein according to the first aspect of the invention, and wherein the method comprises the steps of:

(1) providing an upstream primer and a downstream primer,

wherein the upstream primer binds to the coding region of a fragment of TRA2B protein or a 5' UTR sequence upstream thereof;

the downstream primer binds to the coding region of the fragment of the DNAH5 protein or a 3' UTR sequence downstream thereof;

(2) taking a sample to be detected as a template, and carrying out PCR amplification by using the upstream primer and the downstream primer so as to obtain an amplification product; and

(3) and detecting the amplification product so as to determine the existence and/or quantity of the TRA2B-DNAH5 gene in the sample to be detected.

In another preferred embodiment, the upstream primer binds to the nucleotide sequence shown in positions 1-312 of SEQ ID NO. 1.

In another preferred embodiment, the downstream primer binds to the nucleotide sequence shown in position 313-13281 of SEQ ID NO. 1.

In another preferred embodiment, the sequence of the upstream primer is AAGGAAGGTGCAAGAGGTTG (SEQ ID NO.: 5).

In another preferred embodiment, the sequence of the downstream primer is AACTTCCACATCCAGCAACA (SEQ ID NO.: 6).

In another preferred embodiment, the detection is selected from the group consisting of: electrophoresis, fluorescence detection, sequencing, probe hybridization, or a combination thereof.

In another preferred embodiment, the probe is hybridized with a probe specifically bound to the nucleotide sequence shown in SEQ ID NO. 3.

In another preferred embodiment, the sequence of the probe is shown as SEQ ID No. 3 or the complete complementary sequence thereof.

In another preferred embodiment, the upstream primer also binds to the first 1-10 nucleotides of the coding region of the fragment of the DNAH5 protein, such as the nucleotides 313 and 322 in SEQ ID NO. 3.

In another preferred embodiment, the sample to be tested is mRNA or cDNA.

In another preferred example, the detecting includes: general PCR, 5' RACE and/or sequencing.

In another preferred example, the TRA2B-DNAH5 gene fusion-free sample is or is derived from: a normal sample without tumor tissue, and/or a tumor tissue sample.

In another preferred embodiment, the tumor is selected from the group consisting of: lung cancer (e.g., squamous cell lung carcinoma) tumors or other cancers.

In a tenth aspect of the present invention, there is provided a detection reagent comprising:

(i) an upstream primer and a downstream primer (primer pair),

wherein the upstream primer binds to the coding region of a fragment of TRA2B protein or a 5' UTR sequence upstream thereof;

the downstream primer binds to the coding region of the fragment of the DNAH5 protein or a 3' UTR sequence downstream thereof; and

(ii) optionally a specific probe.

In another preferred embodiment, the sequence of the upstream primer is shown as SEQ ID No. 5; the sequence of the downstream primer is shown as SEQ ID No. 6; and/or the probe is shown as SEQ ID No. 3.

In an eleventh aspect of the present invention, there is provided a kit comprising the detection reagent according to the tenth aspect of the present invention.

In another preferred embodiment, the kit further comprises one or more reagents selected from the group consisting of:

(i) reagents for sample RNA extraction and cDNA synthesis;

(ii) reagents for PCR;

(iii) reagents for hybridization.

In a twelfth aspect of the invention, there is provided a use of the fusion protein of the first aspect of the invention, the polynucleotide of the second aspect of the invention, or the detection reagent of the tenth aspect of the invention, for preparing a kit for (i) detecting whether the TRA2B-DNAH5 gene is fused and/or confirming the fusion site of the TRA2B-DNAH5 gene in a sample to be detected; (ii) (ii) detecting a tumor, (iii) typing the patient for squamous cell lung carcinoma; and/or (iv) determining whether the patient with squamous cell lung carcinoma is suitable for treatment with an inhibitor of the TRA2B-DNAH5 gene or protein.

In another preferred embodiment, if the amount A of the fusion gene TRA2B-DNAH5mRNA in the test sample is higher than the control value C, the patient suffering from lung squamous carcinoma is suitably treated with an inhibitor of the TRA2B-DNAH5 gene or protein.

In another preferred embodiment, the control value C is a value detected in a lung squamous carcinoma patient in which the fusion gene TRA2B-DNAH5 does not exist, and preferably, the control value C is 0.

In another preferred embodiment, the tumor cell is selected from the group consisting of: squamous cell lung carcinoma cells or other tumor cells.

In another preferred embodiment, the detection reagent (or the fusion protein) carries a detectable label.

In another preferred embodiment, the detectable label is selected from the group consisting of: a chromophore, a chemiluminescent group, a fluorophore, an isotope, or an enzyme.

In a thirteenth aspect of the present invention, there is provided a kit for tumor cell detection, comprising:

(a) a container containing a fusion protein according to the first aspect of the invention or a short peptide comprising the amino acid sequence shown in SEQ id No.4, wherein the fusion protein or the short peptide serves as a positive control; and

(b) a label or instructions indicating that the kit is for use in tumor cell detection;

in a fourteenth aspect of the present invention, there is provided an in vitro non-therapeutic method of inhibiting tumor cell growth, comprising the steps of: culturing the tumor cell under the condition of adding the fusion protein inhibitor of the first aspect of the invention, thereby inhibiting the growth of the tumor cell; or

Reducing the expression of the fusion gene TRA2B-DNAH5 or reducing the protein amount or activity of the fusion protein according to the first aspect of the invention.

In another preferred embodiment, the tumor cells are contacted or mixed with a solution of the fusion protein inhibitor according to the first aspect of the invention and then cultured.

In another preferred embodiment, the inhibitor is selected from the group consisting of: an antibody, a small molecule compound, a nucleic acid, or a combination thereof.

In another preferred embodiment, the inhibitor is a specific antibody according to the sixth aspect of the invention.

In another preferred example, the expression of the fusion gene TRA2B-DNAH5 is reduced by 10%, preferably by 20%, more preferably by 30%, more preferably by 40%, more preferably by 50%, more preferably by 60%, more preferably by 70%, more preferably by 80%, more preferably by 90%, most preferably the fusion gene TRA2B-DNAH5 is not expressed at all, compared to the wild type.

In another preferred embodiment, the activity of the fusion protein according to the first aspect of the invention is reduced by 10%, preferably by 20%, more preferably by 30%, more preferably by 40%, more preferably by 50%, more preferably by 60%, more preferably by 70%, more preferably by 80%, more preferably by 90%, most preferably by none, compared to the wild type.

In a fifteenth aspect of the present invention, there is provided a method of determining whether a test substance is an inhibitor or an enhancer of a fusion protein according to the first aspect of the present invention, comprising the steps of:

(a) culturing a lung squamous carcinoma cell expressing a fusion protein according to the first aspect of the invention (i.e., TRA2B-DNAH5 fusion protein) in a culture system in the presence of a test agent in a test group; and culturing squamous cell lung carcinoma cells in a control group in the absence of said test agent and under otherwise identical conditions;

(b) detecting the expression level E1 or activity A1 of the TRA2B-DNAH5 fusion gene or protein thereof in the lung squamous carcinoma cells in the test group; and comparing the expression level E2 or activity A2 of the TRA2B-DNAH5 fusion gene or protein thereof in the lung squamous carcinoma cells in a control group;

wherein, if the expression level E1 is significantly lower than the expression level E2 or the activity A1 is significantly lower than the activity A2, it indicates that the test substance is an inhibitor of the activity of the fusion protein according to the first aspect of the present invention;

if the expression level E1 is significantly higher than the expression level E2 or the activity A1 is significantly higher than the activity A2, it indicates that the test substance is an enhancer for the fusion protein according to the first aspect of the present invention.

In another preferred embodiment, said "significantly lower" means that the ratio E1/E2 or A1/A2 is 1/2, preferably 1/3, more preferably 1/4.

In another preferred embodiment, said "substantially lower" means that the ratio E1/E2 or A1/A2 is ≥ 2, preferably ≥ 3, more preferably ≥ 4.

In another preferred embodiment, the method further comprises the step (c): the fusion protein inhibitor determined in step (b) is further tested for its inhibitory effect on the growth of squamous cell lung carcinoma cells.

In another preferred embodiment, the test article comprises: antibodies, compounds, nucleic acids.

In another preferred embodiment, the test agent is an antibody, and step (c) comprises determining whether the antibody is capable of inhibiting the growth of squamous cell lung carcinoma cells (including in vitro cell assays, or animal assays).

In another preferred embodiment, the method is non-diagnostic and therapeutic.

It is to be understood that within the scope of the present invention, the above-described features of the present invention and those specifically described below (e.g., in the examples) may be combined with each other to form new or preferred embodiments. Not to be reiterated herein, but to the extent of space.

Drawings

FIG. 1 shows that potential DNAH5 fusion genes were found by Exon array analysis.

FIG. 2 shows that 5' RACE and sequencing analysis confirmed the presence of the TRA2B-DNAH5 fusion gene.

FIG. 3 shows the resulting form of the TRA2B-DNAH5 fusion gene.

FIG. 4 shows that the TRA2B-DNAH5 fusion gene can promote proliferation of tumor cells.

FIG. 5 shows that the TRA2B-DNAH5 fusion gene is able to promote anchorage-independent growth of tumor cells.

FIG. 6 shows that the TRA2B-DNAH5 fusion gene can promote tumor growth.

FIG. 7 shows that expression of the TRA2B-DNAH5 fusion gene is capable of activating p-ERK1/2 and up-regulating MMP 1.

FIG. 8 shows that selumetinib is able to significantly inhibit the growth of tumors with expression of TRA2B-DNAH 5.

Figure 9 shows that selumetinib can significantly inhibit the expression of p-ERK1/2 and MMP1 and reduce the proliferation rate of tumor cells.

In each figure, ctrl is a control.

Detailed Description

The inventors of the present invention have conducted extensive and intensive studies and, for the first time, have unexpectedly found that a TRA2B-DNAH5 fusion gene exists in a lung squamous carcinoma tissue, the gene can be specifically and highly expressed in the lung squamous carcinoma tissue, the expression of the TRA2B-DNAH5 can significantly promote the growth of lung squamous carcinoma cells, and the inhibition of the expression of the fusion gene TRA2B-DNAH5 or a protein thereof can effectively inhibit the growth of lung squamous carcinoma cells, and thus, the fusion gene can be used as a detection marker and a therapeutic target of lung squamous carcinoma cells. On this basis, the present inventors have completed the present invention.

Term(s) for

As used herein, the terms "protein of the invention", "fusion protein of the invention", "TRA 2B-DNAH5 fusion protein" are used interchangeably and refer to a fusion protein formed by the fusion of both TRA2B and DNAH 5. Preferably, the term is a fusion protein as described in the first aspect of the invention.

As used herein, the terms "fusion gene of the invention", "TRA 2B-DNAH5 fusion gene" are used interchangeably and refer to a nucleic acid sequence encoding a TRA2B-DNAH5 fusion protein as described herein. The term includes not only DNA forms but also RNA forms; including not only genomic sequences but also cDNA sequences.

TRA2B genes and proteins

In the present invention, the TRA2B gene may be derived from a non-human mammal (e.g. primates or rodents) or a human. An exemplary amino acid sequence of the TRA2B protein encoded by the TRA2B gene is shown in Genebank accession No. 6434. Taking the human TRA2B gene as an example, it encodes a 288 amino acid nucleoprotein, which plays an important role in mRNA processing, splicing and gene expression.

DNAH5 genes and proteins

In the present invention, DNAH5 gene may be derived from non-human mammal (e.g., primates or rodents) or human. One representative DNAH5 gene encodes a DNAH5 protein with an amino acid sequence as set forth in Genebank accession No. 1767.

Taking the human DNAH5 gene as an example, it encodes a heavy chain dynein (heavyin dynein) with 4624 amino acids, which is a component of microtubule-associated dynein complex. The protein has ATPase activity, generates power by consuming ATP, and plays an important role in physiological processes such as intracellular transportation and the like. Loss of function mutations in this protein have been reported to cause intracellular ciliary defects, leading to a related range of diseases.

Fusion proteins, genes and transcripts

The inventor firstly confirms the existence of a TRA2B-DNAH5 fusion gene through Exon array analysis, 5' RACE and sequencing analysis, and the DNAH5 gene Exon18 is fused to the TRA2B gene Exon1, so that a novel fusion protein is generated.

In the present invention, the terms "TRA 2B-DNAH5 protein", "TRA 2B-DNAH5 polypeptide" or "fusion protein TRA2B-DNAH 5" are used interchangeably and refer to a protein or polypeptide having the amino acid sequence of the human fusion protein TRA2B-DNAH5 (SEQ ID NO: 2). They include the fusion protein TRA2B-DNAH5 with or without the initiation methionine.

In the present invention, the representative TRA2B-DNAH5 fusion protein is a fusion protein consisting of a fragment of TRA2B protein and a fragment of DNAH5 protein, wherein the fragment of TRA2B protein is derived from the N-terminal sequence of TRA2B protein and is located at the N-terminus of the fusion protein; and the fragment of the DNAH5 protein is derived from DNAH5 protein and is located at the C-terminus of the fusion protein.

In addition, the invention also provides the gene fusion condition when the element A2 is 0, namely the fusion of the promoter sequence of the TRA2B gene and the DNA sequence of the coding element B2. In this case, although the expressed protein produced does not include the amino acid sequence of TRA2B, the promoter of TRA2B is linked to the coding sequence of the B2 element, thus promoting high expression of mRNA and protein encoded by the B2 element.

As used herein, "isolated" refers to a substance that is separated from its original environment (which, if it is a natural substance, is the natural environment). If the polynucleotide or polypeptide in its native state in a living cell is not isolated or purified, the same polynucleotide or polypeptide is isolated or purified if it is separated from other substances coexisting in its native state.

As used herein, "isolated TRA2B-DNAH5 protein or polypeptide" means that the TRA2B-DNAH5 polypeptide is substantially free of other proteins, lipids, carbohydrates or other materials with which it is naturally associated. Those skilled in the art will be able to purify the TRA2B-DNAH5 protein using standard protein purification techniques. Substantially pure polypeptides are capable of producing a single major band on a non-reducing polyacrylamide gel. The purity of the TRA2B-DNAH5 polypeptide can be analyzed by amino acid sequence analysis.

The polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, a synthetic polypeptide, preferably a recombinant polypeptide. The polypeptides of the invention can be naturally purified products, or chemically synthesized products, or using recombinant technology from prokaryotic or eukaryotic hosts (e.g., bacteria, yeast, higher plant, insect and mammalian cells). Depending on the host used in the recombinant production protocol, the polypeptides of the invention may be glycosylated or may be non-glycosylated. The polypeptides of the invention may or may not also include an initial methionine residue.

The invention also includes fragments, derivatives and analogues of the human TRA2B-DNAH5 protein. As used herein, the terms "fragment," "derivative," and "analog" refer to a polypeptide that retains substantially the same biological function or activity as the native human TRA2B-DNAH5 protein of the invention. A polypeptide fragment, derivative or analogue of the invention may be (i) a polypeptide in which one or more conserved or non-conserved amino acid residues, preferably conserved amino acid residues, are substituted, and such substituted amino acid residues may or may not be encoded by the genetic code, or (ii) a polypeptide having a substituent group in one or more amino acid residues, or (iii) a polypeptide in which the mature polypeptide is fused to another compound, such as a compound that increases the half-life of the polypeptide, e.g. polyethylene glycol, or (iv) a polypeptide in which an additional amino acid sequence is fused to the sequence of the polypeptide (e.g. a leader or secretory sequence or a sequence used to purify the polypeptide or a proprotein sequence, or a fusion protein with an antigenic IgG fragment). Such fragments, derivatives and analogs are within the purview of those skilled in the art in view of the teachings herein.

In the present invention, the term "human TRA2B-DNAH5 polypeptide" refers to a polypeptide having the sequence of SEQ ID NO. 2 having the activity of the human TRA2B-DNAH5 protein. The term also includes variants of the sequence of SEQ ID NO. 2 that have the same function as the human TRA2B-DNAH5 protein. These variants include (but are not limited to): deletion, insertion and/or substitution of one or more (usually 1 to 50, preferably 1 to 30, more preferably 1 to 20, most preferably 1 to 10) amino acids, and addition of one or several (usually up to 20, preferably up to 10, more preferably up to 5) amino acids at the C-terminus and/or N-terminus. For example, in the art, substitutions with amino acids of similar or similar properties will not generally alter the function of the protein. Also, for example, the addition of one or several amino acids at the C-terminus and/or N-terminus does not generally alter the function of the protein. The term also includes active fragments and active derivatives of the human TRA2B-DNAH5 protein.

Variants of the polypeptide include: homologous sequences, conservative variants, allelic variants, natural mutants, induced mutants, proteins encoded by DNA hybridizable to human TRA2B-DNAH5DNA under high or low stringency conditions, and polypeptides or proteins obtained using antisera directed against human TRA2B-DNAH5 polypeptide. The invention also provides other polypeptides, such as fusion proteins comprising the human TRA2B-DNAH5 polypeptide or fragments thereof and other polypeptides. In addition to the nearly full-length polypeptide, the present invention also includes soluble fragments of the human TRA2B-DNAH5 polypeptide. Typically, the fragment has at least about 10 contiguous amino acids, typically at least about 30 contiguous amino acids, preferably at least about 50 contiguous amino acids, more preferably at least about 80 contiguous amino acids, and most preferably at least about 100 contiguous amino acids of the sequence of the human TRA2B-DNAH5 polypeptide.

The invention also provides analogues of the human TRA2B-DNAH5 protein or polypeptide. The analogs may differ from the native human TRA2B-DNAH5 polypeptide by amino acid sequence differences, by modifications that do not affect the sequence, or by both. These polypeptides include natural or induced genetic variants. Induced variants can be obtained by various techniques, such as random mutagenesis by irradiation or exposure to mutagens, site-directed mutagenesis, or other known molecular biological techniques. Analogs also include analogs having residues other than the natural L-amino acids (e.g., D-amino acids), as well as analogs having non-naturally occurring or synthetic amino acids (e.g., beta, gamma-amino acids). It is to be understood that the polypeptides of the present invention are not limited to the representative polypeptides exemplified above.

Modified (generally without altering primary structure) forms include: chemically derivatized forms of the polypeptide, such as acetylation or carboxylation, in vivo or in vitro. Modifications also include glycosylation, such as those resulting from glycosylation modifications in the synthesis and processing of the polypeptide or in further processing steps. Such modification may be accomplished by exposing the polypeptide to an enzyme that performs glycosylation, such as a mammalian glycosylase or deglycosylase. Modified forms also include sequences having phosphorylated amino acid residues (e.g., phosphotyrosine, phosphoserine, phosphothreonine). Also included are polypeptides modified to increase their resistance to proteolysis or to optimize solubility.

In the present invention, the "human TRA2B-DNAH5 protein conservative variant polypeptide" means that at most 10, preferably at most 8, more preferably at most 5, and most preferably at most 3 amino acids are replaced with amino acids having similar or similar properties as compared with the amino acid sequence of SEQ ID NO. 2 to form a polypeptide. These conservative variant polypeptides are preferably generated by amino acid substitutions according to Table 1.

TABLE 1

Initial residue(s)	Representative substitutions	Preferred substitutions
			Ala(A)	Val；Leu；Ile	Val
Arg(R)	Lys；Gln；Asn	Lys
			Asn(N)	Gln；His；Lys；Arg	Gln
Asp(D)	Glu	Glu
			Cys(C)	Ser	Ser
Gln(Q)	Asn	Asn
			Glu(E)	Asp	Asp
Gly(G)	Pro；Ala	Ala
			His(H)	Asn；Gln；Lys；Arg	Arg
Ile(I)	Leu；Val；Met；Ala；Phe	Leu
			Leu(L)	Ile；Val；Met；Ala；Phe	Ile
Lys(K)	Arg；Gln；Asn	Arg
			Met(M)	Leu；Phe；Ile	Leu
Phe(F)	Leu；Val；Ile；Ala；Tyr	Leu
			Pro(P)	Ala	Ala
Ser(S)	Thr	Thr
			Thr(T)	Ser	Ser
Trp(W)	Tyr；Phe	Tyr
			Tyr(Y)	Trp；Phe；Thr；Ser	Phe
Val(V)	Ile；Leu；Met；Phe；Ala	Leu

The polynucleotide of the present invention may be in the form of DNA or RNA. The form of DNA includes cDNA, genomic DNA or artificially synthesized DNA. The DNA may be single-stranded or double-stranded. The DNA may be the coding strand or the non-coding strand. The sequence of the coding region encoding the mature polypeptide may be identical to the sequence of the coding region shown in SEQ ID NO. 1 or may be a degenerate variant. As used herein, "degenerate variant" refers in the present invention to nucleic acid sequences which encode a protein having SEQ ID NO. 2, but differ from the sequence of the coding region shown in SEQ ID NO. 1.

The polynucleotide encoding the mature polypeptide of SEQ ID NO. 2 comprises: a coding sequence encoding only the mature polypeptide; the coding sequence for the mature polypeptide and various additional coding sequences; the coding sequence (and optionally additional coding sequences) as well as non-coding sequences for the mature polypeptide.

Preparation of the proteins of the invention

The polypeptides and polynucleotides of the invention are preferably provided in isolated form, more preferably purified to homogeneity.

The full-length nucleotide sequence of the human TRA2B-DNAH5 or the fragment thereof can be obtained by PCR amplification method, recombination method or artificial synthesis method. For PCR amplification, primers can be designed based on the nucleotide sequences disclosed herein, particularly open reading frame sequences, and the sequences can be amplified using commercially available cDNA libraries or cDNA libraries prepared by conventional methods known to those skilled in the art as templates. When the sequence is long, two or more PCR amplifications are often required, and then the amplified fragments are spliced together in the correct order.

Once the sequence of interest has been obtained, it can be obtained in large quantities by recombinant methods. This is usually done by cloning it into a vector, transferring it into a cell, and isolating the relevant sequence from the propagated host cell by conventional methods.

At present, DNA sequences encoding the proteins of the present invention (or fragments or derivatives thereof) have been obtained completely by chemical synthesis. The DNA sequence may then be introduced into various existing DNA molecules (or vectors, for example) and cells known in the art. Furthermore, mutations can also be introduced into the protein sequences of the invention by chemical synthesis.

A method of amplifying DNA/RNA using PCR technology (Saiki, et al science 1985; 230: 1350-. Particularly, when it is difficult to obtain a full-length cDNA from a library, it is preferable to use the RACE method (RACE-cDNA terminal rapid amplification method), and primers used for PCR can be appropriately selected based on the sequence information of the present invention disclosed herein and synthesized by a conventional method. The amplified DNA/RNA fragments can be isolated and purified by conventional methods, such as by gel electrophoresis.

The invention also relates to vectors comprising the polynucleotides of the invention, as well as genetically engineered host cells engineered with the vectors of the invention or the coding sequence of the TRA2B-DNAH5 protein, and methods for producing the polypeptides of the invention by recombinant techniques.

The polynucleotide sequence of the present invention may be used to express or produce a recombinant TRA2B-DNAH5 polypeptide by conventional recombinant DNA techniques (Science, 1984; 224: 1431). Generally, the following steps are performed:

(1) transforming or transducing a suitable host cell with a polynucleotide (or variant) of the invention encoding a human TRA2B-DNAH5 polypeptide, or with a recombinant expression vector comprising the polynucleotide;

(2) a host cell cultured in a suitable medium;

(3) isolating and purifying the protein from the culture medium or the cells.

The obtained transformant can be cultured by a conventional method to express the polypeptide encoded by the gene of the present invention. The medium used in the culture may be selected from various conventional media depending on the host cell used. The culturing is performed under conditions suitable for growth of the host cell. After the host cells have been grown to an appropriate cell density, the selected promoter is induced by suitable means (e.g., temperature shift or chemical induction) and the cells are cultured for an additional period of time.

The recombinant polypeptide in the above method may be expressed intracellularly or on the cell membrane, or secreted extracellularly. If necessary, the recombinant protein can be isolated and purified by various separation methods using its physical, chemical and other properties. These methods are well known to those skilled in the art. Examples of such methods include, but are not limited to: conventional renaturation treatment, treatment with a protein precipitant (such as salt precipitation), centrifugation, cell lysis by osmosis, sonication, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography, High Performance Liquid Chromatography (HPLC), and other various liquid chromatography techniques, and combinations thereof.

Detection application

The invention also relates to diagnostic assays for qualitative, quantitative and localized detection of the human TRA2B-DNAH5 protein level. Such assays are well known in the art and include immunoassays and the like. The protein level of human TRA2B-DNAH5 detected in the test can be used for explaining the importance of human TRA2B-DNAH5 protein in various diseases (such as lung squamous carcinoma) and for diagnosing the diseases in which the TRA2B-DNAH5 protein plays a role.

A method for detecting whether the TRA2B-DNAH5 protein exists in a sample is to detect by using a specific antibody of the TRA2B-DNAH5 protein, and comprises the following steps: contacting the sample with an antibody specific for the TRA2B-DNAH5 protein; observing whether an antibody complex is formed indicates the presence of TRA2B-DNAH5 protein in the sample.

The polynucleotide of the TRA2B-DNAH5 protein can be used for diagnosing and treating diseases related to the TRA2B-DNAH5 protein. In terms of diagnosis, the polynucleotide of the TRA2B-DNAH5 protein can be used for detecting whether the TRA2B-DNAH5 protein is expressed or not or abnormal expression of the TRA2B-DNAH5 protein under a disease state. For example, the TRA2B-DNAH5DNA sequence can be used for hybridization of biopsy specimens to judge the abnormal expression of the TRA2B-DNAH5 protein. The hybridization technique comprises: southern blotting, Northern blotting, in situ hybridization, etc. The technical methods are all published mature technologies, and related kits are all available from commercial sources. A part or all of the polynucleotide of the present invention can be used as a probe (such as the probe shown in SEQ ID NO: 3) to be fixed on a microarray or a DNA chip (also called a "gene chip") for analyzing the differential expression of genes in tissues and for gene diagnosis.

The transcription product of the TRA2B-DNAH5 protein can also be detected by RNA-polymerase chain reaction (RT-PCR) in vitro amplification using primers specific to the TRA2B-DNAH5 protein.

Specific antibodies

In another aspect, the invention also includes polyclonal and monoclonal antibodies, particularly monoclonal antibodies, specific for the polypeptides encoded by the fusion protein DNA of the invention or fragments thereof. As used herein, "specificity" means that an antibody is capable of binding to a fusion protein product or fragment of the invention. Preferably, antibodies are those which bind to the gene product or fragment of the fusion protein of the invention but do not recognize and bind to other unrelated antigenic molecules, in particular antibodies which are specific for those which do not recognize the TRA2B native protein nor the DNAH5 native protein.

The invention also provides a particularly preferred specific antibody which recognizes and binds the specific binding epitope ERDL (positions 3-6 in SEQ ID No.:4) of SEQ ID No.:4 or the fusion protein of the invention.

Antibodies of the invention include those molecules that bind to and inhibit the fusion protein of the invention, as well as those antibodies that do not affect the function of the fusion protein of the invention. The invention also includes antibodies that bind to the gene product of the fusion protein of the invention in modified or unmodified form.

The invention encompasses not only intact monoclonal or polyclonal antibodies, but also immunologically active antibody fragments, such as Fab' or (Fab)₂A fragment; an antibody heavy chain; an antibody light chain; genetically engineered single chain Fv molecules (Ladner et al, U.S. Pat. No.4,946,778); or chimeric antibodies, such as antibodies that have murine antibody binding specificity but retain portions of the antibody from a human.

The antibodies of the invention can be prepared by a variety of techniques known to those skilled in the art. For example, a purified fusion protein gene product of the invention, or antigenic fragment thereof, can be administered to an animal to induce the production of polyclonal antibodies. Similarly, cells expressing the fusion protein of the invention or antigenic fragments thereof can be used to immunize animals to produce antibodies. The antibody of the present invention may also be a monoclonal antibody. Such monoclonal antibodies can be prepared using hybridoma technology (see Kohler et al,Nature256 of; 495, 1975; the result of Kohler et al,Eur.J.Immunol.6: 511,1976, respectively; the result of Kohler et al,Eur.J.Immunol.6：292,1976, respectively; the Hammerling et al, in the name of,In Monoclonal Antibodies and T Cell Hybridomaselsevier, n.y., 1981). The antibody of the present invention includes an antibody capable of blocking the function of the fusion protein of the present invention and an antibody that does not affect the function of the fusion protein of the present invention. The antibodies of the invention can be obtained by conventional immunization techniques using fragments or functional regions of the gene products of the fusion proteins of the invention. These fragments or functional regions can be prepared by recombinant methods or synthesized using a polypeptide synthesizer. Antibodies that bind to unmodified forms of the fusion protein gene products of the invention can be produced by immunizing an animal with a gene product produced in a prokaryotic cell (e.g., e.coli); antibodies that bind to post-translationally modified forms (e.g., glycosylated or phosphorylated proteins or polypeptides) can be obtained by immunizing an animal with a gene product produced in a eukaryotic cell (e.g., a yeast or insect cell).

Antibodies against the fusion proteins of the invention can be used in immunohistochemical techniques to detect the fusion proteins of the invention in biopsy specimens.

The antibodies of the invention are useful for treating or preventing diseases associated with the fusion proteins of the invention. Administration of an appropriate dose of the antibody can stimulate or block the production or activity of the fusion protein of the invention.

Antibodies can also be used to design immunotoxins directed to a particular site in the body. For example, the monoclonal antibody with high affinity of the fusion protein of the present invention can be covalently bound to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.). One common method is to attack the amino group of the antibody with a thiol crosslinking agent such as SPDP and bind the toxin to the antibody by exchange of disulfide bonds, and this hybrid antibody can be used to kill cells positive for the fusion protein of the present invention.

Production of polyclonal antibodies animals, such as rabbits, mice, rats, etc., can be immunized with the fusion protein or polypeptide of the present invention. Various adjuvants may be used to enhance the immune response, including but not limited to Freund's adjuvant and the like.

Inhibitors of fusion proteins and uses thereof

By utilizing the protein disclosed by the invention, substances which interact with the TRA2B-DNAH5 protein, such as receptors, inhibitors, agonists or antagonists and the like, can be screened out by various conventional screening methods.

Typically, examples of inhibitors of the invention include (but are not limited to): compounds which down-regulate the expression or activity of the fusion protein of the invention (such as miRNA, shRNA or siRNA specific for the promoter or characteristic sequence), or compounds which inhibit the activity of its downstream effector (such as ERK1/2), such as selumetinib, SL327, PD98059, and the like.

The protein antibody, inhibitor, antagonist or receptor of the present invention, etc., when administered (dosed) therapeutically, can be used to inhibit the growth of tumor cells. Generally, these materials will be formulated in a non-toxic, inert and pharmaceutically acceptable aqueous carrier medium, wherein the pH is generally from about 5 to about 8, preferably from about 6 to about 8, although the pH will vary depending on the nature of the material being formulated and the condition being treated. The formulated pharmaceutical compositions may be administered by conventional routes including, but not limited to: intratumoral, intramuscular, intraperitoneal, intravenous, subcutaneous, intradermal, or topical administration.

The polypeptides of the invention can be used directly in disease therapy, for example, in the treatment of cancer, especially squamous cell lung carcinoma. When the inhibitor of the TRA2B-DNAH5 protein is used, other tumor therapeutic agents such as cisplatin and the like can be used simultaneously.

The invention also provides a pharmaceutical composition comprising a safe and effective amount of an inhibitor (e.g., an antibody or a small molecule compound such as selumetinib, SL327, PD98058, etc.) of TRA2B-DNAH5 of the invention and a pharmaceutically acceptable carrier or excipient. Such vectors include (but are not limited to): saline, buffer, glucose, water, glycerol, ethanol, and combinations thereof. The pharmaceutical preparation should be compatible with the mode of administration.

The pharmaceutical composition of the present invention can be prepared in the form of an injection, for example, by a conventional method using physiological saline or an aqueous solution containing glucose and other adjuvants. Pharmaceutical compositions, such as tablets and capsules, can be prepared by conventional methods. Pharmaceutical compositions such as injections, solutions, tablets and capsules are preferably manufactured under sterile conditions. The amount of active ingredient administered is a therapeutically effective amount, for example from about 1 microgram per kilogram of body weight to about 100 milligrams per kilogram of body weight per day. In addition, the inhibitors of the invention may also be used with other therapeutic agents.

In the case of the pharmaceutical composition, a safe and effective amount of the antagonist of TRA2B-DNAH5 is administered to the mammal, wherein the safe and effective amount is generally at least about 10 micrograms per kilogram of body weight, and in most cases does not exceed about 100 milligrams per kilogram of body weight, preferably the dose is from about 10 micrograms per kilogram of body weight to about 10 milligrams per kilogram of body weight. Of course, the particular dosage will depend upon such factors as the route of administration, the health of the patient, and the like, and is within the skill of the skilled practitioner.

The main advantages of the invention include:

(1) the inventor firstly discovers a fusion gene TRA2B-DNAH5 of the lung squamous carcinoma, and finds that the gene can promote the growth of lung squamous carcinoma cells in experiments, so the gene can be used as a tumor marker of the lung squamous carcinoma.

(2) Unlike the markers which only have detection function, TRA2B-DNAH5 not only can be used as a tumor marker, but also can be a target for effectively treating lung squamous carcinoma. The function of inhibiting TRA2B-DNAH5 can effectively inhibit the growth of lung squamous carcinoma cells, so the method has wide application prospect.

The invention will be further illustrated with reference to the following specific examples. It should be understood that these examples are for illustrative purposes only and are not intended to limit the scope of the present invention. Experimental procedures without specific conditions noted in the following examples, generally followed by conventional conditions, such as Sambrook et al, molecular cloning: the conditions described in the laboratory Manual (New York: Cold Spring harbor laboratory Press,1989), or according to the manufacturer's recommendations. Unless otherwise indicated, percentages and parts are percentages and parts by weight.

Example 1 identification of TRA2B-DNAH5 fusion Gene in Lung squamous cell carcinoma by exon chip analysis, 5' RACE and sequencing

Experimental materials:

samples were excised from tumor tissue excised at the time of surgery and rapidly frozen in liquid nitrogen to prevent RNA degradation.

The experimental method comprises the following steps:

the application was done on dry ice, cut into small pieces and placed in a container containing 1ml Trizol reagent (Invitrogen or other company) and the tissue was disrupted with a homogenizer. RNA extraction was performed according to the standard method for RNA extraction by Trizol method to obtain high purity RNA.

Based on the Microarray database resources of laboratory lung squamous carcinomas, by the method of exon chip analysis (exon arrays) (see Lin, E., et al. exon array profiling detectors EML4-ALK fusion in break, color, and non-small cell luminescence research: MCR 7, 1466. 1476 (2009); Li, F., et al. identification of RET expression by exon array analytes in "pan-negative" luminescence reader from research 22, 928. 931 (2012); when the heat map of gene DNAH5 is analyzed, differential mRNA expression was found in a sample of lung squamous carcinomas before and after the expression of genes, and the probability of fusion of mRNA was predicted (FIG. 1).

The presence of the TRA2B-DNAH5 fusion gene was confirmed by performing 5 'RACE experiments according to the method shown in the specification using the RACE kit of Clontech Laboratories, Inc., and sequencing the band obtained by 5' RACE by directly sending it to a sequencing company (FIG. 2). FIG. 3 is a schematic diagram of the fusion form thereof, and the exon18 of the DNAH5 gene was fused with the exon1 of the TRA2B gene to generate a novel fusion gene.

In this example, a 5' RACE primer for DNAH5 gene was designed, and the specific sequence was as follows:

TCCACGGCTTTGTTCAGGGTCTGCTGTA(SEQ ID NO.:7)

163 lung squamous carcinoma samples were detected by RT-PCR, and 5 of them were found to have the fusion gene TRA2B-DNAH5 in a proportion of 3.1%. In this example, a pair of RT-PCR primers for the fusion site was designed, the specific sequences are as follows:

TD-F:AAGGAAGGTGCAAGAGGTTG(SEQ ID NO.:5)

TD-R:AACTTCCACATCCAGCAACA(SEQ ID NO.:6)

the primer pair crossed TRA2B-mRNA Exon1 and DNAH5-mRNA Exon 18.

PCR amplification was performed according to the specific annealing temperature of the primers used and the specific requirements of the Real-Time PCR instrument used. Amplification was performed on a general PCR instrument (Eppendorf Co.) using the above primer pair. The amplification conditions were: 2min at 50 ℃ and 2min at 95 ℃; 95 ℃ 15s,60 ℃ 30s, 72 ℃ 1min (3540 cycles).

As a result, it was found that the amplification product was about 200bp, and this result confirmed that exon18 of the DNAH5 gene was fused with exon1 of the TRA2B gene to generate a novel fused gene.

Example 2 expression of the TRA2B-DNAH5 fusion Gene promotes growth of Lung squamous cell carcinoma cells

The TRA2B-DNAH5 fusion gene (SEQ ID NO.:1) was cloned into an expression vector pCDH (purchased from Systems biosciences) and expression of the TRA2B-DNAH5 fusion gene in the target cells was achieved by a method of packaging lentivirus infection. The cell CRL-5889-Ctrl transferred with the empty vector is used as a control group, and the cell CRL-5889-TRA2B-DNAH5 transferred with the TRA2B-DNAH5 fusion gene is used as an experimental group.

MTT cell proliferation assay and soft agar cloning assay were performed separately as shown in FIGS. 4 and 5.

The result shows that the expression of the TRA2B-DNAH5 fusion gene in the human lung squamous carcinoma cell line CRL-5889 can obviously promote the cell proliferation and the non-anchorage-dependent growth capability of tumor cells.

CRL-5889-Ctrl cell and CRL-5889-TRA2B-DNAH5 cell were used in the same cell number (2 × 10 per inoculation point)⁶Individual cells) were inoculated subcutaneously in nude mice (immunodeficient mice), and tumor sizes of the experimental group and the control group were compared 2 to 3 weeks later.

The results of the nude mouse subcutaneous tumor formation experiments show (as shown in FIG. 6), that the expression of the TRA2B-DNAH5 fusion gene can remarkably promote the growth of CRL-5889 cell subcutaneous transplantation tumor. Therefore, the fusion gene plays an important role in the occurrence and development of the lung squamous cell carcinoma and is a potential therapeutic target.

Example 3 study of the mechanism of action of TRA2B-DNAH5

In this example, the relative expression amounts of the target protein in the control and experimental histone samples were compared by Western blot. The method comprises the following steps: collecting proteins of CRL-5889-Ctrl cell and CRL-5889-TRA2B-DNAH5 cell, carrying out Western blot experiment according to the method of molecular cloning, and analyzing the change conditions of two molecules MMP1 and p-ERK1/2 which have important functions in the process of tumorigenesis and development after being transferred into TRA2B-DNAH5 fusion gene (compared with the experimental group and the control group).

The results are shown in FIG. 7. The result shows that the expression of TRA2B-DNAH5 in the lung squamous carcinoma cell line CRL-5889 can obviously up-regulate MMP1 through Western blot experiments, and through reporter gene screening, drug screening and Westernblot experiments, the MEK-ERK signal channel is found to possibly mediate the up-regulation effect of the TRA2B-DNAH5 fusion gene on MMP 1; and Western blot experiments prove that the TRA2B-DNAH5 fusion gene can activate ERK 1/2. Therefore, the TRA2B-DNAH5 fusion gene promotes the generation and development of lung squamous carcinoma by activating MEK-ERK signaling pathway and up-regulating MMP 1.

Therefore, TRA2B-DNAH5 can be used as a potential therapeutic target for lung squamous carcinoma patients in clinic.

Example 4 inhibition of tumor cells by inhibitors of the fusion Gene TRA2B-DNAH5

CRL-5889-TRA2B-DNAH5 cells were added in the same cell number (2 × 10 per inoculation point)⁶Individual cells) were inoculated subcutaneously in nude mice (immunodeficient mice), and after 1 week, the mice were randomly divided into two groups, an experimental group was administered with an appropriate dose of selumetinib by gavage, and a control group was administered with the same amount of drug solvent.

The results are shown in FIGS. 8 and 9. The results show that selumetinib can significantly inhibit the growth of CRL-5889 transplantable tumors with TRA2B-DNAH5 fusion gene expression by inhibiting ERK1/2 and MMP 1. Therefore, selumetinib can be used as a potential therapeutic drug for lung squamous carcinoma patients with TRA2B-DNAH5 fusion gene clinically.

EXAMPLE 5 kit

This embodiment provides a kit comprising the components:

component 1: a pair of RT-PCR primers.

RT-PCR primers:

TD-F:AAGGAAGGTGCAAGAGGTTG(SEQ ID NO.:5)

TD-R:AACTTCCACATCCAGCAACA(SEQ ID NO.:6)

and (2) component: reagents for sample RNA extraction and cDNA synthesis.

And (3) component: reagents for general PCR.

And (4) component: and (3) probe: TACGGCGAGCGGGATCTTTGTGTA (SEQ ID NO. 3)

Using the kit, about 500 lung squamous carcinoma specimens were tested again, and about 17 specimens were tested to have the fusion gene TRA2B-DNAH5 in a proportion of about 3%.

All documents referred to herein are incorporated by reference into this application as if each were individually incorporated by reference. Furthermore, it should be understood that various changes and modifications of the present invention can be made by those skilled in the art after reading the above teachings of the present invention, and these equivalents also fall within the scope of the present invention as defined by the appended claims.

Claims (11)

1. A detection reagent is used for detecting the nucleotide sequence of TRA2B-DNAH5 fusion protein shown in SEQ ID No. 1, and the detection reagent comprises:

(i) an upstream primer and a downstream primer (primer pair),

wherein the upstream primer binds to the coding region of a fragment of TRA2B protein or a 5' UTR sequence upstream thereof;

the downstream primer is combined with a coding region of a DNAH5 protein fragment or a 3' UTR sequence downstream of the coding region, and the upstream primer is combined with a nucleotide sequence shown in 1 st to 312 st positions in SEQ ID NO. 1; the downstream primer is combined with the nucleotide sequence shown in the 313-13281 th site in the SEQ ID NO. 1; and

(ii) optionally a specific probe.

2. The detection reagent of claim 1, wherein the sequence of the upstream primer is as shown in SEQ ID No. 5; the sequence of the downstream primer is shown as SEQ ID No. 6; and/or the probe is shown as SEQ ID No. 3.

3. Use of the detection reagent according to claim 1 for preparing a kit for (i) detecting whether the TRA2B-DNAH5 gene is fused and/or confirming the fusion site of the TRA2B-DNAH5 gene in a test sample; (ii) typing the squamous cell lung carcinoma patient; and/or (iii) determining whether the patient with squamous cell lung carcinoma is suitable for treatment with an inhibitor of the TRA2B-DNAH5 gene or protein.

4. The use according to claim 3, wherein the patient with lung squamous carcinoma is suitably treated with an inhibitor of the TRA2B-DNAH5 gene or protein if the amount A of the fusion gene TRA2B-DNAH5mRNA of the test sample is higher than the control value C; the control value C is a detection value in a lung squamous carcinoma patient in which the fusion gene TRA2B-DNAH5 does not exist, wherein the control value C is 0.

5. A kit comprising the detection reagent according to claim 1.

6. The kit of claim 5, further comprising a fusion protein or a short peptide comprising the amino acid sequence of seq id No.4 as a positive control, wherein the fusion protein is a fusion protein of a fragment of the TRA2B protein and a fragment of the DNAH5 protein, wherein the fragment of the TRA2B protein is from the N-terminal sequence of the TRA2B protein and is located at the N-terminus of the fusion protein; and the fragment of the DNAH5 protein is derived from DNAH5 protein and is located at the C-terminus of the fusion protein.

7. The kit of claim 6, wherein the fusion protein comprises the following characteristic sequences:

an amino acid sequence shown in the 9 th to 16 th positions in SEQ ID NO. 2;

2, amino acid sequence shown in 4 th-20 th positions of SEQ ID NO; or

2, 1-24 in the sequence of SEQ ID NO.

8. The kit of claim 6, wherein the fragment of TRA2B protein has the sequence shown in SEQ ID No. 2 at positions 1-12.

9. The kit of claim 6, wherein the sequence of the fragment of the DNAH5 protein is as set forth in SEQ ID NO. 2 at positions 13-3777.

10. The kit of claim 6, wherein the fusion protein has the structure of formula II:

A2-B2 (formula II)

In the formula (I), the compound is shown in the specification,

a2 is the amino acid sequence from the N-terminus of the TRA2B protein,

b2 is the amino acid sequence from the C-terminus of DNAH5 protein;

"-" is a peptide bond located between element A2 and element B2.

11. The kit of claim 6, wherein the fusion protein is selected from the group consisting of:

(A) polypeptide with the amino acid sequence shown in SEQ ID NO. 2.

Images