CN114949004A - Application of akkermansia muciniphila in preparation of composition for preventing and treating hyperlipidemia and composition containing akkermansia muciniphila - Google Patents

Application of akkermansia muciniphila in preparation of composition for preventing and treating hyperlipidemia and composition containing akkermansia muciniphila Download PDF

Info

Publication number
CN114949004A
CN114949004A CN202210652479.1A CN202210652479A CN114949004A CN 114949004 A CN114949004 A CN 114949004A CN 202210652479 A CN202210652479 A CN 202210652479A CN 114949004 A CN114949004 A CN 114949004A
Authority
CN
China
Prior art keywords
akkermansia muciniphila
composition
muciniphila
group
akkermansia
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN202210652479.1A
Other languages
Chinese (zh)
Other versions
CN114949004B (en
Inventor
常磊
吴家棋
刘步蟾
李永霞
梁美君
智发朝
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Guangzhou Zhiyi Biotechnology Co Ltd
Original Assignee
Guangzhou Zhiyi Biotechnology Co Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Guangzhou Zhiyi Biotechnology Co Ltd filed Critical Guangzhou Zhiyi Biotechnology Co Ltd
Priority to CN202210652479.1A priority Critical patent/CN114949004B/en
Publication of CN114949004A publication Critical patent/CN114949004A/en
Application granted granted Critical
Publication of CN114949004B publication Critical patent/CN114949004B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/66—Microorganisms or materials therefrom
    • A61K35/74—Bacteria
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23L—FOODS, FOODSTUFFS, OR NON-ALCOHOLIC BEVERAGES, NOT COVERED BY SUBCLASSES A21D OR A23B-A23J; THEIR PREPARATION OR TREATMENT, e.g. COOKING, MODIFICATION OF NUTRITIVE QUALITIES, PHYSICAL TREATMENT; PRESERVATION OF FOODS OR FOODSTUFFS, IN GENERAL
    • A23L33/00—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof
    • A23L33/10—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof using additives
    • A23L33/135—Bacteria or derivatives thereof, e.g. probiotics
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A61K45/06—Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00—Drugs for disorders of the metabolism
    • A61P3/06—Antihyperlipidemics
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/20—Bacteria; Culture media therefor
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/20—Bacteria; Culture media therefor
    • C12N1/205—Bacterial isolates
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23V—INDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
    • A23V2002/00—Food compositions, function of food ingredients or processes for food or foodstuffs
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
    • C12R2001/00—Microorganisms ; Processes using microorganisms
    • C12R2001/01—Bacteria or Actinomycetales ; using bacteria or Actinomycetales
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Medicinal Chemistry (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Genetics & Genomics (AREA)
  • Biotechnology (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Microbiology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Mycology (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Biomedical Technology (AREA)
  • Epidemiology (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Virology (AREA)
  • Molecular Biology (AREA)
  • Diabetes (AREA)
  • Hematology (AREA)
  • Obesity (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Nutrition Science (AREA)
  • Food Science & Technology (AREA)
  • Polymers & Plastics (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
  • Medicinal Preparation (AREA)

Abstract

The invention relates to application of akkermansia muciniphila in preparation of a composition for preventing and treating hyperlipidemia, wherein the akkermansia muciniphila is akkermansia muciniphila AM06, akkermansia muciniphila AM02 or a combination of the two; wherein the preservation number of the akkermansia muciniphila AM06 is CGMCC No.22793, and the preservation number of the akkermansia muciniphila AM02 is CGMCC No. 22794. In the application, AM02 and AM06 can improve the cholesterol degradation capability of a body, regulate the contents of TC, TG and HDL-C, LDL-C in serum, effectively prevent and treat hyperlipidemia, and can be used for preventing and treating hyperlipidemia in cooperation with one or more of fenofibrate, lovastatin, simvastatin, pravastatin, fluvastatin, atorvastatin, rosuvastatin and pitavastatin.

Description

Application of akkermansia muciniphila in preparation of composition for preventing and treating hyperlipidemia and composition containing akkermansia muciniphila
Technical Field
The invention relates to the technical field of hyperlipidemia prevention and treatment, and in particular relates to application of akkermansia muciniphila in preparation of a composition for preventing and treating hyperlipidemia and a composition containing akkermansia muciniphila.
Background
Hyperlipidemia (Hyperlipidemia), or hyperlipidaemia, is a condition in which the blood cholesterol and/or triglycerides are high. Generally, the total cholesterol in the fasting serum of an adult exceeds 5.72mmol/L and the triglyceride exceeds 1.70mmol/L, and the hyperlipidemia can be diagnosed. Hyperlipidemia can be divided into two major categories, namely primary hyperlipidemia and secondary hyperlipidemia. Primary hyperlipidemia is genetically related, due to single or multiple gene defects, abnormalities in receptors, enzymes or apolipoproteins involved in lipoprotein transport and metabolism, and may be due to environmental factors (diet, nutrition, drugs, etc.) and other unknown mechanisms. Secondary hyperlipidemia often occurs in metabolic disorders (such as diabetes, hyperlipidemia, myxedema, hypothyroidism, obesity, liver and kidney diseases, adrenal cortex hyperfunction and the like), or is related to other factors such as age, sex, season, drinking, smoking, physical activity, mental stress, emotional activity and the like.
Dyslipidemia, which is characterized by elevated low-density lipoprotein cholesterol (LDL-C) or Total Cholesterol (TC), is an important risk factor for atherosclerotic cardiovascular disease; other types of dyslipidemias, such as increased Triglycerides (TG) or decreased high density lipoprotein cholesterol (HDL-C), are also associated with increased risk of atherosclerotic cardiovascular disease (ASCVD). Effectively control dyslipidemia and has important significance for ASCVD prevention and control.
Therefore, development of new intervention schemes for the prevention and treatment of hyperlipidemia is essential.
Disclosure of Invention
Based on the above, the invention of the application comprises providing akkermansia muciniphila which is akkermansia muciniphila AM06, akkermansia muciniphila AM02 or the combination of the two, and the application of a composition containing the akkermansia muciniphila in preparing a pharmaceutical composition for preventing and treating hyperlipidemia or a health care product composition for improving the blood lipid level; wherein,
the akkermansia muciniphila AM06 is preserved in the China general microbiological culture Collection center of China Committee for culture Collection of microorganisms at 28 th month 06 in 2021, with the preservation number of CGMCC No. 22793;
the akkermansia muciniphila AM02 is preserved in the China general microbiological culture Collection center of China Committee for culture Collection of microorganisms at 28 th month 06 in 2021, and the preservation number is CGMCC No. 22794.
In a first aspect of the present invention, there is provided a use of akkermansia muciniphila for the preparation of a pharmaceutical composition for the prevention and treatment of hyperlipidemia or for the preparation of a health care composition for the improvement of blood lipid levels, said akkermansia muciniphila being akkermansia muciniphila AM06, akkermansia muciniphila AM02, or a combination of both; wherein,
the akkermansia muciniphila AM06 is preserved in the China general microbiological culture Collection center of China Committee for culture Collection of microorganisms at 28 th month 06 in 2021, with the preservation number of CGMCC No. 22793;
the akkermansia muciniphila AM02 is preserved in the China general microbiological culture Collection center of China Committee for culture Collection of microorganisms at 28 th month 06 in 2021, and the preservation number is CGMCC No. 22794.
In some embodiments, the akkermansia muciniphila AM06 and the akkermansia muciniphila AM02 are each independently viable bacteria, killed bacteria, or a combination of viable and killed bacteria.
In some embodiments, the pharmaceutical composition is a pharmaceutical product in the form of a tablet, capsule, granule, pill, ointment, solution, suspension, emulsion, cream, spray, drop, patch, or tube feed.
In some embodiments, the nutraceutical composition is a nutraceutical in the form of a pill, tablet, granule, capsule, solution, suspension, or emulsion.
In some embodiments, the pharmaceutical composition or nutraceutical composition comprises an effective amount of the akkermansia muciniphila.
In some embodiments, the subject is a mammal.
In some embodiments, the subject is a human or a mouse.
In a second aspect of the present invention there is provided the use of a composition comprising akkermansia muciniphila for the manufacture of a pharmaceutical composition for the prevention and treatment of hyperlipidaemia or for the manufacture of a nutraceutical composition for the improvement of blood lipid levels, wherein akkermansia muciniphila is as defined in the first aspect of the invention.
In some embodiments, the akkermansia muciniphila-containing composition is a nutraceutical composition or a pharmaceutical composition.
In some embodiments, the akkermansia muciniphila-containing composition further comprises a second active ingredient that is a different drug than the akkermansia muciniphila.
In some embodiments, the akkermansia muciniphila-containing composition is a probiotic composition, the probiotic composition further containing a probiotic other than the akkermansia muciniphila.
In a third aspect of the present invention, there is provided a composition comprising akkermansia muciniphila, further comprising one or more of fenofibrate, lovastatin, simvastatin, pravastatin, fluvastatin, atorvastatin, rosuvastatin, and pitavastatin; the akkermansia muciniphila is as defined in the first aspect.
Compared with the prior art, the invention has the following beneficial effects:
the inventor of the application obtains strains AM06 (with the preservation number of CGMCC No.22793) and AM02 (with the preservation number of CGMCC No.22794) through separation, and the strains belong to akkermansia muciniphila according to 16S rRNA analysis, morphological analysis, metabolite component analysis, efficacy analysis (such as tolerance of artificial gastric juice and artificial intestinal juice) and other comprehensive analysis, and are identified as new strains different from akkermansia muciniphila such as ATCC BAA-835 (standard strains).
The inventor finds that the separated akkermansia muciniphila AM06 and/or AM02 can be used for preventing and treating hyperlipidemia. The separated akkermansia muciniphila AM06 and/or AM02, AM02 and AM06 can improve the degradation capability of cholesterol in mice, regulate the contents of TC, TG and HDL-C, LDL-C in serum, and effectively prevent and treat the hyperlipidemia of the mice. Meanwhile, the akkermansia muciniphila AM06 and/or AM02 can also be used for preventing and treating hyperlipidemia in cooperation with one or more of fenofibrate, lovastatin, simvastatin, pravastatin, fluvastatin, atorvastatin, rosuvastatin and pitavastatin.
Drawings
In order to more clearly illustrate the technical solutions in the embodiments of the present application and to more fully understand the present application and the advantages thereof, the drawings used in the description of the embodiments will be briefly introduced below. It is obvious that the drawings in the following description are only some embodiments of the application, and that other drawings can be derived from these drawings by a person skilled in the art without inventive effort.
FIG. 1 is a characteristic diagram of a colony of Ackermansia muciniphila AM02 cultured in one embodiment of the present invention;
FIG. 2 is a characteristic diagram of a colony of Ackermansia muciniphila AM06 obtained in accordance with an embodiment of the present invention;
FIG. 3 is a microscopic image of gram-stained Ackermansia muciniphila AM02 cultured in accordance with an embodiment of the present invention;
FIG. 4 is a gram-stained microscopic image of Ackermansia muciniphila AM06 cultured in accordance with one embodiment of the present invention;
FIG. 5 is a PCA analysis of culture supernatant metabolites of a few Ackermanella muciniphila in one embodiment of the present invention.
The Ackermanella muciniphila AM06 obtained by separation in the invention is classified and named as Akkermansia muciniphila, and is preserved in China general microbiological culture Collection center at 28 th 06 th 2021, with the address: no. 3 Xilu No.1 Beijing, Chaoyang, and the preservation number is CGMCC No. 22793; the strain was collected and registered in the collection at 28.06.2021, and was detected as a viable strain by the collection at 28.06.2021.
The Ackermanella muciniphila AM02 obtained by separation in the invention is classified and named as Akkermansia muciniphila, and is preserved in China general microbiological culture Collection center at 28 th 06 th 2021, with the address: no. 3 of Xilu No.1 Beijing, Chaoyang, Beijing, with the preservation number of CGMCC No. 22794; the strain was collected and registered in the collection at 28.06.2021, and was detected as a viable strain by the collection at 28.06.2021.
Detailed Description
The present invention will be described in further detail with reference to the drawings, embodiments and examples. It should be understood that these embodiments and examples are given solely for the purpose of illustrating the invention and are not to be construed as limiting the scope of the invention, which is provided for the purpose of providing a more thorough understanding of the present disclosure. It is also understood that the present invention may be embodied in many different forms and is not limited to the embodiments and examples described herein, and that various changes and modifications may be effected therein by one of ordinary skill in the art without departing from the spirit and scope of the invention and equivalents thereof. Furthermore, in the following description, numerous specific details are set forth in order to provide a more thorough understanding of the present invention, and it is to be understood that the present invention may be practiced without one or more of these details.
Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. The terminology used herein in the description of the invention is for the purpose of describing particular embodiments and examples only and is not intended to be limiting of the invention.
Term(s) for
Unless otherwise stated or contradicted, terms or phrases used herein have the following meanings:
the term "and/or", "and/or" as used herein is intended to be inclusive of any one of the two or more items listed in association, and also to include any and all combinations of the items listed in association, including any two or more of the items listed in association, any more of the items listed in association, or all combinations of the items listed in association. It should be noted that when at least three items are connected by at least two conjunctive combinations selected from "and/or", "or/and", "and/or", it should be understood that, in the present application, the technical solutions definitely include the technical solutions all connected by "logic and", and also the technical solutions all connected by "logic or". For example, "A and/or B" includes A, B and A + B. For example, the embodiments of "a, and/or, B, and/or, C, and/or, D" include any of A, B, C, D (i.e., all embodiments using "logical or" connection "), any and all combinations of A, B, C, D (i.e., any two or any three of A, B, C, D), and four combinations of A, B, C, D (i.e., all embodiments using" logical and "connection).
The present invention relates to "plural", etc., and indicates that it is 2 or more in number, unless otherwise specified. For example, "one or more" means one or two or more.
As used herein, "a combination thereof," "any combination thereof," and the like, includes all suitable combinations of any two or more of the listed items.
In the present specification, the term "suitable" as used in the "suitable combination," "suitable mode," "any suitable mode," and the like means that the technical solution of the present invention can be implemented, the technical problem of the present invention can be solved, and the technical effect intended by the present invention can be achieved.
The terms "preferably", "better" and "suitable" are used herein only to describe preferred embodiments or examples, and it should be understood that the scope of the present invention is not limited by these terms. If multiple 'preferences' appear in one technical scheme, if no special description exists, and no contradiction or mutual restriction exists, each 'preference' is independent.
In the present invention, "further", "still further", "specifically" and the like are used for descriptive purposes to indicate differences in content, but should not be construed as limiting the scope of the present invention.
In the present invention, "optionally", "optional" and "optional" refer to the presence or absence, i.e., to any one of two juxtapositions selected from "present" and "absent". If multiple optional parts appear in one technical scheme, if no special description exists, and no contradiction or mutual constraint relation exists, each optional part is independent.
In the present invention, the terms "first", "second", "third", etc. in the terms "first", "second", "third", etc. are used for descriptive purposes only and are not to be construed as indicating or implying a relative importance or quantity, nor is it to be construed as implicitly indicating the importance or quantity of the technical feature indicated. Also, "first," "second," "third," etc. are for non-exhaustive enumeration description purposes only and should not be construed as constituting a closed limitation to the number.
In the present invention, the technical features described in the open type include a closed technical solution composed of the listed features, and also include an open technical solution including the listed features.
In the present invention, a range of values (i.e., a range of values) is included, and unless otherwise stated, the distribution of values that are selectable within the range of values is considered to be continuous and includes both the endpoints (i.e., the minimum and maximum) of the range of values and each value between the endpoints. Unless otherwise specified, when a numerical range refers to integers only within the numerical range, the inclusion of both endpoints of the range, and each integer between the endpoints, is equivalent to the direct recitation of each integer. Where multiple numerical ranges are provided to describe a feature or characteristic, the numerical ranges may be combined. In other words, unless otherwise indicated, all numerical ranges disclosed herein are to be understood to include any and all subranges subsumed therein. The "numerical value" in the numerical range may be any quantitative value such as a number, a percentage, a ratio, or the like. "numerical range" is intended to broadly encompass quantitative ranges such as percentage ranges, proportional ranges, ratio ranges, and the like.
The temperature parameter in the present invention is not particularly limited, and may be a constant temperature treatment or a variation within a certain temperature range. It will be appreciated that the described thermostatic process allows the temperature to fluctuate within the accuracy of the instrument control. Allowing fluctuations in the range of, for example,. + -. 5 deg.C,. + -. 4 deg.C,. + -. 3 deg.C,. + -. 2 deg.C, + -. 1 deg.C.
In the present invention, the term "room temperature" generally means 4 ℃ to 35 ℃, preferably 20 ℃. + -. 5 ℃. In some embodiments of the invention, room temperature refers to 20 ℃ to 30 ℃.
In the present invention, the units relating to the data range, if only with units following the right end point, indicate that the units of the left end point and the right end point are the same. For example, 3-5 h indicates that the units of the left end point "3" and the right end point "5" are both h (hours).
All documents referred to herein are incorporated by reference into this application as if each were individually incorporated by reference. The citation referred to herein is incorporated by reference in its entirety for all purposes unless otherwise in conflict with the present disclosure's objectives and/or technical solutions. Where a citation is referred to herein, the definition of a reference in the document, including features, terms, nouns, phrases, etc., that is relevant, is also incorporated by reference. In the present invention, when the citation is referred to, the cited examples and preferred embodiments of the related art features are also incorporated by reference into the present application, but the present invention is not limited to the embodiments. It should be understood that where the citation conflicts with the description herein, the application will control or be adapted in accordance with the description herein.
Modes clinically used for lipid regulation include lifestyle intervention (therapeutic lifestyle changes), application of lipid regulating drugs, lipoprotein plasma replacement, surgical treatments such as liver transplantation, partial ileal bypass surgery, and portal vein bypass surgery, etc. Lifestyle intervention is a fundamental measure of dyslipidemia treatment, and whether or not other lipid modifying treatments are used, diet control and lifestyle improvement must be adhered to. Lifestyle interventions include weight control, physical activity, smoking cessation, alcohol restriction, etc., but compliance issues often arise depending on the patient's condition.
Lipid regulating drugs are divided into two main classes of cholesterol reducing drugs and triglyceride reducing drugs, wherein statins are the first clinical lipid regulating drugs. Statins mainly lower cholesterol and are indicated for patients with hypercholesterolemia, combined hyperlipidemia and ASCVD. Currently, lovastatin, simvastatin, pravastatin, fluvastatin, atorvastatin, rosuvastatin and pitavastatin exist clinically in China. The cholesterol-lowering range of statins varies greatly between species and doses. Statins can reduce TG levels by 7% -30% and HDL-C levels by 5% -15%. Most people have good tolerance to statins, but when statins are applied in large dose, the patients may have liver dysfunction, muscle adverse reaction (myalgia, myositis, rhabdomyolysis and the like), new onset diabetes, transient cognitive dysfunction, headache, insomnia, depression and digestive tract symptoms.
Other lipid-regulating drugs include ezetimibe, probucol, and bile acid sequestrant for lowering cholesterol; fibrates, nicotinic acids, high purity fish oil preparations for reducing triglycerides, and the like. The lipid-regulating drugs are used singly or in combination according to different conditions of patients, but have adverse reactions such as liver toxicity, digestive tract toxicity and the like.
Lipoprotein plasma replacement has proven to be an important adjunctive therapy for familial hypercholesterolemia patients, which is effective, but is expensive, time consuming and carries an infection risk. The operative treatment has great harm to patients, and has the problems of postoperative complications, requirement of lifelong administration of immunosuppressive agents and the like, so the clinical application is very few. Because of the defects of the existing treatment modes, the search for a safer and more effective treatment mode for hyperlipemia is necessary.
Probiotics are a class of living microorganisms that can colonize the human intestinal tract and improve the micro-ecological balance, which is beneficial to the health of the host. The common probiotics discovered at present comprise bifidobacteria, clostridium aceticum, lactobacillus, actinomycetes, saccharomycetes and the like, and a plurality of researches show that the probiotics play a positive role in a plurality of aspects of human body obesity, cardiovascular systems, immunity and the like. Park et al found that Lactobacillus plantarum LG42, isolated from korean traditional rice wine, significantly reduced the body weight and abdominal fat weight of high-fat diet-induced obese mice, indicating that Lactobacillus plantarum plays a certain role in the prevention and treatment of obesity. AN et al found that probiotics not only have anti-obesity effects of reducing adipose tissue deposition, reducing body weight and the like, but also have the effect of reducing plasma TC and TG. At present, the use of probiotic preparations for relieving obesity and preventing cardiovascular diseases has become a hot point of research at home and abroad.
Akkermansia muciniphila (Akkermansia muciniphila, a. muciniphila) is one of the most abundant single species in the human intestinal microbiota, accounting for 0.5-5% of the total bacteria. It is in the form of oval, a gram-negative anaerobe, representative of the phylum verrucomicrobia. There is no microecological preparation for regulating blood lipids using a.
First aspect of the invention
In a first aspect of the present invention, there is provided a use of akkermansia muciniphila for the preparation of a pharmaceutical composition for the prevention and treatment of hyperlipidemia or for the preparation of a nutraceutical composition for the improvement of blood lipid levels, said akkermansia muciniphila being akkermansia muciniphila AM06, akkermansia muciniphila AM02, or a combination of both.
The akkermansia muciniphila of the invention can be live bacteria, or akkermansia muciniphila which retains biological activity and is subjected to inactivation, gene recombination, modification, attenuation, chemical treatment and physical treatment, and can also be lysate, culture (such as supernatant) of bacteria or components extracted from the supernatant. Optionally, the akkermansia muciniphila AM06 and the akkermansia muciniphila AM02 are each independently viable bacteria, inactivated bacteria, or a combination of viable and inactivated bacteria.
The inventor of the application obtains strains AM06 (with the preservation number of CGMCC No.22793) and AM02 (with the preservation number of CGMCC No.22794) through separation, and the strains belong to akkermansia muciniphila according to 16S rRNA analysis, morphological analysis, metabolite component analysis, efficacy analysis (such as tolerance of artificial gastric juice and artificial intestinal juice) and other comprehensive analysis, and are identified as new strains different from akkermansia muciniphila such as ATCC BAA-835 (standard strains).
Akkermansia muciniphila AM06 was deposited at 28.06.2021 in the general microbiological culture collection center of the committee for culture collection of chinese microorganisms with the collection number of CGMCC No.22793, and was isolated by the method of example 1, and the identification of the species was performed by one or more methods including, but not limited to, the methods of examples 2 to 6.
In some embodiments, the colony culture features of akkermansia muciniphila AM06 include: round convex, neat edge, opaque, white, uneven size colonies.
In some embodiments, akkermansia muciniphila AM06 is isolated from breast milk.
Ackermanobacter muciniphila AM02 was deposited at 28.06.2021 in the China general microbiological culture Collection center (CGMCC) with the collection number of CGMCC No.22794, and was isolated by the method of example 1, and was identified by one or more methods including, but not limited to, examples 2-6.
In some embodiments, the colony culture characteristics of akkermansia muciniphila AM02 of CGMCC No.22794 comprise: round convex, neat edge, opaque, white, uneven size colonies.
In some embodiments, applicants have also conducted tolerance studies for artificial gastric fluids, artificial intestinal fluids. In the research on the tolerance of the artificial gastric juice, the number of viable bacteria in different groups of a 0.9 wt% NaCl solution group, a pH3 artificial gastric juice group and a Ph2 artificial gastric juice group after being subjected to anaerobic incubation for 0h, 1.5h and 3h is statistically analyzed, and the result shows that the tolerance of the artificial gastric juice of the ackermann mucinophilus strain is AM02 to AM06 to standard strain ATCC BAA-835 in sequence. In the artificial intestinal juice tolerance investigation experiment, the number of viable bacteria after anaerobic incubation for 0, 4 and 8 hours at 37 +/-2 ℃ is subjected to statistical analysis, and the artificial intestinal juice tolerance is superior to AM06, AM02, ATCC BAA-835.
The inventor finds that the Ackermansia muciniphila AM06 and/or AM02 obtained by separation can be used for hyperlipidemia through a large number of experiments. The separated akkermansia muciniphila AM02 and AM06 can improve the degradation capability of cholesterol in a mouse, regulate the contents of TC, TG and HDL-C, LDL-C in serum and effectively prevent and treat hyperlipidemia of the mouse.
In the present invention, "prevention" includes prevention, treatment, adjuvant therapy and the like. As used herein, "control" or "prevention" as used herein refers to alleviation, delay of progression, attenuation, prevention, or maintenance of an existing disease or condition. "preventing" also includes curing, preventing the development of, or alleviating to some extent one or more of the symptoms of a disease or disorder.
In the present invention, the "composition" may be a combination of a plurality of substances, and may be used in combination or may be a mixture of combinations.
In the present invention, "health food" and "health food" have the same meaning and may be used interchangeably. In the present invention, "health product" means a food having a health function which is capable of regulating physiological functions of an animal body (human or other animals) and often provides a beneficial effect. The range of the beneficial effect of the health product in vivo is not particularly limited, and the health product can be a systemic effect or a local effect.
In the present invention, the "nutraceutical composition" refers to a food composition having a health-care function. The health product composition can be directly eaten as a health product or can be eaten as a dietary additive. Wherein "treating" as used herein refers to alleviating, delaying progression, attenuating, or maintaining an existing disease or disorder, treating also includes curing, preventing the development of, or alleviating to some extent one or more symptoms of the disease or disorder.
In the present invention, "food" refers to an edible substance. "food composition" refers to an edible composition. It will be appreciated that the food composition of the invention may also comprise any suitable other edible substance in addition to the aforementioned akkermansia muciniphila. In some embodiments, the additional edible substances may be selected from substances allowed to be added in healthcare product regulatory specifications, and further, not include substances prohibited from being added in healthcare brand regulatory specifications. The health care product management standard refers to the current standard in production, if not particularly limited. In the present invention, the "food composition" refers to a food having a health-care function. In the present invention, the "nutraceutical composition" is not intended for the treatment of diseases, but can be used for the prevention of diabetes.
In the present invention, "drug" includes any agent, compound, composition or mixture that provides a physiological and/or pharmacological effect in vivo or in vitro, and often provides a beneficial effect. The range of the "drug" that exerts a physiological and/or pharmacological effect in vivo is not particularly limited, and may be a systemic effect or a local effect. The activity of the "drug" is not particularly limited, and may be an active substance that can interact with other substances or an inert substance that does not interact with other substances.
In the present invention, the term "pharmaceutical composition" refers to a composition having a pharmaceutically prophylactic and therapeutic effect and usable as a medicament.
In some embodiments, the composition for preventing and treating hyperlipidemia is a liquid formulation or a solid formulation. Liquid formulations refer to formulations containing a liquid phase, such as, by way of non-limiting example, solutions, suspensions, emulsions, and the like. Non-limiting examples of solid formulations are tablets, capsules, granules, pills, and the like.
In some embodiments, it may be an oral agent, an injection, a drop, a patch, a tube feed, etc., depending on the administration mode.
In some embodiments, the health food is in the form of a pill, tablet, granule, capsule, and solution, suspension, or emulsion. Further, as non-limiting examples, honeyed pills, water-honeyed pills, syrup and the like can be given.
In some embodiments, the pharmaceutical product is in the form of a tablet, capsule, granule, pill, ointment, solution, suspension, emulsion, cream, spray, drop, patch, or tube feed.
In some embodiments, the composition for preventing and treating hyperlipidemia comprises akkermansia muciniphila and an auxiliary material. The excipients selected may vary depending on the dosage form.
In some embodiments, the health food comprises said akkermansia muciniphila and an edible adjuvant. In the present invention, the food additive also belongs to edible auxiliary materials. Examples of the edible auxiliary materials include sugar, fructose, honey, glucose, starch, vitamins, beneficial trace elements and secondary elements including calcium powder, soybean powder, mung bean powder, maltodextrin, milk powder, vegetable juice, fruit juice, spice or essence.
In some embodiments, a pharmaceutical product comprises the akkermansia muciniphila and a pharmaceutically acceptable carrier.
In the present invention, "carrier" includes, but is not limited to, mannitol, sorbitol, sodium metabisulfite, sodium bisulfite, sodium thiosulfate, cysteine hydrochloride, thioglycolic acid, methionine, vitamin C, EDTA disodium, calcium sodium EDTA, monovalent alkali metal carbonates, acetates, phosphates or aqueous solutions thereof, hydrochloric acid, acetic acid, sulfuric acid, phosphoric acid, amino acids, sodium chloride, potassium chloride, sodium lactate, xylitol, maltose, glucose, fructose, dextran, glycine, starch, sucrose, lactose, mannitol, silicon derivatives, cellulose and derivatives thereof, alginates, gelatin, polyvinylpyrrolidone, glycerin, tween 80, agar, calcium carbonate, calcium bicarbonate, surfactants, polyethylene glycol, cyclodextrin, phospholipid-based materials, kaolin, talc, calcium stearate, magnesium stearate.
In the present invention, "pharmaceutically acceptable" refers to those ligands, materials, compositions, and/or dosage forms which are, within the scope of sound medical judgment, suitable for administration to a patient and commensurate with a reasonable benefit/risk ratio.
In the present invention, "pharmaceutically acceptable carrier" refers to a pharmaceutically acceptable material, composition or vehicle, such as a liquid or solid filler, diluent, excipient, solvent or encapsulating material. As used herein, the language "pharmaceutically acceptable carrier" includes buffers, sterile water for injection, solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like, compatible with pharmaceutical administration. Each entity must be "pharmaceutically acceptable" in the sense of being compatible with the other ingredients in the formulation and not injurious to the patient. Suitable examples include, but are not limited to: (1) sugars such as lactose, glucose and sucrose; (2) starches, such as corn starch, potato starch, and substituted or unsubstituted beta-cyclodextrin; (3) cellulose and its derivatives, such as sodium carboxymethyl cellulose, ethyl cellulose and cellulose acetate; (4) powdered gum tragacanth; (5) malt; (6) gelatin; (7) talc; (8) excipients, such as cocoa butter and suppository waxes; (9) oils such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil and soybean oil; (10) glycols, such as propylene glycol; (11) polyols such as glycerol, sorbitol, mannitol and polyethylene glycol; (12) esters such as ethyl oleate and ethyl laurate; (13) agar; (14) buffering agents such as magnesium hydroxide and aluminum hydroxide; (15) alginic acid; (16) pyrogen-free water; (17) isotonic saline; (18) ringer's solution; (19) ethanol; (20) phosphate buffer; and (21) other non-toxic compatible substances employed in pharmaceutical formulations.
In some embodiments, the composition for preventing and treating hyperlipidemia comprises an effective amount of the akkermansia muciniphila.
In the present invention, an "effective amount" refers to an amount of a component corresponding to the term that achieves treatment, prevention, alleviation and/or relief of a particular disease, disorder and/or condition in a subject, and in the present invention, without particular limitation, refers to an amount that achieves treatment, prevention, alleviation and/or relief of a hyperlipidemic disease, disorder and/or condition.
In the present invention, a "subject" is an animal, preferably a mammal, more preferably a human, including, but not limited to, consumers of food compositions and patients with diseases, disorders and/or symptoms. The subject of the present invention is preferably a mammal. The term "mammal" refers primarily to warm-blooded vertebrate mammals, including but not limited to: such as cat, dog, rabbit, bear, fox, wolf, monkey, deer, rat (such as rat, mouse), pig, cow, sheep, horse, human, etc., preferably primate, more preferably human.
In some embodiments, the subject is a mammal.
In some embodiments, the subject is a human or a mouse.
In the present invention, "patient" means an animal, preferably a mammal, more preferably a human. The term "mammal" refers primarily to warm-blooded vertebrate mammals, including but not limited to: such as cat, dog, rabbit, bear, fox, wolf, monkey, deer, rat, pig, cow, sheep, horse, human, etc., preferably primate, more preferably human.
In some embodiments, the composition for preventing and treating hyperlipidemia is a pharmaceutical composition. Further, the composition for preventing and treating hyperlipidemia contains a therapeutically effective amount of the akkermansia muciniphila.
In the present invention, "therapeutically effective amount" refers to the amount of a pharmaceutically active ingredient that will elicit the biological or medical response of an individual with respect to a disease, disorder and/or condition, e.g., the amount of a compound of the present invention that will elicit the physiological and/or pharmacological positive effect of the individual, including but not limited to reducing or inhibiting enzyme or protein activity or ameliorating symptoms, alleviating the disorder, slowing or delaying the progression of the disease or preventing the disease, etc.
Second aspect of the invention
In a second aspect of the invention there is provided the use of a composition comprising akkermansia muciniphila, as defined with reference to the first aspect of the invention, in the manufacture of a composition for the control of hyperlipidaemia.
Further, the akkermansia muciniphila is akkermansia muciniphila AM06 (with the preservation number of CGMCC No.22793), akkermansia muciniphila AM02 (with the preservation number of CGMCC No.22794) or a combination of the two.
In some embodiments, the composition comprising akkermansia muciniphila is a nutraceutical composition or a pharmaceutical composition.
Reference is made to the first aspect of the invention for the definitions of "composition", "prophylaxis", "nutraceutical composition" and "pharmaceutical composition".
In some embodiments, the active ingredient in the akkermansia muciniphila-containing composition is akkermansia muciniphila AM06 and/or akkermansia muciniphila AM02, i.e., is free of other ingredients having a hyperlipidemia controlling effect.
In the present invention, "active ingredient" means an ingredient having a hyperlipemia preventing and treating effect. The active ingredients in the invention at least comprise akkermansia muciniphila AM06 and/or akkermansia muciniphila AM 02.
In some embodiments, the akkermansia muciniphila-containing composition further comprises a second active ingredient.
In some embodiments, non-limiting examples of the second active ingredient include: one or more of fenofibrate, lovastatin, simvastatin, pravastatin, fluvastatin, atorvastatin, rosuvastatin, pitavastatin and the like.
In some embodiments, the akkermansia muciniphila-containing composition is a probiotic composition, and in addition to akkermansia muciniphila AM06 and/or akkermansia muciniphila AM02, contains other probiotics other than akkermansia muciniphila.
In some embodiments, the other probiotic bacteria other than akkermansia muciniphila may be selected from one or more of bacteroides fragilis, klebsiella, saccharomyces boulardii, lactobacillus rhamnosus, lactobacillus bifidus, and enterococcus hirae.
Third aspect of the present invention
The present invention provides a composition comprising akkermansia muciniphila, further comprising one or more of fenofibrate, lovastatin, simvastatin, pravastatin, fluvastatin, atorvastatin, rosuvastatin, and pitavastatin; the akkermansia muciniphila is as defined in the first aspect.
Reference is made to the first aspect for the definition of "composition" and "akkermansia muciniphila".
Fourth aspect of the invention
In a fourth aspect of the present invention, there is provided a method for preventing or treating hyperlipidemia, comprising administering to a subject an effective amount of akkermansia muciniphila (i.e., administering to the subject an effective amount of akkermansia muciniphila).
In a fourth aspect of the present invention, there is provided a method for preventing and treating hyperlipidemia, comprising administering to a subject an effective amount of a composition containing akkermansia muciniphila (i.e., administering to the subject an effective amount of a composition containing akkermansia muciniphila).
The definitions of "akkermansia muciniphila", "composition containing akkermansia muciniphila", "control", "effective amount", "active ingredient" can refer to the first or second aspect of the present invention.
In some embodiments, the mode of administration of the drug includes, but is not limited to: oral, rectal, parenteral (intravenous, intramuscular or subcutaneous) injection, and topical administration, inhalation.
In some embodiments, the pharmaceutical composition can be administered orally, enema, or parenterally.
In some of these embodiments, the administration period of the pharmaceutical composition can be intermittent, periodic, continuous, or chronic.
Solid dosage forms for oral administration may include capsules, tablets, pills, powders and granules. In these solid dosage forms, the active ingredient is mixed with at least one conventional inert excipient (or carrier), such as sodium citrate or dicalcium phosphate, or with the following: (a) fillers or extenders, for example, starch, lactose, sucrose, glucose, mannitol and silicic acid; (b) binders, for example, hydroxymethyl cellulose, alginates, gelatin, polyvinylpyrrolidone, sucrose, and acacia; (c) humectants, for example, glycerol; (d) disintegrating agents, for example, agar-agar, calcium carbonate, potato or tapioca starch, alginic acid, certain complex silicates, and sodium carbonate; (e) slow solvents, such as paraffin; (f) absorption accelerators, e.g., quaternary ammonium compounds; (g) wetting agents, such as cetyl alcohol and glycerol monostearate; (h) adsorbents, for example, kaolin; and (i) lubricants, for example, talc, calcium stearate, magnesium stearate, solid polyethylene glycols, sodium lauryl sulfate, or mixtures thereof. In capsules, tablets and pills, the dosage forms may also comprise buffering agents. Solid dosage forms such as tablets, dragees, capsules, pills, and granules can be prepared using coatings and shells such as enteric coatings and other materials well known in the art. They may contain opacifying agents and the release of the active compound or compounds in such compositions may be delayed in release in a certain part of the digestive tract. Examples of embedding components which can be used are polymeric substances and wax-like substances. If desired, the active compound may also be in microencapsulated form with one or more of the above-mentioned excipients.
Liquid dosage forms for oral administration include pharmaceutically acceptable emulsions, solutions, suspensions, syrups or tinctures. In addition to the active ingredients, the liquid dosage forms may contain inert diluents commonly employed in the art, such as water or other solvents, solubilizing agents and emulsifiers, for example, ethyl alcohol, isopropyl alcohol, ethyl carbonate, ethyl acetate, propylene glycol, 1, 3-butylene glycol, dimethylformamide, and oils, in particular, cottonseed, groundnut, corn germ, olive, castor and sesame oils or mixtures of these materials. In addition to these inert diluents, the compositions can also contain adjuvants such as wetting agents, emulsifying and suspending agents, sweetening, flavoring, and perfuming agents. If suspensions may contain suspending agents, for example, ethoxylated isostearyl alcohols, polyoxyethylene sorbitol and sorbitan esters, microcrystalline cellulose, aluminium methoxide and agar, or mixtures of these substances.
Compositions for parenteral injection may comprise physiologically acceptable sterile aqueous or anhydrous solutions, dispersions, suspensions or emulsions as well as sterile powders for reconstitution into sterile injectable solutions or dispersions. Suitable aqueous or nonaqueous carriers, diluents, solvents or vehicles include water, ethanol, polyols and suitable mixtures thereof.
Dosage forms for topical administration include ointments, powders, patches, sprays, and inhalants. Is prepared by mixing the active ingredient under sterile conditions with a pharmaceutically acceptable carrier, and with any preservatives, buffers, or propellants which may be required if desired.
The dosage form of the food composition may also be selected from suitable means in the dosage forms of the above-described pharmaceutical compositions, which can be selected by the skilled person depending on the mode of administration.
It will be appreciated that the medicaments of the embodiments of the invention may be formulated with various pharmaceutically acceptable excipients into suitable clinical dosage forms, including but not limited to those described above.
Some specific examples are provided below.
Embodiments of the present invention will be described in detail with reference to examples. It should be understood that these examples are for illustrative purposes only and are not intended to limit the scope of the present invention. The experimental procedures for the conditions not specified in the following examples, preferably with reference to the guidelines given in the present invention, may also be performed according to the experimental manual or the conventional conditions in the art, may also be performed according to the conditions suggested by the manufacturer, or may be performed according to the experimental procedures known in the art.
In the following specific examples, the measurement parameters relating to the components of the raw materials, if not specified otherwise, may be subject to slight deviations within the accuracy of the weighing. Temperature and time parameters are involved to allow for acceptable deviation due to instrument test accuracy or operational accuracy.
Example 1 isolation and characterization of Ackermanella muciniphila
Isolation and characterization of the AM02 Strain
Using a sterile spoon, the soybean feces (sample from an adult healthy male) were placed in a 10mL centrifuge tube and immediately transferred to a 37 ℃ anaerobic workstation (85% N) after sampling was completed 2 、10％H 2 、5％CO 2 ) According to the formula 1: 10 dilution mode the sample is diluted to 10 -9 And inoculating 1mL of each dilution solution into 9mL of a basal medium which takes mucin as a unique carbon source, and carrying out anaerobic culture for 7 days. Get 10 -4 1mL of the diluted inoculated culture solution was added as 1: 10 dilution method the culture solution is diluted to 10 -6 Each dilution (100. mu.L) was applied to a mucin agar medium, anaerobically cultured for 7 days, and a single colony was inoculated into 2mL of BHI broth (N-acetyl-D-glucosamine-containing medium, which may be referred to as BHI broth supplemented with GlcNAc). The cultured bacterial solution was subjected to 16S rRNA sequencing, and the 16S rRNA sequencing was performed by sequence alignment on NCBI database. The separated strain is identified as akkermansia muciniphila, and the 16S rRNA sequencing result is shown as the following SEQ ID No. 1:
GTGACGGGCGGGGTGCATAGACATGCAGTCGAACGAGAGAATTGCTAGCTTGCTAATAATTCTCTAGTGGCGCACGGGTGAGTAACACGTGAGTAACCTGCCCCCGAGAGCGGGATAGCCCTGGGAAACTGGGATTAATACCGCATAGTATCGAAAGATTAAAGCAGCAATGCGCTTGGGGATGGGCTCGCGGCCTATTAGTTAGTTGGTGAGGTAACGGCTCACCAAGGCGATGACGGGTAGCCGGTCTGAGAGGATGTCCGGCCACACTGGAACTGAGACACGGTCCAGACACCTACGGGTGGCAGCAGTCGAGAATCATTCACAATGGGGGAAACCCTGATGGTGCGACGCCGCGTGGGGGAATGAAGGTCTTCGGATTGTAAACCCCTGTCATGTGGGAGCAAATTAAAAAGATAGTACCACAAGAGGAAGAGACGGCTAACTCTGTGCCAGCAGCCGCGGTAATACAGAGGTCTCAAGCGTTGTTCGGAATCACTGGGCGTAAAGCGTGCGTAGGCTGTTTCGTAAGTCGTGTGTGAAAGGCGCGGGCTCAACCCGCGGACGGCACATGATACTGCGAGACTAGAGTAATGGAGGGGGAACCGGAATTCTCGGTGTAGCAGTGAAATGCGTAGATATCGAGAGGAACACTCGTGGCGAAGGCGGGTTCCTGGACATTAACTGACGCTGAGGCACGAAGGCCAGGGGAGCGAAAGGGATTAGATACCCCTGTAGTCCTGGCAGTAAACGGTGCACGCTTGGTGTGCGGGGAATCGACCCCCTGCGTGCCGGAGCTAACGCGTTAAGCGTGCCGCCTGGGGAGTACGGTCGCAAGATTAAAACTCAAAGAAATTGACGGGGACCCGCACAAGCGGTGGAGTATGTGGCTTAATTCGATGCAACGCGAAGAACCTTACCTGGGCTTGACATGTAATGAACAACATGTGAAAGCATGCGACTCTTCGGAGGCGTTACAACAGGTGCTGCATGGCCGTCGTCAGCTCGTGTCGTGAGATGTTTGGTTAAGTCCAGCAACGAGCGCAACCCCTGTTGCCAGTTACCAGCACGTGAAGGTGGGGACTCTGGCGAGACTGCCCAGATCAACTGGGAGGAAGGTGGGGACGACGTCAGGTCAGTATGGCCCTTATGCCCAGGGCTGCACACGTACTACAATGCCCAGTACAGAGGGGGCCGAAGCCGCGAGGCGGAGGAAATCCTGAAAACTGGGCCCAGTTCGGACTGTAGGCTGCAACCCGCCTACACGAAGCCGGAATCGCTAGTAATGGCGCATCAGCTACGGCGCCGTGAATACGTTCCCGGGTCTTGTACACACCGCCCGTCACATCATGGAAGCCGGTCGCACCCGAAGTATCTGAAGCCAACCGCAAGGAGGCAGGTCCTAAGGTAGACTACTGTCTAT
the 16S sequence alignment of SEQ ID NO 1 with ATCC BAA-835 shows a Per.Ident value of 99.43%.
Isolation and characterization of the AM06 Strain
Freshly collected breast milk samples (from adult healthy women) were immediately injected into 5mL anaerobic vials for storage, and then transferred to a 37 ℃ anaerobic workstation (85% N) 2 、10％H 2 、5％CO 2 ) According to the formula 1: 10 dilution mode the sample is diluted to 10 -6 And inoculating 1mL of each dilution solution into 9mL of a basal medium which takes mucin as a unique carbon source, and carrying out anaerobic culture for about 1 month. Get 10 -1 -10 -4 1mL of the diluted inoculated culture solution was added as 1: 10 dilution method the culture solution is diluted to 10 -6 Each 100. mu.L dilution was applied to a mucin agar medium, anaerobically cultured for 7 days, and a single colony was inoculated into 2mL of BHI broth (medium containing N-acetyl-D-glucosamine). 16S rRNA sequencing identification is carried out on the cultured bacterial liquid, the 16S rRNA sequence is listed on an NCBI database for sequence comparison, the result is identified as the akkermansia muciniphila, and the sequencing result of the 16S rRNA is shown as the following SEQ ID No. 2:
CGGATTACGGCGTGCTAAGACTGCAGTCGACGAGAGATTGCTAGCTTGCTAATAATTCTCTAGTGGCGCACGGGTGAGTAACACGTGAGTAACCTGCCCCCGAGAGCGGGATAGCCCTGGGAAACTGGGATTAATACCGCATAGTATCGAAAGATTAAAGCAGCAATGCGCTTGGGGATGGGCTCGCGGCCTATTAGTTAGTTGGTGAGGTAACGGCTCACCAAGGCGATGACGGGTAGCCGGTCTGAGAGGATGTCCGGCCACACTGGAACTGAGACACGGTCCAGACACCTACGGGTGGCAGCAGTCGAGAATCATTCACAATGGGGGAAACCCTGATGGTGCGACGCCGCGTGGGGGAATGAAGGTCTTCGGATTGTAAACCCCTGTCATGTGGGAGCAAATTAAAAAGATAGTACCACAAGAGGAAGAGACGGCTAACTCTGTGCCAGCAGCCGCGGTAATACAGAGGTCTCAAGCGTTGTTCGGAATCACTGGGCGTAAAGCGTGCGTAGGCTGTTTCGTAAGTCGTGTGTGAAAGGCGCGGGCTCAACCCGCGGACGGCACATGATACTGCGAGACTAGAGTAATGGAGGGGGAACCGGAATTCTCGGTGTAGCAGTGAAATGCGTAGATATCGAGAGGAACACTCGTGGCGAAGGCGGGTTCCTGGACATTAACTGACGCTGAGGCACGAAGGCCAGGGGAGCGAAAGGGATTAGATACCCCTGTAGTCCTGGCAGTAAACGGTGCACGCTTGGTGTGCGGGGAATCGACCCCCTGCGTGCCGGAGCTAACGCGTTAAGCGTGCCGCCTGGGGAGTACGGTCGCAAGATTAAAACTCAAAGAAATTGACGGGGACCCGCACAAGCGGTGGAGTATGTGGCTTAATTCGATGCAACGCGAAGAACCTTACCTGGGCTTGACATGTAATGAACAACATGTGAAAGCATGCGACTCTTCGGAGGCGTTACACAGGTGCTGCATGGCCGTCGTCAGCTCGTGTCGTGAGATGTTTGGTTAAGTCCAGCAACGAGCGCAACCCCTGTTGCCAGTTACCAGCACGTGAAGGTGGGGACTCTGGCGAGACTGCCCAGATCAACTGGGAGGAAGGTGGGGACGACGTCAGGTCAGTATGGCCCTTATGCCCAGGGCTGCACACGTACTACAATGCCCAGTACAGAGGGGGCCGAAGCCGCGAGGCGGAGGAAATCCTAAAAACTGGGCCCAGTTCGGACTGTAGGCTGCAACCCGCCTACACGAAGCCGGAATCGCTAGTAATGGCGCATCAGCTACGGCGCCGTGAATACGTTCCCGGGTCTTGTACACACCGCCCGTCACATCATGGAAGCCGGTCGCACCCGAAGTCATTACTGAAGCCAACCGCAAGGAGGCAGGTCCTAAAGTGAGACTATAACAA
the 16S sequence alignment of SEQ ID NO 2 with ATCC BAA-835 shows a Per.Ident value of 99.22%.
1.3. Culture of Ackermanella muciniphila
Ackermans muciniphila strains were streaked onto BHA plates and cultured anaerobically for 3 days. Observing the morphological characteristics, staining characteristics, size, club shape, distribution and the like of colonies.
Colony characteristics: after culturing Ackermansia muciniphila AM02 and AM06 on the above culture medium for 3 days, colonies with circular convex, regular edges, opacity, white color and nonuniform size are presented, as shown in FIG. 1 (Ackermansia muciniphila AM02) and FIG. 2 (Ackermansia muciniphila AM 06).
Microscopic morphology: gram-stained microscopy of akkermansia muciniphila AM02 and AM06, gram-negative bacteria, in an oval, single or chain-like arrangement, is shown in fig. 3 (akmansia muciniphila AM02) and fig. 4 (akmansia muciniphila AM 06).
Selecting a single bacterial colony to be inoculated into BHI broth to be cultured for 48 hours (the temperature is 37 ℃), centrifuging the obtained bacterial liquid for precipitation at the rotating speed of 16000 Xg for 30min, removing supernatant, and collecting precipitate to obtain the akkermansia muciniphila bacterial mud. Respectively culturing to obtain AM02, AM06 and ATCC BAA-835 Ackermansia muciniphila.
Example 2 resistance of Ackermanella muciniphila to Artificial gastric juice
(1) Experimental methods and groups
TABLE 1 Experimental groups
Figure BDA0003684158710000091
Figure BDA0003684158710000101
TABLE 2 Experimental methods
Figure BDA0003684158710000102
"+" indicates that detection is required
1) Taking 1 Ackermanella muciniphila strain, removing the label, wiping and disinfecting the outer surface of the glycerol cryopreservation tube by 75% alcohol, uniformly mixing by vortex oscillation, and starting. And (3) inoculating 500 mu L of 100-one strain liquid into 10 mL/tube of BHI broth, shaking uniformly, preparing 3 tubes in total, simultaneously taking no inoculated strain as a negative control, and placing at 37 ℃ for anaerobic culture for 2-4 days to obtain a primary seed liquid.
The first-level seed liquid is subjected to gram staining microscopic examination, and is G-bacillus free, spore-free and free of mixed bacteria.
2) Centrifuging 10mL of the first-stage seed solution at 12000 Xg and 4 ℃ for 10min, removing the supernatant, adding 1mL of 0.9% NaCl solution for resuspension, and respectively preparing bacterial solutions for later use.
3) AM06, AM02 and the standard strain bacteria liquid are respectively added into artificial gastric juice with 0.9 percent of NaCl, pH3 and pH2 according to the table 2, evenly mixed, subpackaged into 5 mL/tube, placed in an anaerobic glove box for incubation for 0 hour, 1.5 hours and 3 hours at 37 ℃, and then taken out to detect the bacteria concentration of each sample. Each experimental group was done in 3 replicates.
And (3) viable count determination:
taking the test sample, after 10 times serial dilution, taking 100 mu L of diluent to inoculate to a BHA plate, evenly coating, making 2 plates for each dilution, generally making 2-3 dilutions, simultaneously taking 100 mu L of diluent to inoculate to the BHA plate as a negative control, culturing all coated plates under the condition of positive anaerobic condition for about 3-5 days, observing the growth condition of bacterial colonies on the plates, and counting.
Calculating the viable count according to the sum of the colony counts of the 2 plates according to the following formula:
viable count (CFU/mL) ═ 2 plate colonies/2X 10 Xfinal dilution
And (3) survival rate calculation:
Figure BDA0003684158710000103
(2) results of the experiment
TABLE 3 statistical table of results of artificial gastric juice tolerance survival rate of akkermansia muciniphila
Figure BDA0003684158710000104
As can be seen from the table, the artificial gastric juice resistance of the different Ackermania muciniphila strains is in turn AM02> AM06> standard strain.
Example 3 resistance of Ackermanella muciniphila to Artificial intestinal juice
(1) Experimental methods and groups
TABLE 4 Experimental groups
Figure BDA0003684158710000111
1) First order seed liquid preparation
Taking 1 Ackermanella muciniphila strain, removing the label, wiping and disinfecting the outer surface of the glycerol cryopreservation tube by 75% alcohol, uniformly mixing by vortex oscillation, and starting. And (3) inoculating 100 mu L of bacterial liquid into 10 mL/tube of BHI broth, shaking up, preparing 3 tubes in total, simultaneously taking no inoculated bacteria as a negative control, and placing at 37 ℃ for anaerobic culture for 2-4 days to obtain a first-grade seed liquid.
The first-level seed liquid is subjected to gram staining microscopic examination, and is G-bacillus free, spore-free and free of mixed bacteria.
2) Preparation of bacterial sludge
Respectively packaging the primary seed liquid into 1.5 mL/tube, centrifuging at 12000rpm for 10min, discarding supernatant to obtain bacterial sludge, and preparing 3 tubes of bacterial sludge from AM06, AM02 and standard strain.
3) Strain artificial intestinal juice tolerance evaluation
As shown in table 5, 1.5mL of artificial intestinal juice was added to each tube of the bacterial sludge prepared in 2), mixed, and then each tube of solution was dispensed at 0.5 mL/tube, 3 tubes were dispensed, and anaerobic incubation was performed at 37 ℃ for 0h, 4h, and 8h, and the number of viable bacteria was detected by sampling. Each group was made in 3 replicates.
TABLE 5 Experimental methods
Figure BDA0003684158710000112
"+" indicates that detection is required
Viable count determination
Respectively taking incubated samples, inoculating 100 mu L of diluent to a BHA plate, uniformly coating, making 2 plates for each dilution, generally making 2-3 dilutions, simultaneously taking 100 mu L of diluent to the BHA plate, using the dilution as a negative control, culturing all the coated plates under the positive anaerobic condition for about 3-5 days, observing the growth condition of bacterial colonies on the plates, and counting.
Viable count (CFU/mL) ═ 2 plate colonies/2X 10 Xfinal dilution
Survival rate calculation
Survival rate is viable count at each time point/viable count corresponding to 0h multiplied by 100%
(2) Results of the experiment
TABLE 6 survival rate statistics table
Figure BDA0003684158710000113
As shown in the table, the artificial intestinal juice of ATCC BAA-835, AM02 and AM06 strains has good tolerance.
Example 4 non-targeted Metabolic differential analysis of Ackermanella muciniphila culture supernatant
(1) Sample preparation
After the culture of each Ackermanella muciniphila (AM02, AM06, ATCC BAA-835) in example 1 was completed, 1ml of each cell suspension was centrifuged at 12000rpm for 5min, and the supernatant was filtered through a 0.22 μm filter, and then the filtrate was used as a sample to be tested to conduct non-targeted metabonomics analysis. For each strain, 5 replicates of the test sample were prepared.
(2) Results of the experiment
PCA is a data dimension reduction method, namely, a plurality of variables are reduced to a group of new comprehensive variables, and then the first few principal components reflecting the original variable information as much as possible are selected from the new comprehensive variables, so that the purpose of dimension reduction is achieved. The PCA diagram reflects the real distribution of the sample, is mainly used for observing the separation trend among sample groups and whether abnormal points appear or not, and reflects the variation degree among the groups and in the groups from the original data.
The results of the experiments are shown in FIG. 5, which includes QC samples and PCA analysis of all samples. And each QC sample is homopolymerized together in the two principal component analysis diagrams, so that the instrument is stable during the detection period, and the repeatability of the acquired data is good. The results also show that the metabolites in the AM06 culture supernatant are closer to those of BAA-835, and that the metabolites in the AM02 culture supernatant are more different from those of BAA-835.
The results of comparing the amounts of the different metabolites among the strains are shown in Table 7. It can be seen that the positive ion (pos) pattern of the AM02 detected the differential metabolite and the negative ion (neg) pattern of the AM detected the differential metabolite of 205 and 135, respectively, compared to the standard strain BAA-835, and that the positive ion (pos) pattern of the AM06 detected the differential metabolite and the negative ion (neg) pattern of the AM detected the differential metabolite of 111 and 62, respectively, compared to the standard strain BAA-835.
TABLE 7 statistical Table of differential metabolites
Figure BDA0003684158710000121
Example 5 drug effect experiment of Ackermansia muciniphila for preventing hyperlipidemia in mice
1. Experimental design and procedure
Male mice of SPF grade Kunming species 150 mice, with body mass (20 ± 2) g, were randomly divided into 15 groups: normal control group, model group, simvastatin group (positive drug, 3.33mg/kg), and AKK AM06 viable bacteria low dose (10) 6 CFU/only), high dose (10) 10 CFU/only) group, AM02 live bacteria low dose (10) 6 CFU/only), high dose (10) 10 CFU/only), AM06 and AM02 live bacteria combination group (10) 10 CFU/only; 10 10 CFU/only), BAA-835 live bacteria (10) 10 CFU/only), low dose of the killed AKK strain AM06 (10) 6 CFU/only), high dose (10) 10 cell/cell), low dose of AM02 inactivated bacteria (10) 6 CFU/only), high dose (10) 10 cell/cell), group of inactivated bacteria AM06 and AM02 (10) 10 CFU/only; 10 10 CFU/only), BAA-835 inactivated bacteria (10) 10 cell/cell) groups of 10 cells each.
Except for the normal control group, the mice of each group were fed with high fat diet (lard 10%, yolk cholesterol, choline sui 10%, cholesterol 1%, choline sui 0.2%, basal diet 78.8%), and the normal control group was fed with basal diet, and the experiment was started after 1 week of adaptive feeding (D0). From D0, the mice of the normal control group and the model group are perfused with 0.5mL of normal saline, and the corresponding dose of the drug is perfused to each administration group once a day and continuously administered for 60 days.
The content of bile salts in the mouse feces was measured every 20 days by uv spectrophotometry. After fasting for 12h after the last administration, the orbital venous plexus was bled and the serum Total Cholesterol (TC), Triglyceride (TG), high density lipoprotein (HDL-C), low density lipoprotein (LDL-C) levels were measured using the kit.
All data were statistically analyzed using SPSS 25.0. P <0.05 was considered statistically different.
2. Results of the experiment
(1) Mouse serum fat related index
TABLE 8 serum fat related index (mean + -SD) for each group of mice
Figure BDA0003684158710000122
Figure BDA0003684158710000131
Note: indicates a significant difference p <0.05 compared to model group; indicates a very significant difference p < 0.01.
TC, TG, HDL-C and LDL-C are different lipids contained in blood, and they directly reflect the blood lipid content. Any one of the above-mentioned drugs is higher than the standard value, and the disease is hyperlipidemia.
As shown in the table above, compared with the normal control group, the TC, TG and LDL-C of the model group are all increased, and the HDL-C is remarkably reduced, which indicates that the molding is successful.
The serum TC, TG, LDL-C levels of the mice were down-regulated to different degrees in each administration group compared to the model group. In the AKK group, the AM06 effect is similar to AM 02.
Compared with the model group, the serum HDL-C level of the mice is up-regulated to different degrees in each administration group, wherein simvastatin has a significant difference. In the AKK group, the AM06 effect is similar to AM 02. The above results indicate that AKK is effective in regulating blood lipid levels.
(2) Bile salts of feces
TABLE 9 content of bile salts of feces of mice (mean. + -. SD) of each group
Figure BDA0003684158710000132
Note: indicates a significant difference p <0.05 compared to model group; indicates a very significant difference p < 0.01.
The main way of degrading the cholesterol in vivo is to discharge bile acid out of the body through a bile duct system, so the amount of the reduced cholesterol can be indirectly obtained by measuring the content of free cholate, and the effect of reducing the blood fat is further shown.
As shown in the above table, at the beginning of the experiment, there was no significant difference in fecal cholate content among the groups of mice; during the experiment, the content of the normal control group mouse fecal cholate is maintained to be stable, and the content of the model group mouse fecal cholate is reduced slightly, which shows that the cholesterol degradation capability of the hyperlipidemic mouse is reduced. The content of the fecal cholate of the simvastatin group mice is similar to that of the normal control group mice; in each group of AKK bacteria, the content of the bile acid salt in the mouse feces gradually increases along with the progress of the experiment, which shows that the AKK bacteria can enhance the cholesterol degradation capability of the mouse. In the AKK group, the AM06 effect is similar to AM 02.
In conclusion, the akkermansia muciniphila can improve the cholesterol degradation capability in a mouse, regulate the TC, TG and HDL-C, LDL-C content of serum and effectively improve the hyperlipidemia of the mouse.
Example 6 drug effect experiment of Ackermansia muciniphila for treating hyperlipidemia in mice
1. Experimental design and procedure
100 SPF-level Kunming mice, half of each male and female, with the body mass (20 +/-2) g, are subjected to laboratory adaptive feeding for 1 week, and then the model is made: randomly selecting 80 mice, and feeding high-fat feed (4% cholesterol, 10% lard, 0.2% methyl thiouracil and 86% basal feed); the remaining 20 mice were fed basal diet.
After feeding for 4 weeks, according to the serum detection result of the mice, 80 mice successfully molded are selected and randomly divided into 8 groups: model group, fenofibrate group (positive drug, 30mg/kg), and AKK bacterium AM06 viable bacterium (10) 10 CFU/only) group, AM02 live bacteria (10) 10 CFU/only), group of live AM06 in combination with fenofibrate (10) 10 CFU/only, 30mg/kg), AKK bacteria AM06, AM02 killed bacteria group (10) 10 cell/cell), AM06 inactivated bacteria in combination with fenofibrate (10) 10 CFU/one, 30mg/kg), 10 per group. Another 10 unmolded mice were used as normal control groups.
Administration was started upon grouping (D0): the normal control group and the model group are infused with 0.5mL of physiological saline every day; each administration group was administered with the corresponding dose of the drug once a day for 60 days. During the administration period, mice of each group were fed with high-fat diet except for the normal control group; the normal control group was fed basal diet.
After fasting for 12h after the last administration, the orbital venous plexus was bled and the serum Total Cholesterol (TC), Triglyceride (TG), high density lipoprotein (HDL-C), low density lipoprotein (LDL-C) levels were measured using the kit. Collecting the mouse feces, and measuring the content of cholate in the feces by an ultraviolet spectrophotometry.
All data were statistically analyzed using SPSS 25.0. P <0.05 was considered statistically different.
2. Results of the experiment
(1) Mouse serum fat related index
TABLE 10 serum fat related indices (mean + -SD) for each group of mice
Figure BDA0003684158710000141
Note: indicates a significant difference p <0.05 compared to model group; indicates a very significant difference p < 0.01.
As shown in the above table, TC was increased, TG and LDL-C were significantly increased in the model group as compared with the normal control group; HDL-C is reduced, which indicates that the molding is successful.
The serum TC, TG, LDL-C levels of the mice were down-regulated to different degrees in each administration group compared to the model group. In the AKK group, the AM06 effect is similar to AM 02.
Compared with the model group, the serum HDL-C level of the mice is up-regulated to different degrees in each administration group, and the AM06 effect is similar to that of AM02 in the AKK bacteria group. The results show that AKK can effectively regulate the blood lipid level of mice.
(2) Fecal bile acid
TABLE 11 content of bile acid in mouse feces (mean. + -. SD) of each group
Group of Cholate (μ g/g)
Normal control group 54.54±4.42*
Model set 115.63±9.38
Fenofibrate group 128.82±9.04
Live bacterium AM06 126.23±9.81
Live bacterium AM02 120.75±8.46
AM06 live bacterium and fenofibrate group 135.86±9.45*
AM06 inactivated bacterium group 121.37±9.74
AM02 inactivated bacterium group 119.67±8.89
AM06 inactivated bacteria + fenofibrate group 129.79±9.72*
Note: indicates a significant difference p <0.05 compared to model group; indicates a very significant difference p < 0.01.
As shown in the above table, at the end of the experiment, the fecal cholate content of the model mice was significantly increased compared to that of the normal control mice, because the metabolic level was relatively high due to the higher blood cholesterol content of the model mice;
compared with the model group mice, the content of the fecal bile acid of the mice in each administration group is increased, wherein the content of the fecal bile acid salt of the mice in each group of AM06 is equivalent to that of the fenofibrate group. This shows that AKK bacteria can improve blood cholesterol metabolism level of mice with hyperlipemia, and in AKK bacteria group, AM06 effect is similar to AM 02.
Example 7 pharmacodynamic experiment of Ackermansia muciniphila in combination with fenofibrate on treatment of hyperlipidemia in mice
1. Experimental design and procedure
140 SPF SD female rats weighing 220-260g, after 1 week of laboratory adaptive feeding, model building is started: randomly selecting 120 rats, and feeding high-fat feed (5% cholesterol, 20% lard, 2% propylthiouracil, 73% basal feed); the remaining 20 rats were fed basal diet.
After feeding for 2 weeks, 120 rats successfully molded were randomly selected according to the serum test results of the rats, and were randomly divided into 12 groups of 10 rats each. The animal groups comprise a model group, a positive medicine group (simvastatin), an AKK AM06 viable bacteria group, an AKK AM06 viable bacteria combined simvastatin group, an AKK AM02 viable bacteria group, an AKK AM02 viable bacteria combined simvastatin group, a BAA-835 viable bacteria group, an AM06 inactivated bacteria group, an AM02 inactivated bacteria group, an AM06 inactivated bacteria combined simvastatin group, an AM02 inactivated bacteria combined simvastatin group and a BAA-835 inactivated bacteria group. Another 10 unmolded rats were used as normal control groups. See table 11 for details.
Administration was started upon grouping (D0): the normal control group and the model group are infused with 0.5mL of physiological saline every day; the fenofibrate group is administered with the corresponding dose of drug once a day for 8 weeks. During the administration period, rats in each group except the normal control group were fed with high-fat diet; the normal control group was fed basal diet.
After fasting for 12h after the last administration, the orbital venous plexus was bled and the serum Total Cholesterol (TC), Triglyceride (TG), high density lipoprotein (HDL-C), low density lipoprotein (LDL-C) levels were measured using the kit. Collecting rat feces, and measuring the content of cholate in the feces by an ultraviolet spectrophotometry method.
All data were statistically analyzed using SPSS 25.0. P <0.05 was considered statistically different.
TABLE 12 animal grouping and dosing
Group of Administration 1 Administration 2
Normal control group Physiological saline 0.5mL Physiological saline 0.5mL
Model set Physiological saline 0.5mL Physiological saline 0.5mL
Positive drug group Simvastatin 10mg/kg Physiological saline 0.5mL
Live bacterium AM06 Physiological saline 0.5mL Live AM06 bacteria 10 10 CFU/only
AM06 live bacteria + simvastatin group Simvastatin 10mg/kg Live AM06 bacteria 10 10 CFU/only
AM02 live bacterium group Physiological saline 0.5mL Live AM02 bacteria 10 10 CFU/only
AM02 live bacteria + simvastatin group Simvastatin 10mg/kg Live AM02 bacteria 10 10 CFU/only
BAA-835 live bacteria Physiological saline 0.5mL BAA-835 live bacteria 10 10 CFU/only
AM06 live-killing bacteria Physiological saline 0.5mL AM06 live-killing bacterium 10 10 cell/cell
AM02 live-killing bacteria Physiological saline 0.5mL AM02 live-kill bacteria 10 10 cell/cell
AM06 inactivated bacteria + simvastatin group Simvastatin 10mg/kg AM06 live-kill bacteria 10 10 cell/cell
AM02 inactivated bacteria + simvastatin group Simvastatin 10mg/kg AM02 live-kill bacteria 10 10 cell/cell
BAA-835 inactivated bacteria Physiological saline 0.5mL AM02 live-kill bacteria 10 10 cell/cell
2. Results of the experiment
(1) Mouse serum fat related index
TABLE 13 serum fat related indices (mean + -SD) for each group of mice
Figure BDA0003684158710000151
Figure BDA0003684158710000161
Note: indicates a significant difference p <0.05 compared to model group; indicates a very significant difference p < 0.01.
As shown in the above table, TC was increased, TG and LDL-C were significantly increased in the model group as compared with the normal control group; HDL-C is reduced, which indicates that the molding is successful.
Compared with a model group, the administration groups down-regulate the TC, TG and LDL-C levels of the mouse serum to different degrees, the administration groups up-regulate the HDL-C level of the mouse serum to different degrees, the AM06 effect is similar to that of AM02 in an AKK bacterial group, and the live bacteria and the inactivated bacteria have better similar effects. The results show that AKK can effectively regulate the blood lipid level of mice.
In conclusion, the akkermansia muciniphila can improve the cholesterol degradation capability in a mouse, regulate the TC, TG and HDL-C, LDL-C content of serum and effectively improve the hyperlipoidemia level of the mouse.
The technical features of the above embodiments and examples can be combined in any suitable manner, and for the sake of brevity, all possible combinations of the technical features of the above embodiments and examples are not described, however, as long as there is no contradiction between the combinations of the technical features, the combinations of the technical features should be considered to be within the scope of the description in the present specification.
The above examples only show some embodiments of the present invention, so as to facilitate the detailed and detailed understanding of the technical solutions of the present invention, but not to be construed as limiting the scope of the present invention. It should be noted that, for a person skilled in the art, several variations and modifications can be made without departing from the inventive concept, which falls within the scope of the present invention. Furthermore, it should be understood that various changes or modifications can be made by those skilled in the art after reading the above teachings of the present invention, and equivalents obtained thereby also fall within the scope of the present invention. It should also be understood that the technical solutions provided by the present invention, which are obtained by logical analysis, reasoning or limited experiments, are within the scope of the present invention as set forth in the appended claims. Therefore, the protection scope of the present patent shall be subject to the content of the appended claims, and the description and drawings can be used to explain the content of the claims.

Claims (10)

1. The application of akkermansia muciniphila in preparing a pharmaceutical composition for preventing and treating hyperlipidemia or a health-care product composition for improving the blood lipid level is characterized in that the akkermansia muciniphila is akkermansia muciniphila AM06, akkermansia muciniphila AM02 or the combination of the akkermansia muciniphila AM06 and the akkermansia muciniphila AM 02; wherein,
the akkermansia muciniphila AM06 is preserved in the China general microbiological culture Collection center of China Committee for culture Collection of microorganisms at 28 th month 06 in 2021, with the preservation number of CGMCC No. 22793;
the akkermansia muciniphila AM02 is preserved in the China general microbiological culture Collection center of China Committee for culture Collection of microorganisms at 28 th month 06 in 2021, and the preservation number is CGMCC No. 22794.
2. The use of claim 1, wherein said akkermansia muciniphila AM06 and said akkermansia muciniphila AM02 are each independently a live bacterium, a killed bacterium, or a combination of live and killed bacteria.
3. The use according to claim 2, wherein the pharmaceutical composition is a medicament in the form of a tablet, capsule, granule, pill, paste, solution, suspension, emulsion, cream, spray, drop, patch or tube feed; and/or the first and/or second light sources,
the health-care product composition is a health-care food, and the dosage form of the health-care product composition is pills, tablets, granules, capsules, solutions, suspensions or emulsions.
4. The use according to any one of claims 1 to 3, wherein the pharmaceutical composition or nutraceutical composition comprises an effective amount of Ackermansia muciniphila.
5. The use of any one of claims 1 to 3, wherein the subject is a mammal; optionally, the subject is a human or a mouse.
6. Use of a composition comprising akkermansia muciniphila for the preparation of a pharmaceutical composition for the prevention and treatment of hyperlipidemia or for the preparation of a nutraceutical composition for the improvement of blood lipid levels, characterized in that akkermansia muciniphila is as defined in claim 1 or 2.
7. The use of claim 6, wherein the composition comprising akkermansia muciniphila is a nutraceutical composition or a pharmaceutical composition.
8. The use of claim 6, wherein the Ackermansia muciniphila-containing composition is a probiotic composition, and wherein the probiotic composition further comprises a probiotic other than the Ackermansia muciniphila.
9. The use according to any one of claims 6 to 8, wherein the composition comprising akkermansia muciniphila further comprises a second active ingredient which is a different drug to the akkermansia muciniphila.
10. A composition comprising akkermansia muciniphila, characterized in that the composition further comprises one or more of fenofibrate, lovastatin, simvastatin, pravastatin, fluvastatin, atorvastatin, rosuvastatin and pitavastatin; the akkermansia muciniphila is as defined in claim 1 or 2.
CN202210652479.1A 2022-06-08 2022-06-08 Application of akkermansia muciniphila in preparation of composition for preventing and treating hyperlipidemia and composition containing akkermansia muciniphila Active CN114949004B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202210652479.1A CN114949004B (en) 2022-06-08 2022-06-08 Application of akkermansia muciniphila in preparation of composition for preventing and treating hyperlipidemia and composition containing akkermansia muciniphila

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202210652479.1A CN114949004B (en) 2022-06-08 2022-06-08 Application of akkermansia muciniphila in preparation of composition for preventing and treating hyperlipidemia and composition containing akkermansia muciniphila

Publications (2)

Publication Number Publication Date
CN114949004A true CN114949004A (en) 2022-08-30
CN114949004B CN114949004B (en) 2024-04-26

Family

ID=82961282

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202210652479.1A Active CN114949004B (en) 2022-06-08 2022-06-08 Application of akkermansia muciniphila in preparation of composition for preventing and treating hyperlipidemia and composition containing akkermansia muciniphila

Country Status (1)

Country Link
CN (1) CN114949004B (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2023237067A1 (en) * 2022-06-08 2023-12-14 广州知易生物科技有限公司 Use of akkermansia muciniphila in preparation of pharmaceutical composition or health care product composition for improving metabolic syndrome

Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101809172B1 (en) * 2016-07-11 2017-12-14 한국생명공학연구원 Composition for preventing, improving or treating metabolic disease comprising Akkermansia muciniphila strain or its culture broth cultivated in medium without mucin as effective component
CN110964650A (en) * 2018-09-27 2020-04-07 上海上药信谊药厂有限公司 Bacterial strain for preventing and treating metabolic diseases and application thereof
CN113230387A (en) * 2021-04-06 2021-08-10 慕恩（广州）生物科技有限公司 Combined medicine containing microorganism and blood sugar and blood fat reducing medicine
CN113330109A (en) * 2018-10-11 2021-08-31 Ko生物技术有限公司 Akkermansia muciniphila strain and application thereof
US20220133811A1 (en) * 2019-08-23 2022-05-05 Enterobiome Inc. Akkermansia muciniphila eb-amdk27 strain and use thereof
CN114569638A (en) * 2022-03-03 2022-06-03 中国农业大学 Ackermanella muciniphila microecological preparation and application thereof to laying hens

Patent Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101809172B1 (en) * 2016-07-11 2017-12-14 한국생명공학연구원 Composition for preventing, improving or treating metabolic disease comprising Akkermansia muciniphila strain or its culture broth cultivated in medium without mucin as effective component
CN110964650A (en) * 2018-09-27 2020-04-07 上海上药信谊药厂有限公司 Bacterial strain for preventing and treating metabolic diseases and application thereof
CN113330109A (en) * 2018-10-11 2021-08-31 Ko生物技术有限公司 Akkermansia muciniphila strain and application thereof
US20220133811A1 (en) * 2019-08-23 2022-05-05 Enterobiome Inc. Akkermansia muciniphila eb-amdk27 strain and use thereof
CN113230387A (en) * 2021-04-06 2021-08-10 慕恩（广州）生物科技有限公司 Combined medicine containing microorganism and blood sugar and blood fat reducing medicine
CN114569638A (en) * 2022-03-03 2022-06-03 中国农业大学 Ackermanella muciniphila microecological preparation and application thereof to laying hens

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
吴艳丽等: "嗜黏蛋白阿克曼氏菌 ATCC BAA-835 肠道益生作用的体外评价", 食品与发酵工业, vol. 48, no. 2, pages 156 - 162 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2023237067A1 (en) * 2022-06-08 2023-12-14 广州知易生物科技有限公司 Use of akkermansia muciniphila in preparation of pharmaceutical composition or health care product composition for improving metabolic syndrome

Also Published As

Publication number Publication date
CN114949004B (en) 2024-04-26

Similar Documents

Publication Publication Date Title
CN114832019A (en) Application of akkermansia muciniphila in preparation of pharmaceutical composition for preventing and treating obesity, composition and application thereof
WO2023237067A1 (en) Use of akkermansia muciniphila in preparation of pharmaceutical composition or health care product composition for improving metabolic syndrome
CN112501046B (en) Lactobacillus fermentum with weight-losing function and application thereof
CN108641988B (en) Lactobacillus plantarum NA136 and application thereof in relieving non-alcoholic fatty liver disease
US11273189B2 (en) Lactobacillus plantarum TCI378 and its uses in losing fat and improving gastrointestinal functions
CN110218681A (en) One plant of lactobacillus fermenti KP101 and its application
TW202300161A (en) Lactobacillus plantarum hg-23 and application thereof
CN114949003B (en) Acremonium muciniphilum, application and culture method thereof
CN115381859A (en) Application of akkermansia muciniphila in preparation of pharmaceutical composition for preventing and treating diabetes, composition and application thereof
CN116836893B (en) Lactobacillus paracasei, and metaplastic product and application thereof
CN114949004A (en) Application of akkermansia muciniphila in preparation of composition for preventing and treating hyperlipidemia and composition containing akkermansia muciniphila
CN114949002B (en) Application of akkermansia muciniphila in preparation of composition for preventing and treating atherosclerosis
TW202207957A (en) Novel bifidobacterium breve idcc 4401 strain having high resistance ability of acid and bile salt and effect of preventing or treating dyslipidemia, and their killed form id-bbr4401
CN115804793A (en) Application of akkermansia muciniphila in preparation of composition for improving alcoholic liver dysfunction, composition and application
CN115252651A (en) Application of akkermansia muciniphila in preparation of composition for preventing and treating hypertension and composition containing akkermansia muciniphila
CN116004472A (en) Clostridium butyricum for relieving obesity and application thereof
WO2021134740A1 (en) Tibetan pig fecal microbiota capsule for relieving diarrhea in weaned piglet, and preparation method therefor
WO2022016806A1 (en) Use of dubosiella newyorkensis for prevention or treatment of colon cancer
CN113207960B (en) Bifidobacterium lactis MN-Gup fermented milk for improving obesity and preparation method thereof
CN114933992A (en) Bifidobacterium longum and application of compound preparation thereof in relieving ulcerative colitis
CN116173075A (en) Synbiotic composition for improving cognitive function based on clostridium sporogenes and application thereof
CN110839693B (en) Application of parabacteroides gibsonii in preventing or treating obesity or related diseases
CN116622593B (en) Lactobacillus paracasei for fermentation and fermentation process for preparing wind-resistant acid-discharging ferment by same
CN118415297B (en) Application of metatrophic liquid in improving white blood cell and platelet number and improving immunosuppression and intestinal injury caused by chemotherapeutics and preparation method thereof
CN117264850B (en) Pediococcus pentosaceus SW006 with auxiliary treatment of colpitis and immunity enhancing functions and application thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
CB03 Change of inventor or designer information
CB03 Change of inventor or designer information

Inventor after: Chang Lei

Inventor after: Wu Jiaqi

Inventor after: Liu Buchan

Inventor after: Li Yongxia

Inventor after: Liang Meijun

Inventor after: Zhi Fachao

Inventor before: Chang Lei

Inventor before: Wu Jiaqi

Inventor before: Liu Buchan

Inventor before: Li Yongxia

Inventor before: Liang Meijun

Inventor before: Zhi Fachao

GR01 Patent grant
GR01 Patent grant