CN115252651A

CN115252651A - Application of akkermansia muciniphila in preparation of composition for preventing and treating hypertension and composition containing akkermansia muciniphila

Info

Publication number: CN115252651A
Application number: CN202210642442.0A
Authority: CN
Inventors: 邝高波; 吴家棋; 林渝清; 丁靖志; 周秋云; 王晔
Original assignee: Guangzhou Zhiyi Biotechnology Co Ltd
Current assignee: Guangzhou Zhiyi Biotechnology Co Ltd
Priority date: 2022-06-08
Filing date: 2022-06-08
Publication date: 2022-11-01

Abstract

The invention relates to an application of akkermansia muciniphila in preparing a composition for preventing and treating hypertension, wherein the akkermansia muciniphila is akkermansia muciniphila AM06, akkermansia muciniphila AM02 or a combination of the two; wherein the preservation number of the akkermansia muciniphila AM06 is CGMCC No.22793, and the preservation number of the akkermansia muciniphila AM02 is CGMCC No.22794. In the application, the separated akkermansia muciniphila AM06 and/or AM02 can effectively prevent and treat hypertension by improving the levels of blood pressure regulating factors such as ET-1, NO, angII and the like.

Description

Application of akkermansia muciniphila in preparation of composition for preventing and treating hypertension and composition containing akkermansia muciniphila

Technical Field

The invention relates to the technical field of hypertension control, in particular to application of akkermansia muciniphila in preparation of a composition for controlling hypertension and a composition containing the same.

Background

Hypertension (Hypertension) is a clinical syndrome characterized by an increase in systemic arterial blood pressure (systolic pressure and/or diastolic pressure) (systolic pressure not less than 140 mm hg, diastolic pressure not less than 90 mm hg), and also accompanied by functional or organic damage to organs such as heart, brain, and kidney. Hypertension is one of the most common chronic diseases, and a close causal relationship exists between blood pressure level and the morbidity and mortality risk of cardiovascular and cerebrovascular diseases. The most relevant complications of hypertension include stroke, heart failure, left ventricular hypertrophy, atrial fibrillation, end stage renal disease, etc. The mode of hypertension treatment comprises life style intervention, antihypertensive drug and appliance intervention, and other intervention treatments are also needed in a targeted way when other risk factors such as hyperlipidemia, hyperglycemia and ischemic cardiovascular and cerebrovascular diseases exist. Lifestyle intervention is the most fundamental treatment modality, including reduction of sodium salt intake, complete cessation of smoking and avoidance of passive smoking, non-drinking, alleviation of mental stress, etc., but is often associated with compliance problems due to patient variability.

Therefore, development of effective hypertension control drugs is essential.

Disclosure of Invention

Based on the above, the invention aims to provide the application of akkermansia muciniphila which is akkermansia muciniphila AM06, akkermansia muciniphila AM02 or a combination of the two in the preparation of a pharmaceutical composition for preventing and treating hypertension or a health care product composition for improving blood pressure level; wherein, the first and the second end of the pipe are connected with each other,

the akkermansia muciniphila AM06 is preserved in China general microbiological culture Collection center in 2021, 06 months and 28 days, and the preservation number is CGMCC No.22793;

the akkermansia muciniphila AM02 is preserved in China general microbiological culture Collection center in 2021, 06 months and 28 days, and the preservation number is CGMCC No.22794.

In a first aspect of the invention, there is provided the use of akkermansia muciniphila for the manufacture of a pharmaceutical composition for the prevention and treatment of hypertension or for the manufacture of a nutraceutical composition for the improvement of blood pressure levels, said akkermansia muciniphila being akkermansia muciniphila AM06, akkermansia muciniphila AM02 or a combination of both; wherein the content of the first and second substances,

the akkermansia muciniphila AM06 is preserved in the China general microbiological culture Collection center in 2021, at 06 months and 28 days, and the preservation number is CGMCC No.22793;

the akkermansia muciniphila AM02 is preserved in the China general microbiological culture Collection center in 2021, 06 months and 28 days, and the preservation number is CGMCC No.22794.

In some embodiments, the akkermansia muciniphila AM06 and the akkermansia muciniphila AM02 are each independently a live bacterium, a killed bacterium, or a combination of live and killed bacteria.

In some embodiments, the hypertension comprises prevention and treatment of renal hypertension, idiopathic hypertension, metabolic hypertension due to complex dietary factors, or isolated systolic hypertension.

In some embodiments, the pharmaceutical composition is a pharmaceutical product in the form of a tablet, capsule, granule, pill, ointment, solution, suspension, emulsion, cream, spray, drop, patch, or tube feed.

In some embodiments, the nutraceutical composition is a nutraceutical, which is a dairy product or a fermented cereal.

In some embodiments, the pharmaceutical composition or nutraceutical composition comprises an effective amount of the akkermansia muciniphila.

In some embodiments, the subject is a mammal.

In some embodiments, the subject is a human or a mouse.

In a second aspect of the invention there is provided the use of a composition comprising akkermansia muciniphila for the manufacture of a pharmaceutical composition for the prevention and treatment of hypertension or for the manufacture of a nutraceutical composition for the amelioration of blood pressure levels, wherein akkermansia muciniphila is as defined in the first aspect of the invention.

In some embodiments, the akkermansia muciniphila-containing composition is a nutraceutical composition, a pharmaceutical composition, or a probiotic composition.

In some embodiments, the akkermansia muciniphila-containing composition further comprises a second active ingredient that is a different drug than the akkermansia muciniphila.

In some embodiments, the akkermansia muciniphila-containing composition is a probiotic composition, the probiotic composition further containing a probiotic other than the akkermansia muciniphila.

In a third aspect of the present invention, there is provided a composition comprising akkermansia muciniphila, further comprising one or more of telmisartan, captopril, valsartan and amlodipine; the akkermansia muciniphila is as defined in the first aspect.

Compared with the prior art, the invention has the following beneficial effects:

the inventor of the application obtains strains AM06 (preservation number CGMCC No. 22793) and AM02 (preservation number CGMCC No. 22794) by separation, and both belong to akkermansia muciniphila according to 16S rRNA analysis, morphological analysis, metabolite component analysis, efficacy analysis (such as tolerance of artificial gastric juice and artificial intestinal juice) and other comprehensive analysis, and are identified as new strains of akkermansia muciniphila different from ATCC BAA-835 (standard strains).

The inventor finds that the Ackermansia muciniphila AM06 and/or AM02 obtained by the separation can be used for hypertension. The separated akkermansia muciniphila AM06 and/or AM02 can effectively prevent and treat hypertension by improving the level of blood pressure regulating factors such as ET-1, NO, angII and the like.

Drawings

In order to more clearly illustrate the technical solutions in the embodiments of the present application and to more fully understand the present application and the advantages thereof, the drawings used in the description of the embodiments will be briefly introduced below. It is obvious that the drawings in the following description are only some embodiments of the application, and that other drawings can be derived from these drawings by a person skilled in the art without inventive effort.

FIG. 1 is a characteristic diagram of a colony of Ackermansia muciniphila AM02 cultured in one embodiment of the present invention;

FIG. 2 is a characteristic diagram of a colony of Ackermansia muciniphila AM06 obtained in accordance with an embodiment of the present invention;

FIG. 3 is a gram-stained microscopic image of Ackermansia muciniphila AM02 cultured in accordance with one embodiment of the present invention;

FIG. 4 is a microscopic image of cultured Ackermansia muciniphila AM06 in accordance with an embodiment of the present invention, after gram staining;

FIG. 5 is a PCA analysis of culture supernatant metabolites of a few Ackermanella muciniphila in one embodiment of the present invention.

The Ackermanella muciniphila AM06 obtained by separation in the invention is classified and named as Akkermansia muciniphila, and is preserved in China general microbiological culture Collection center at 28.06.2021, with the address: no. 3 Xilu No.1 Beijing, chaoyang, with the preservation number of CGMCC No.22793; the strain was collected and registered in the collection at 28.06.2021, and was detected as a viable strain by the collection at 28.06.2021.

The Ackermanobacter muciniphila AM02 obtained by separation in the invention is classified and named as Akkermansia muciniphila, and has been deposited in the general microbiological culture Collection center of China Committee for culture Collection of microorganisms at 28 th of 06 months in 2021, address: no. 3 Xilu No.1 Beijing, chaoyang, with the preservation number of CGMCC No.22794; the strain was received and registered in the collection at 28.06.2021, and was detected as a viable strain by the collection at 28.06.2021.

Detailed Description

The present invention will be described in further detail with reference to the drawings, embodiments and examples. It should be understood that these embodiments and examples are merely illustrative of the present invention and are not intended to limit the scope of the present invention, which is provided for the purpose of making the present disclosure more thorough and complete. It is also understood that the present invention may be embodied in many different forms and is not limited to the embodiments and examples described herein, and that various changes and modifications may be effected therein by one of ordinary skill in the art without departing from the spirit and scope of the invention and equivalents thereof. Furthermore, in the following description, numerous specific details are set forth in order to provide a more thorough understanding of the present invention, and it is to be understood that the present invention may be practiced without one or more of these details.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. The terminology used herein in the description of the invention is for the purpose of describing particular embodiments and examples only and is not intended to be limiting of the invention.

Term(s)

Unless otherwise stated or contradicted, terms or phrases used herein have the following meanings:

as used herein, the term "and/or", "and/or" is selected to encompass any of two or more of the associated listed items, as well as any and all combinations of the associated listed items, including any two of the associated listed items, any more of the associated listed items, or all combinations of the associated listed items. It should be noted that when at least three items are connected by at least two conjunctive combinations selected from "and/or", "or/and", "and/or", it should be understood that, in the present application, the technical solutions definitely include the technical solutions all connected by "logic and", and also the technical solutions all connected by "logic or". For example, "A and/or B" includes three parallel schemes of A, B and A + B. For example, a reference to "a, and/or, B, and/or, C, and/or, D" includes any one of a, B, C, and D (i.e., all connected by "logical or"), any and all combinations of a, B, C, and D (i.e., any two or any three of a, B, C, and D), and any four combinations of a, B, C, and D (i.e., all connected by "logical and").

The present invention relates to "plural", etc., and indicates that it is 2 or more in number, unless otherwise specified. For example, "one or more" means one or two or more.

As used herein, "a combination thereof," "any combination thereof," and the like, includes all suitable combinations of any two or more of the listed items.

In the present specification, the term "suitable" in "a suitable combination, a suitable manner," any suitable manner "and the like shall be construed to mean that the technical solution of the present invention can be implemented, the technical problem of the present invention can be solved, and the technical effect of the present invention can be achieved.

The terms "preferably", "better" and "suitable" are used herein only to describe preferred embodiments or examples, and it should be understood that the scope of the present invention is not limited by these terms. If multiple "preferences" appear in one embodiment, each "preference" is independent if no special description is provided, and there are no contradictions or mutual constraints.

In the present invention, "further", "still further", "specifically" and the like are used for descriptive purposes to indicate differences in content, but should not be construed as limiting the scope of the present invention.

In the present invention, "optionally", "optional" and "optional" refer to the presence or absence, i.e., to any one selected from the two juxtapositions "present" or "absent". If multiple optional parts appear in one technical scheme, if no special description exists, and no contradiction or mutual constraint relation exists, each optional part is independent.

In the present invention, the terms "first," "second," "third," and the like, in the terms "first," "second," "third," and the like, are used for descriptive purposes only and are not to be construed as indicating or implying a relative importance or quantity, nor as implicitly indicating the importance or quantity of the technical feature indicated. Moreover, "first," "second," "third," etc. are used merely for purposes of non-exhaustive enumeration and description, and should not be construed as a closed limitation of quantity.

In the present invention, the technical features described in the open type include a closed technical solution composed of the listed features, and also include an open technical solution including the listed features.

In the present invention, a range of values (i.e., a range of values) is included, and unless otherwise stated, the distribution of values that are selectable within the range of values is considered to be continuous and includes both the endpoints (i.e., the minimum and maximum) of the range of values and each value between the endpoints. Unless otherwise specified, when a numerical range refers to integers only within the numerical range, the inclusion of both endpoints of the range, and each integer between the endpoints, is equivalent to the direct recitation of each integer. Where multiple numerical ranges are provided to describe a feature or characteristic, the numerical ranges may be combined. In other words, unless otherwise indicated, all numerical ranges disclosed herein are to be understood to include any and all subranges subsumed therein. The "numerical value" in the numerical range may be any quantitative value such as a number, a percentage, a ratio, or the like. "numerical range" is intended to broadly encompass quantitative ranges such as percentage ranges, proportional ranges, ratio ranges, and the like.

The temperature parameter in the present invention is not particularly limited, and is allowed to be constant temperature treatment or to vary within a certain temperature range. It will be appreciated that the described thermostatic process allows the temperature to fluctuate within the accuracy of the instrument control. Allowing fluctuations in the range of, for example,. + -. 5 deg.C,. + -. 4 deg.C,. + -. 3 deg.C,. + -. 2 deg.C, + -. 1 deg.C.

In the present invention, the term "room temperature" generally means 4 ℃ to 35 ℃, preferably 20 ℃. + -. 5 ℃. In some embodiments of the invention, room temperature is from 20 ℃ to 30 ℃.

In the present invention, the units relating to the data range, if only with units following the right end point, indicate that the units of the left end point and the right end point are the same. For example, 3 to 5h indicate that the units of the left end point "3" and the right end point "5" are all h (hours).

All documents mentioned in this application are incorporated by reference in this application as if each were individually incorporated by reference. The citation of the present application is incorporated by reference herein in its entirety for all purposes unless otherwise in conflict with the present objectives and/or technical disclosure of the present application. Where a citation is referred to herein, the definition of a reference in the document, including features, terms, nouns, phrases, etc., that is relevant, is also incorporated by reference. In the present invention, when the citation is referred to, the cited examples and preferred embodiments of the related art features are also incorporated by reference into the present application, but the present invention is not limited to the embodiments. It should be understood that where a reference conflicts with the description herein, the application is controlling or adaptively modified in accordance with the description herein.

Commonly used hypotensive agents include Calcium Channel Blockers (CCBs), angiotensin Converting Enzyme Inhibitors (ACEIs), angiotensin receptor Antagonists (ARBs), diuretics, and beta-blockers. In addition, alpha receptor blockers or other hypotensor drugs may sometimes be used in certain hypertensive populations. Different kinds of antihypertensive drugs have adverse reactions, such as non-dihydropyridine CCB can inhibit the cardiac contraction and conduction function, resulting in second-degree to third-degree atrioventricular block; dry cough, occasional angioneurotic edema and dysgeusia occur in the initial stage of ACEI administration, and the blood potassium is possibly increased after long-term application; the long-term application of ARB can also increase the blood potassium; thiazide diuretics can cause hypokalemia, while spironolactone long-term application can cause gynecomastia; the common adverse reactions of the beta receptor blocker include fatigue, limb cold feeling, agitation, gastrointestinal discomfort and the like, and can also influence the metabolism of sugar and fat.

Instrumental intervention is an emerging direction for the treatment of refractory hypertension, including denervation, baroreflex activation therapy, arteriovenous anastomosis, carotid body chemoreceptor ablation, deep brain stimulation, slowed respiratory therapy, and the like. The above therapies are in research, have unclear safety and effectiveness, and are not suitable for wide clinical popularization. Therefore, there is a need to find safer and more effective treatments for hypertension.

There is increasing evidence that gut microbiology and gut activity play important regulatory roles in blood pressure control. The intake of probiotics can regulate the balance of intestinal flora of a host and has the potential of regulating blood pressure. Studies have shown that lactic acid bacteria and their fermented foods are capable of regulating blood pressure in subjects. Random, double-blind, placebo-controlled, parallel experimental studies were performed by Sharafedtinov et al using l.plantarum Tensia DSM 21380 fermented cheese, and a total of 40 volunteers, including 15 in the control group and 25 in the experimental group, participated in the 3-week-old survey, found that there was a positive correlation between colonization and a decrease in early morning systolic and diastolic blood pressure in hypertensive patients, and that the characterization of metabolic syndrome was significantly reduced by the intake of probiotic cheese: arterial blood pressure values and Body Mass Index (BMI), indicating that l.plantarum Tensia DSM 21380 fermented cheese has a hypotensive effect.

Akkermansia muciniphila (Akkermansia muciniphila, a. Muciniphila) is one of the most abundant single species in the human intestinal microbiota (0.5-5% of the total bacteria). It is in the form of oval, a gram-negative anaerobe, representative of the phylum verrucomicrobia. A study by Everard et al in 2013 showed daily administration of 2X 10⁸Each live a. Muciniphila was able to partially protect mice from diet-induced obesity. Another study showed that pasteurized a. Muciniphila has even stronger metabolic regulation effects than live bacteria. This opens the door for a. Muciniphila to be considered as a new generation of beneficial microorganisms. Muconiphila is now widely recognized as being able to ameliorate metabolic disorders associated with obesity, diabetes, liver disease and cardiometabolic disorders. In fact, modulation of this has been shown to greatly reduce the progression of such diseases. A cross-sectional study comprising 6896 chinese 18-97 year old volunteers from the guangdong microbiome program showed that the abundance of a. Muciniphila was dose-related to the metabolic syndrome (Mets) in inverse proportion.

However, there is no microecological agent that uses a. Muciniphila for the regulation of blood pressure at present.

First aspect of the invention

In a first aspect of the invention, there is provided the use of akkermansia muciniphila, which is akkermansia muciniphila AM06, akkermansia muciniphila AM02 or a combination of both, in the manufacture of a pharmaceutical composition for the prevention or treatment of hypertension or in the manufacture of a nutraceutical composition for the amelioration of blood pressure levels.

The akkermansia muciniphila of the invention can be live bacteria, or akkermansia muciniphila which retains biological activity and is subjected to inactivation, gene recombination, modification, attenuation, chemical treatment and physical treatment, and can also be lysate, culture (such as supernatant) of bacteria or components extracted from the supernatant. Optionally, the akkermansia muciniphila AM06 and the akkermansia muciniphila AM02 are each independently live bacteria, inactivated bacteria, or a combination of live and inactivated bacteria.

The inventor of the application obtains strains AM06 (with the preservation number of CGMCC No. 22793) and AM02 (with the preservation number of CGMCC No. 22794) through separation, and the strains belong to akkermansia muciniphila according to 16S rRNA analysis, morphological analysis, metabolite component analysis, efficacy analysis (such as tolerance of artificial gastric juice and artificial intestinal juice) and other comprehensive analysis, and are identified as new strains different from akkermansia muciniphila such as ATCC BAA-835 (standard strains).

Akkermansia muciniphila AM06 was deposited at 28.06.2021 in the general microbiological culture collection center of the committee for culture collection of chinese microorganisms with the collection number of CGMCC No.22793, which was isolated by the method of example 1, and the species identification was performed by one or more methods including, but not limited to, the methods of examples 2 to 8.

In some embodiments, the colony culture characteristics of akkermansia muciniphila AM06 comprise: round convex, neat edge, opaque, white, uneven size colonies.

In some embodiments, akkermansia muciniphila AM06 is isolated from breast milk.

Akkermansia muciniphila AM02 was deposited at 28.06 months 2021 in the general microbiological culture collection center of the committee for culture collection of chinese microorganisms with the collection number of CGMCC No.22794, and was isolated by the method of example 1, and was identified by one or more methods including, but not limited to, the methods of examples 2-8.

In some embodiments, the colonial culture characteristics of akkermansia muciniphila AM02 of CGMCC No.22794 comprise: round convex, neat edge, opaque, white, uneven size colonies.

In some embodiments, applicants have also conducted tolerance studies for artificial gastric fluids, artificial intestinal fluids. Wherein, in the research of the tolerance of the artificial gastric juice, the statistical analysis is carried out on the viable count of 0.9wt% NaCl solution group, pH3 artificial gastric juice group and Ph2 artificial gastric juice group which are different groups and are 37 +/-2 ℃ and after anaerobic incubation for 0h,1.5h and 3h, and the result shows that the tolerance of the artificial gastric juice of the ackermann muciniphilic strain is AM02> AM06> standard strain ATCC BAA-835 in sequence. In the artificial intestinal juice tolerance investigation experiment, the number of viable bacteria after anaerobic incubation for 0h, 4h and 8h at 37 +/-2 ℃ is subjected to statistical analysis, and the artificial intestinal juice tolerance is superior to AM06, AM02 and ATCC BAA-835.

In some in vitro experiments, the akkermansia muciniphila AM06 and AM02 have tolerance to artificial gastric juice and artificial intestinal juice, and can effectively prevent and treat hypertension by improving the levels of blood pressure regulating factors such as ET-1, NO, angII and the like.

The inventor finds that the Ackermansia muciniphila AM06 and/or AM02 obtained by the separation can be used for hypertension through a plurality of experiments. The separated akkermansia muciniphila AM06 and/or AM02 can effectively prevent and treat hypertension by improving the level of blood pressure regulating factors such as ET-1, NO, angII and the like.

In the present invention, "prevention" includes prevention, treatment, adjuvant therapy and the like. As used herein, "control" or "prevention" as used herein refers to alleviation, delay of progression, attenuation, prevention, or maintenance of an existing disease or condition. "preventing" also includes curing, preventing the development of, or alleviating to some extent one or more of the symptoms of a disease or disorder.

In the present invention, the "composition" may be a combination of a plurality of substances, and further may be used in combination or may be a mixture of combinations.

In some embodiments, the hypertension includes renal hypertension, idiopathic hypertension, metabolic hypertension due to complex dietary factors, or isolated systolic hypertension.

In the present invention, "food" refers to an edible substance. "food composition" refers to an edible composition. It will be appreciated that the food composition of the invention may also comprise any suitable other edible substance in addition to the aforementioned akkermansia muciniphila. In some embodiments, the additional edible substances may be selected from substances allowed to be added in healthcare product regulatory specifications, and further, not include substances prohibited from being added in healthcare brand regulatory specifications. The health care product management standard refers to the current standard in production, if not particularly limited. In the present invention, the "nutraceutical composition" is not intended to treat diseases, but can be used to prevent hypertension.

In the present invention, "drug" includes any agent, compound, composition or mixture that provides a physiological and/or pharmacological effect in vivo or in vitro, and often provides a beneficial effect. The range of the "drug" that exerts a physiological and/or pharmacological effect in vivo is not particularly limited, and may be a systemic effect or a local effect. The activity of the "drug" is not particularly limited, and may be an active substance that can interact with other substances or an inert substance that does not interact with other substances.

In the present invention, the term "pharmaceutical composition" refers to a composition having a pharmaceutically preventive or therapeutic effect and usable as a pharmaceutical.

In some embodiments, the composition for preventing and treating hypertension is a liquid formulation or a solid formulation. Liquid formulations refer to formulations containing a liquid phase, such as, by way of non-limiting example, solutions, suspensions, emulsions, and the like. Non-limiting examples of solid formulations are tablets, capsules, granules, pills, and the like.

In some embodiments, it may be an oral agent, an injection, a drop, a patch, a tube feed, etc., depending on the administration mode.

In some embodiments, the nutraceutical composition is a dairy product or a fermented cereal. Dairy products such as milk powder, cheese, curd, yogurt, ice cream, etc., fermented cereals such as cookies, etc.

In some embodiments, the pharmaceutical composition is in the form of a tablet, capsule, granule, pill, paste, solution, suspension, emulsion, cream, spray, drop, patch, or tube feed formulation.

In some embodiments, a pharmaceutical composition for preventing and treating hypertension or a nutraceutical composition for improving blood pressure levels comprises the akkermansia muciniphila and an adjuvant. The excipients selected may vary depending on the dosage form.

In some embodiments, a nutraceutical composition comprises the akkermansia muciniphila and an edible adjuvant. In the present invention, the food additive also belongs to edible auxiliary materials. Examples of the edible auxiliary materials include sugar, fructose, honey, glucose, starch, vitamins, beneficial trace elements and secondary elements including calcium powder, soybean powder, mung bean powder, maltodextrin, milk powder, vegetable juice, fruit juice, spice or essence.

In some embodiments, a pharmaceutical composition comprises the akkermansia muciniphila and a pharmaceutically acceptable carrier.

In the present invention, the "carrier" includes, but is not limited to, mannitol, sorbitol, sodium metabisulfite, sodium bisulfite, sodium thiosulfate, cysteine hydrochloride, thioglycolic acid, methionine, vitamin C, disodium EDTA, sodium calcium EDTA, monovalent alkali metal carbonates, acetates, phosphates or aqueous solutions thereof, hydrochloric acid, acetic acid, sulfuric acid, phosphoric acid, amino acids, sodium chloride, potassium chloride, sodium lactate, xylitol, maltose, glucose, fructose, dextran, glycine, starch, sucrose, lactose, mannitol, silicon derivatives, cellulose and derivatives thereof, alginates, gelatin, polyvinylpyrrolidone, glycerol, tween 80, agar, calcium carbonate, calcium bicarbonate, surfactants, polyethylene glycol, cyclodextrin, phospholipid-based materials, kaolin, talc, calcium stearate, magnesium stearate.

In the present invention, "pharmaceutically acceptable" refers to those ligands, materials, compositions, and/or dosage forms which are suitable for administration to a patient within the scope of sound medical judgment and are commensurate with a reasonable benefit/risk ratio.

In the present invention, "pharmaceutically acceptable carrier" refers to a pharmaceutically acceptable material, composition or vehicle, such as a liquid or solid filler, diluent, excipient, solvent or encapsulating material. As used herein, the language "pharmaceutically acceptable carrier" includes buffers, sterile water for injection, solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like, compatible with pharmaceutical administration. Each entity must be "pharmaceutically acceptable" in the sense of being compatible with the other ingredients in the formulation and not injurious to the patient. Suitable examples include, but are not limited to: (1) sugars such as lactose, glucose and sucrose; (2) Starches, such as corn starch, potato starch, and substituted or unsubstituted β -cyclodextrin; (3) Cellulose and its derivatives, such as sodium carboxymethyl cellulose, ethyl cellulose and cellulose acetate; (4) powdered gum tragacanth; (5) malt; (6) gelatin; (7) talc; (8) excipients, such as cocoa butter and suppository waxes; (9) Oils such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil and soybean oil; (10) glycols, such as propylene glycol; (11) Polyols such as glycerol, sorbitol, mannitol and polyethylene glycol; (12) esters such as ethyl oleate and ethyl laurate; (13) agar; (14) buffering agents such as magnesium hydroxide and aluminum hydroxide; (15) alginic acid; (16) pyrogen-free water; (17) isotonic saline; (18) ringer's solution; (19) ethanol; (20) phosphate buffer; and (21) other non-toxic compatible substances employed in pharmaceutical formulations.

In some embodiments, the akkermansia muciniphila is contained in an effective amount in a pharmaceutical composition for preventing and treating hypertension or a nutraceutical composition for improving blood pressure level.

In the present invention, an "effective amount" refers to an amount of a component corresponding to the term that achieves treatment, prevention, alleviation and/or relief of a particular disease, disorder and/or symptom in a subject, and in the present invention, without particular limitation, refers to an amount that achieves treatment, prevention, alleviation and/or relief of a hypertensive disease, disorder and/or symptom.

In the present invention, a "subject" is an animal, preferably a mammal, more preferably a human, including, but not limited to, a consumer of food and a patient having a disease, disorder and/or condition. The subject of the present invention is preferably a mammal. The term "mammal" refers primarily to warm-blooded vertebrate mammals, including but not limited to: such as cat, dog, rabbit, bear, fox, wolf, monkey, deer, rat (such as rat, mouse), pig, cow, sheep, horse, human, etc., preferably primate, more preferably human.

In some embodiments, the subject is a mammal.

In some embodiments, the subject is a human or a mouse.

In the present invention, "patient" means an animal, preferably a mammal, more preferably a human. The term "mammal" refers primarily to warm-blooded vertebrate mammals, including but not limited to: such as cats, dogs, rabbits, bears, foxes, wolves, monkeys, deer, rats, pigs, cattle, sheep, horses, humans, etc., preferably primates, more preferably humans.

In some embodiments, the pharmaceutical composition for preventing and treating hypertension comprises a therapeutically effective amount of the akkermansia muciniphila.

In the present invention, "therapeutically effective amount" refers to the amount of a pharmaceutically active ingredient that will elicit the biological or medical response of an individual with respect to a disease, disorder and/or condition, e.g., the amount of a compound of the present invention that will bring a physiologically and/or pharmacologically positive effect to the individual, including but not limited to reducing or inhibiting enzyme or protein activity or ameliorating symptoms, alleviating a disorder, slowing or delaying the progression of a disease or preventing a disease, etc.

Second aspect of the invention

In a second aspect of the invention there is provided the use of a composition comprising akkermansia muciniphila, as defined with reference to the first aspect of the invention, in the manufacture of a pharmaceutical composition for the prevention or treatment of hypertension or in the manufacture of a nutraceutical composition for the amelioration of blood pressure levels.

Further, the akkermansia muciniphila is akkermansia muciniphila AM06 (preservation number is CGMCC No. 22793), akkermansia muciniphila AM02 (preservation number is CGMCC No. 22794) or a combination of the two.

Reference is made to the first aspect of the invention for the definitions of "composition", "prophylaxis", "hypertension", "composition for prophylaxis or treatment of hypertension", "nutraceutical composition" and "pharmaceutical composition".

In some embodiments, the active ingredient in the akkermansia muciniphila-containing composition is akkermansia muciniphila AM06 and/or akkermansia muciniphila AM02, i.e., is free of other ingredients having a hypertension control effect.

In the present invention, "active ingredient" means an ingredient having a hypertension preventing and treating effect. The active ingredients in the invention at least comprise akkermansia muciniphila AM06 and/or akkermansia muciniphila AM02.

In some embodiments, the akkermansia muciniphila-containing composition further comprises a second active ingredient.

In some embodiments, non-limiting examples of the second active ingredient include: one or more of telmisartan, captopril, valsartan, amlodipine and the like.

In some embodiments, the akkermansia muciniphila-containing composition is a probiotic composition, and in addition to akkermansia muciniphila AM06 and/or akkermansia muciniphila AM02, contains other probiotics other than akkermansia muciniphila.

In some embodiments, the other probiotic bacteria other than akkermansia muciniphila may be selected from one or more of bacteroides fragilis, klebsiella, saccharomyces boulardii, lactobacillus rhamnosus, and lactobacillus bifidus.

Third aspect of the invention

The present invention provides a composition comprising akkermansia muciniphila, further comprising one or more of telmisartan, captopril, valsartan, and amlodipine; the akkermansia muciniphila is as defined in the first aspect. Reference is made to the first aspect of the invention for the definition of "composition".

Fourth aspect of the invention

In a fourth aspect of the present invention, there is provided a method for the prevention and treatment of hypertension, comprising administering to a subject an effective amount of akkermansia muciniphila (i.e., administering to the subject an effective amount of akkermansia muciniphila).

In a fourth aspect of the present invention, there is provided a method for the prevention and treatment of hypertension, comprising administering to a subject an effective amount of a composition comprising akkermansia muciniphila (i.e., administering to the subject an effective amount of a composition comprising akkermansia muciniphila).

The definitions of "akkermansia muciniphila", "composition", "akkermansia muciniphila-containing composition", "control", "hypertension", "effective amount", "active ingredient" can refer to the first or second aspect of the present invention.

In some embodiments, the mode of administration of the drug includes, but is not limited to: oral, rectal, parenteral (intravenous, intramuscular or subcutaneous) injection, and topical administration, inhalation.

In some of these embodiments, the pharmaceutical composition can be administered orally, by enema, or parenterally.

In some of these embodiments, the administration cycle of the pharmaceutical composition can be intermittent, periodic, continuous, or chronic.

Solid dosage forms for oral administration may include capsules, tablets, pills, powders and granules. In these solid dosage forms, the active ingredient is mixed with at least one conventional inert excipient (or carrier), such as sodium citrate or dicalcium phosphate, or with the following: (a) Fillers or extenders, for example, starch, lactose, sucrose, glucose, mannitol and silicic acid; (b) Binders, for example, hydroxymethylcellulose, alginates, gelatin, polyvinylpyrrolidone, sucrose and acacia; (c) humectants, for example, glycerol; (d) Disintegrating agents, for example, agar-agar, calcium carbonate, potato or tapioca starch, alginic acid, certain complex silicates, and sodium carbonate; (e) slow solvents, such as paraffin; (f) absorption accelerators, e.g., quaternary ammonium compounds; (g) Wetting agents, such as cetyl alcohol and glycerol monostearate; (h) adsorbents, for example, kaolin; and (i) lubricants, for example, talc, calcium stearate, magnesium stearate, solid polyethylene glycols, sodium lauryl sulfate, or mixtures thereof. In capsules, tablets and pills, the dosage forms may also comprise buffering agents. Solid dosage forms such as tablets, dragees, capsules, pills, and granules can be prepared using coatings and shells such as enteric coatings and other materials well known in the art. They may contain opacifying agents and the release of the active compound or compounds in such a composition may be delayed in release in a certain part of the digestive tract. Examples of embedding components which can be used are polymeric substances and wax-like substances. If desired, the active compound may also be in microencapsulated form with one or more of the above-mentioned excipients.

Liquid dosage forms for oral administration include pharmaceutically acceptable emulsions, solutions, suspensions, syrups or tinctures. In addition to the active ingredients, the liquid dosage forms may contain inert diluents commonly employed in the art, such as water or other solvents, solubilizing agents and emulsifiers, such as, for example, ethyl alcohol, isopropyl alcohol, ethyl carbonate, ethyl acetate, propylene glycol, 1, 3-butylene glycol, dimethylformamide, and oils, in particular, cottonseed, groundnut, corn germ, olive, castor and sesame oils, or mixtures of these materials. In addition to these inert diluents, the compositions can also contain adjuvants such as wetting agents, emulsifying and suspending agents, sweetening, flavoring, and perfuming agents. If suspensions may contain suspending agents, for example, ethoxylated isostearyl alcohols, polyoxyethylene sorbitol and sorbitan esters, microcrystalline cellulose, aluminium methoxide and agar, or mixtures of these substances.

Compositions for parenteral injection may comprise physiologically acceptable sterile aqueous or anhydrous solutions, dispersions, suspensions or emulsions, as well as sterile powders for reconstitution into sterile injectable solutions or dispersions. Suitable aqueous or nonaqueous carriers, diluents, solvents or vehicles include water, ethanol, polyols and suitable mixtures thereof.

Dosage forms for topical administration include ointments, powders, patches, sprays, and inhalants. Is prepared by mixing the active ingredient under sterile conditions with a pharmaceutically acceptable carrier, and with any preservatives, buffers, or propellants which may be required if desired.

The dosage form of the food composition may also be selected from suitable means in the dosage forms of the above-described pharmaceutical compositions, which can be selected by the skilled person depending on the mode of administration.

It will be appreciated that the medicaments of the embodiments of the invention may be formulated with various pharmaceutically acceptable excipients into suitable clinical dosage forms, including but not limited to those described above.

Some specific examples are provided below.

Embodiments of the present invention will be described in detail with reference to examples. It should be understood that these examples are for illustrative purposes only and are not intended to limit the scope of the present invention. The experimental procedures for the conditions not specified in the following examples, preferably with reference to the guidelines given in the present invention, may also be performed according to the experimental manual or the conventional conditions in the art, may also be performed according to the conditions suggested by the manufacturer, or may be performed according to the experimental procedures known in the art.

In the following specific examples, the measurement parameters relating to the components of the raw materials, if not specified otherwise, may be subject to slight deviations within the accuracy of the weighing. Temperature and time parameters are involved to allow for acceptable deviation due to instrument test accuracy or operational accuracy.

Example 1 isolation and characterization of Ackermanella muciniphila

1.1 isolation and identification of the AM02 Strain

Using a sterile sampling spoon, place the soybean grain size feces (sample from an adult healthy male) in a 10mL centrifuge tube, transfer the sample immediately to a 37 ℃ anaerobic workstation after sampling is complete (85% N)₂、10％H₂、5％CO₂) According to the formula 1:10 dilution mode the sample is diluted to 10^-9And inoculating 1mL of each dilution solution into 9mL of a basal medium which takes mucin as a unique carbon source, and carrying out anaerobic culture for 7 days. Get 10^-41mL of the diluted inoculated culture solution was added as 1:10 dilution method the culture solution is diluted to 10^-6Each dilution (100. Mu.L) was applied to a mucin agar medium, anaerobically cultured for 7 days, and a single colony was inoculated into 2mL of BHI broth (N-acetyl-D-glucosamine-containing medium, which may be referred to as BHI broth supplemented with GlcNAc). And (3) sequencing 16S rRNA of the cultured bacterial liquid, and comparing the 16S rRNA sequence on an NCBI database. The separated strain is identified as akkermansia muciniphila, and the 16S rRNA sequencing result is shown as the following SEQ ID No. 1:

GTGACGGGCGGGGTGCATAGACATGCAGTCGAACGAGAGAATTGCTAGCTTGCTAATAATTCTCTAGTGGCGCACGGGTGAGTAACACGTGAGTAACCTGCCCCCGAGAGCGGGATAGCCCTGGGAAACTGGGATTAATACCGCATAGTATCGAAAGATTAAAGCAGCAATGCGCTTGGGGATGGGCTCGCGGCCTATTAGTTAGTTGGTGAGGTAACGGCTCACCAAGGCGATGACGGGTAGCCGGTCTGAGAGGATGTCCGGCCACACTGGAACTGAGACACGGTCCAGACACCTACGGGTGGCAGCAGTCGAGAATCATTCACAATGGGGGAAACCCTGATGGTGCGACGCCGCGTGGGGGAATGAAGGTCTTCGGATTGTAAACCCCTGTCATGTGGGAGCAAATTAAAAAGATAGTACCACAAGAGGAAGAGACGGCTAACTCTGTGCCAGCAGCCGCGGTAATACAGAGGTCTCAAGCGTTGTTCGGAATCACTGGGCGTAAAGCGTGCGTAGGCTGTTTCGTAAGTCGTGTGTGAAAGGCGCGGGCTCAACCCGCGGACGGCACATGATACTGCGAGACTAGAGTAATGGAGGGGGAACCGGAATTCTCGGTGTAGCAGTGAAATGCGTAGATATCGAGAGGAACACTCGTGGCGAAGGCGGGTTCCTGGACATTAACTGACGCTGAGGCACGAAGGCCAGGGGAGCGAAAGGGATTAGATACCCCTGTAGTCCTGGCAGTAAACGGTGCACGCTTGGTGTGCGGGGAATCGACCCCCTGCGTGCCGGAGCTAACGCGTTAAGCGTGCCGCCTGGGGAGTACGGTCGCAAGATTAAAACTCAAAGAAATTGACGGGGACCCGCACAAGCGGTGGAGTATGTGGCTTAATTCGATGCAACGCGAAGAACCTTACCTGGGCTTGACATGTAATGAACAACATGTGAAAGCATGCGACTCTTCGGAGGCGTTACAACAGGTGCTGCATGGCCGTCGTCAGCTCGTGTCGTGAGATGTTTGGTTAAGTCCAGCAACGAGCGCAACCCCTGTTGCCAGTTACCAGCACGTGAAGGTGGGGACTCTGGCGAGACTGCCCAGATCAACTGGGAGGAAGGTGGGGACGACGTCAGGTCAGTATGGCCCTTATGCCCAGGGCTGCACACGTACTACAATGCCCAGTACAGAGGGGGCCGAAGCCGCGAGGCGGAGGAAATCCTGAAAACTGGGCCCAGTTCGGACTGTAGGCTGCAACCCGCCTACACGAAGCCGGAATCGCTAGTAATGGCGCATCAGCTACGGCGCCGTGAATACGTTCCCGGGTCTTGTACACACCGCCCGTCACATCATGGAAGCCGGTCGCACCCGAAGTATCTGAAGCCAACCGCAAGGAGGCAGGTCCTAAGGTAGACTACTGTCTAT

the 16S sequence alignment of SEQ ID NO 1 with ATCC BAA-835 shows a Per.Ident value of 99.43%.

1.2 isolation and identification of the AM06 Strain

Freshly collected breast milk samples (from adult healthy women) were immediately injected into 5mL anaerobic vials for storage, and then transferred to a 37 ℃ anaerobic workstation (85% N)₂、10％H₂、5％CO₂) According to the method, according to 1:10 dilution mode to dilute the sample to 10^-6And inoculating 1mL of each dilution solution into 9mL of a basal medium which takes mucin as a unique carbon source, and carrying out anaerobic culture for about 1 month. Get 10^-1～10^-41mL of the diluted inoculated culture solution was added as 1:10 dilution method the culture solution is diluted to 10^-6Each 100. Mu.L dilution was applied to a mucin agar medium, and anaerobic culture was carried out for 7 days, and a single colony was selected and inoculated into 2mL of BHI broth (medium containing N-acetyl-D-glucosamine). Opposite cultureAnd (3) carrying out 16S rRNA sequencing identification on the cultured bacterial liquid, carrying out sequence comparison on a 16S rRNA sequence on an NCBI database, and identifying the bacterial liquid as the akkermansia muciniphila, wherein the 16S rRNA sequencing result is shown as the following SEQ ID No. 2:

CGGATTACGGCGTGCTAAGACTGCAGTCGACGAGAGATTGCTAGCTTGCTAATAATTCTCTAGTGGCGCACGGGTGAGTAACACGTGAGTAACCTGCCCCCGAGAGCGGGATAGCCCTGGGAAACTGGGATTAATACCGCATAGTATCGAAAGATTAAAGCAGCAATGCGCTTGGGGATGGGCTCGCGGCCTATTAGTTAGTTGGTGAGGTAACGGCTCACCAAGGCGATGACGGGTAGCCGGTCTGAGAGGATGTCCGGCCACACTGGAACTGAGACACGGTCCAGACACCTACGGGTGGCAGCAGTCGAGAATCATTCACAATGGGGGAAACCCTGATGGTGCGACGCCGCGTGGGGGAATGAAGGTCTTCGGATTGTAAACCCCTGTCATGTGGGAGCAAATTAAAAAGATAGTACCACAAGAGGAAGAGACGGCTAACTCTGTGCCAGCAGCCGCGGTAATACAGAGGTCTCAAGCGTTGTTCGGAATCACTGGGCGTAAAGCGTGCGTAGGCTGTTTCGTAAGTCGTGTGTGAAAGGCGCGGGCTCAACCCGCGGACGGCACATGATACTGCGAGACTAGAGTAATGGAGGGGGAACCGGAATTCTCGGTGTAGCAGTGAAATGCGTAGATATCGAGAGGAACACTCGTGGCGAAGGCGGGTTCCTGGACATTAACTGACGCTGAGGCACGAAGGCCAGGGGAGCGAAAGGGATTAGATACCCCTGTAGTCCTGGCAGTAAACGGTGCACGCTTGGTGTGCGGGGAATCGACCCCCTGCGTGCCGGAGCTAACGCGTTAAGCGTGCCGCCTGGGGAGTACGGTCGCAAGATTAAAACTCAAAGAAATTGACGGGGACCCGCACAAGCGGTGGAGTATGTGGCTTAATTCGATGCAACGCGAAGAACCTTACCTGGGCTTGACATGTAATGAACAACATGTGAAAGCATGCGACTCTTCGGAGGCGTTACACAGGTGCTGCATGGCCGTCGTCAGCTCGTGTCGTGAGATGTTTGGTTAAGTCCAGCAACGAGCGCAACCCCTGTTGCCAGTTACCAGCACGTGAAGGTGGGGACTCTGGCGAGACTGCCCAGATCAACTGGGAGGAAGGTGGGGACGACGTCAGGTCAGTATGGCCCTTATGCCCAGGGCTGCACACGTACTACAATGCCCAGTACAGAGGGGGCCGAAGCCGCGAGGCGGAGGAAATCCTAAAAACTGGGCCCAGTTCGGACTGTAGGCTGCAACCCGCCTACACGAAGCCGGAATCGCTAGTAATGGCGCATCAGCTACGGCGCCGTGAATACGTTCCCGGGTCTTGTACACACCGCCCGTCACATCATGGAAGCCGGTCGCACCCGAAGTCATTACTGAAGCCAACCGCAAGGAGGCAGGTCCTAAAGTGAGACTATAACAA

the 16S sequence alignment of SEQ ID NO 2 with ATCC BAA-835 shows a Per.Ident value of 99.22%.

1.3. Culture of Ackermanella muciniphila

Ackermans viscosus was streaked onto BHA plates and cultured anaerobically for 3 days. Observing the morphological characteristics, staining characteristics, size, club shape, distribution and the like of colonies.

Colony characteristics: ackermansia muciniphila exhibited circular convex, well-edged, opaque, white colonies with heterogeneous sizes after 3 days of culture on the above medium, see FIGS. 1 and 2.

Microscopic morphology: akkermansia muciniphila was subjected to gram-stained microscopy and was gram-negative bacteria, either oval, single or in chain-like arrangement, see fig. 3 and 4.

Selecting a single bacterial colony to be inoculated into BHI broth to be cultured for 48 hours (the temperature is 37 ℃), centrifuging the obtained bacterial liquid for precipitation at the rotating speed of 16000 Xg for 30min, removing supernatant, and collecting precipitate to obtain the akkermansia muciniphila bacterial mud.

And (3) carrying out pasteurization on the obtained akkermansia muciniphila bacterial sludge to obtain the akkermansia muciniphila killed bacteria.

Example 2 resistance of Ackermanella muciniphila to Artificial gastric juice

(1) Experimental methods and groups

TABLE 1 Experimental groups

TABLE 2 Experimental methods

"+" indicates that detection is required

1) Taking 1 Ackermanomyces muciniphila strain, removing the label, wiping and disinfecting the outer surface of the glycerol cryopreservation tube by using 75% alcohol, uniformly mixing by vortex oscillation, and starting. And (3) inoculating 100-500 mu L of bacterial liquid into 10 mL/tube of BHI broth, shaking up, preparing 3 tubes in total, simultaneously taking no inoculated bacteria as a negative control, and placing at 37 ℃ for anaerobic culture for 2-4 days to obtain a first-grade seed liquid.

The first-level seed liquid is subjected to gram staining microscopic examination, and is G-bacillus free, spore-free and free of mixed bacteria.

2) Collecting the above primary seed solution (10mL), centrifuging at 12000 Xg at 4 deg.C for 10min, discarding supernatant, adding 1mL0.9% NaCl solution, and resuspending to obtain bacterial solutions.

3) AM06, AM02 and the standard strain liquid were added to 0.9% NaCl, pH3 and pH2 artificial gastric juice, respectively, as shown in Table 2, mixed, split-packed into 5 mL/tube, placed in an anaerobic glove box and incubated at 37 ℃ for 0h,1.5h and 3h, and then taken out to measure the bacterial concentration of each sample. Each experimental group was done in 3 replicates.

4) And (3) viable count determination:

taking an experimental sample, carrying out serial dilution by 10 times, then inoculating 100 mu L of diluent to a BHA plate, uniformly coating, making 2 plates for each dilution, generally making 2-3 dilutions, simultaneously taking 100 mu L of diluent to the BHA plate, using the dilution as a negative control, culturing all coated plates under the positive anaerobic condition for about 3-5 days, observing the growth condition of bacterial colonies on the plates, and counting.

Calculating the viable count according to the sum of the bacterial counts of 2 plates according to the following formula:

viable count (CFU/mL) = sum of 2 plate colonies/2 × 10 × final dilution

And (3) survival rate calculation:

(2) Results of the experiment

TABLE 3 statistical table of results of artificial gastric juice tolerance survival rate of akkermansia muciniphila

As can be seen from the table, the artificial gastric juice tolerance of different Ackermans muciniphilic strains is AM02> AM06> standard strain in turn.

Example 3 resistance of Ackermanella muciniphila to Artificial intestinal juice

(1) Experimental methods and groups

TABLE 4 Experimental groups

1) First order seed liquid preparation

Taking 1 Ackermanomyces muciniphila strain, removing the label, wiping and disinfecting the outer surface of the glycerol cryopreservation tube by using 75% alcohol, uniformly mixing by vortex oscillation, and starting. Inoculating 100 μ L of the bacterial solution into 10 mL/tube BHI broth, shaking, preparing 3 tubes, and culturing at 37 deg.C for 2-4 days to obtain first-stage seed solution.

The first-stage seed liquid is subjected to gram staining microscopic examination and is G-bacillus free and free of spores and foreign bacteria.

2) Preparation of bacterial sludge

Respectively packaging the primary seed liquid into 1.5 mL/tube, centrifuging at 12000rpm for 10min, discarding supernatant to obtain bacterial sludge, and preparing 3 tubes of bacterial sludge from AM06, AM02 and standard strain.

3) Strain artificial intestinal juice tolerance evaluation

As shown in table 5, 1.5mL of artificial intestinal juice was added to each tube of the bacterial sludge prepared in 2), mixed, and then each tube of solution was dispensed at 0.5 mL/tube, 3 tubes were dispensed, and anaerobic incubation was performed at 37 ℃ for 0, 4 and 8 hours, respectively, and the number of viable bacteria was sampled and detected. Each group was made in 3 replicates.

TABLE 5 Experimental methods

"+" indicates that detection is required

4) Viable count determination

Respectively taking the incubated samples, carrying out 10-fold serial dilution, then taking 100 mu L of diluent to inoculate onto a BHA plate, uniformly coating, making 2 plates for each dilution, generally making 2-3 dilutions, simultaneously taking 100 mu L of diluent on the BHA plate as a negative control, culturing all coated plates under the positive anaerobic condition for about 3-5 days, observing the growth condition of colonies on the plates, and counting.

Viable count (CFU/mL) = sum of 2 plate colonies/2 × 10 × final dilution

Survival rate calculation

Survival rate = viable count/viable count corresponding to 0h × 100% at each time point

(2) Results of the experiment

TABLE 6 survival rate statistics table

As shown in the table, the artificial intestinal juice of ATCC BAA-835, AM02 and AM06 strains has good tolerance.

Example 4 non-targeted Metabolic differential analysis of Ackermanella muciniphila culture supernatant

(1) Sample preparation

After the culture supernatants of the Ackermanus muciniphila (AM 02, AM06, ATCC BAA-835) obtained in example 1 were collected, 1ml of each of the supernatants was centrifuged at 12000rpm for 5 minutes, and the supernatants were filtered through a 0.22 μm filter to obtain a filtrate as a sample to be tested, which was subjected to non-targeted metabonomic analysis. For each strain, 5 replicates of the test sample were prepared.

(2) Results of the experiment

PCA is a data dimension reduction method, namely, a plurality of variables are reduced to a group of new comprehensive variables, and then the first main components reflecting the original variable information as much as possible are selected from the new comprehensive variables, so that the purpose of reducing the dimension is achieved. The PCA diagram reflects the real distribution of the sample, is mainly used for observing the separation trend among sample groups and whether abnormal points appear or not, and reflects the variation degree among the groups and in the groups from the original data.

The results of the experiment are shown in FIG. 5, including QC samples and PCA analysis of all samples. And each QC sample is homopolymerized in the two principal component analysis diagrams, so that the instrument is stable during detection, and the repeatability of acquired data is good. The results also show that the metabolites in the AM06 culture supernatant are closer to those of BAA-835, and the metabolites in the AM02 culture supernatant are more different from those of BAA-835.

The results of comparing the amounts of the different metabolites between the strains are shown in Table 7. It can be seen that the differential metabolites detected by the positive ion (pos) mode and the differential metabolites detected by the negative ion (neg) mode were 205 and 135, respectively, for AM02 compared with the standard strain BAA-835, and 111 and 62, respectively, for AM06 compared with the standard strain BAA-835.

TABLE 7 statistical Table of differential metabolites

Example 5 drug effect experiment of Ackermanella muciniphila for treating renal hypertension in rats

1. Experimental design and procedure

SPF grade healthy Wistar rats are 120, half male and half female, the body mass (200 +/-20) g, and are randomly divided into 12 groups according to the body weight, and each group comprises 10 rats: normal control group, model group, telmisartan group (positive drug, 5 mg/kg), AKK AM06 viable bacteria low dose (10)⁶CFU/only), high dose (10)¹⁰CFU/only) group, AM02 live bacteria (10)¹⁰CFU/only) group, AM06 and AM02 viable bacteria combination group (10)¹⁰CFU/only, 10¹⁰CFU/only), BAA-835 live bacteria (10)¹⁰CFU/only), AKK bacteria AM06, AM02 killed bacteria group (10)¹⁰cell/cell), AM06 and AM02 Combined group of inactivated bacteria (10)¹⁰CFU/engine, 10¹⁰CFU/only), BAA-835 inactivated bacteria (10)¹⁰cell/only) group.

The model is made by double kidney-clamp method, except the blank group, 0.01g/mL pentobarbital sodium is given to anaesthetize each group of rats. Taking a rat fixed in a supine position, disinfecting an operation area after skin preparation by iodophor, making a longitudinal incision of 2.0-2.5 cm at a position of 0.5cm beside the abdominal midline of the rat and 0.5cm below the lower edge of a left costal arch of the rat, separating subcutaneous tissues layer by layer into an abdominal cavity, adopting a blunt separation abdominal aorta sheath, stripping the abdominal aorta, and then threading a No. 1.0 operation suture below the left and right renal artery branches of the rat for ligation, thereby causing partial renal artery stenosis. The wound is sutured, disinfected and bandaged, and penicillin is injected into the wound for 2-3 ten thousand units per unit, 1 time per day and 5 days continuously. And (3) judging the standard of successful molding: the average systolic pressure (SBP) of the rat is measured 2 weeks after the model is made, and the blood pressure difference value before the model is not less than 20mmHg and is higher than 115mmHg, so that the success of the model is determined. All rats were successfully modelled. The blank group was subjected to the same open surgery, but the abdominal aorta was not ligated.

After the molding was successful (D0), the administration was started. The normal control group and the model group are subjected to intragastric administration by 1mL of physiological saline, each administration group is subjected to corresponding dose of medicine, and the rats of each group are subjected to continuous intragastric administration for 8 weeks once a day.

After the final administration, the rats were anesthetized after measuring the blood pressure of each group of rats, 3mL of blood was drawn from the orbit, the ET-1 level was measured by the radioimmunoassay, and the nitrite and nitrate contents in the plasma of the rats were measured by the nitrate reductase colorimetric method to indirectly reflect the NO level.

All data were statistically analyzed using SPSS 25.0. P <0.05 was considered statistically different.

2. Results of the experiment

(1) Blood pressure of rat

TABLE 8 rat systolic pressure (mean + -SD) for each group

Note: indicates a significant difference p <0.05 compared to model group; * Indicates very significant p <0.01 difference.

As shown in the table above, compared with the normal control group, the blood pressure of the model group rat is obviously increased, and the model building is successful; compared with the model group, the blood pressure of the rats is reduced in each administration group.

(2) Plasma ET-1, NO content

TABLE 9 plasma ET-1, NO content (mean + -SD) of rats of each group

Group of	ET-1(pg/mL)	NO(mmol/g)
			Normal control	65.82±4.42*	26.45±4.58*
Model (model)	124.19±11.73	9.19±1.03
			Telmisartan	73.40±6.76	21.47±3.26*
Low dosage of AM06 live bacteria	80.89±6.40	18.12±2.98*
			High dose of AM06 viable bacteria	81.05±4.74	18.36±3.38*
High dose of AM02 viable bacteria	85.70±6.84	17.74±2.95
			Live AM06 bacteria + live AM02 bacteria	76.28±5.58*	21.42±3.45*
BAA-835 live bacteria	88.85±6.48	15.38±2.87
			AM06 inactivated bacteria	79.09±5.43	18.20±3.86*
AM02 inactivated bacteria	86.32±4.85	17.35±3.22
			AM06 dead bacteria + AM02 dead bacteria	79.39±5.27	20.34±3.66*
BAA-835 inactivated bacteria	89.99±6.21	15.86±3.17

Note: indicates a significant difference p <0.05 compared to the model group; * Indicates a very significant difference p <0.01.

ET-1 and NO are secreted by vascular endothelial cells, ET-1 has the functions of contracting blood vessels and raising blood pressure, and NO is an important vasodilating factor.

As shown in the above table, model group ET-1 was significantly elevated compared to the normal control group; compared with the model group, the ET-1 content in the plasma of the rat is reduced in each administration group.

Compared with a normal control group, the NO of the model group is obviously reduced; compared with a model group, the NO content in the plasma of rats is up-regulated in each administration group, and the positive drugs telmisartan and AM06 have significant differences in each group. This indicates that AKK bacteria can improve the level of blood pressure regulating factors secreted from vascular endothelium, thereby lowering blood pressure.

In conclusion, the akkermansia muciniphila can effectively prevent and treat the renal hypertension of the rat.

Example 6 efficacy test of Ackermansia muciniphila for treating spontaneous hypertension in rats

1. Experimental design and procedure

Spontaneous Hypertensive Rats (SHR) 110, male and female halves, body mass (200 ± 20) g, randomly divided by body weight into 11 groups of 10 per group: model group, captopril group (positive drug, 6.25 mg/kg), AKK bacterium AM06 viable bacteria low dose (10)⁶CFU/only), high dose (10)¹⁰CFU/only) group, AM02 live bacteria (10)¹⁰CFU/only) group, BAA-835 live bacteria (10)¹⁰CFU/only), AKK bacteria AM06, AM02 inactivating bacteria group (10)¹⁰cell/cell), AM06 inactivated bacteria and captopril combined group, AM02 inactivated bacteria and captopril combined group, BAA-835 inactivated bacteria (10)¹⁰cell/only) group. Another 10 WKY rats were used as normal control group.

All rats were acclimatized for one week and then administered (D0), and the normal control group and the model group were subjected to intragastric administration with 1mL of physiological saline, and the respective administration groups were administered with the corresponding dose of the drug once a day for 21 days.

Measuring the blood pressure of rats at the beginning of treatment and after the last administration, fasting without water prohibition for 24 hours after the last administration, taking blood from the tail artery of each group of rats, measuring the content of angiotensin II (AngII) by an ELISA method, and measuring the content of NO by a chemical one-step method.

2. Results of the experiment

(1) Blood pressure of rat

TABLE 10 blood pressure of rats in each group (mean + -SD)

Note: indicates a significant difference p <0.05 compared to the model group; * Indicates very significant p <0.01 difference.

As shown in the table above, the blood pressure of the model group is higher than that of the normal control group during the whole experiment period, and the characteristics of spontaneous hypertension are met; each administration group down-regulated the blood pressure in rats compared to the model group.

(2) Angiotensin II (AngII) and NO content

TABLE 11 angiotensin II and NO content (mean + -SD) of rats of each group

Group of	AngII(pg/mL)	NO(μmol/L)
			Normal control	36.57±8.03**	85.43±12.36
Model (model)	285.54±22.15	68.77±8.84
			Captopril	232.68±19.64	72.71±9.63
Low dose of AM06 viable bacteria	244.57±14.34	125.24±8.92*
			High dose of AM06 live bacteria	229.71±12.24	122.38±10.83*
High dose of AM02 viable bacteria	248.99±11.37	120.32±9.48*
			Live BAA-835 bacteria	250.65±13.68	110.88±9.47
AM06 inactivated bacteria	236.78±19.63	119.56±10.11
			AM02 inactivated bacteria	251.12±13.43	118.49±8.26
AM06 killed + captopril	71.47±11.42**	90.37±23.42*
			AM02 killed bacteria + captopril	80.32±12.74**	98.84±20.53*
BAA-835 inactivated bacteria	267.38±16.58	103.73±11.45

The renin-angiotensin-aldosterone system (RAAS) belongs to the endocrine system and is an important regulator of blood pressure and water and salt metabolism. Angiotensin II is a strong vasoconstrictor in this system and plays an important role in the pathogenesis of hypertension.

The AngII level in the model group is increased compared with that in the normal control group; each administration group down-regulated the rat plasma AngII level compared to the model group.

The NO level of the model group is reduced compared with that of a normal control group; compared with the model group, the serum NO level of rats is up-regulated in each administration group, wherein the live bacteria AM06 and AM02 have significant difference. This indicates that AKK can improve the level of blood pressure regulating factors in rats, thereby reducing blood pressure.

In conclusion, akkermansia muciniphila can effectively prevent and treat spontaneous hypertension of rats.

Example 7 pharmacodynamic experiment of Ackermanella muciniphila for treating metabolic hypertension caused by complex dietary factors in rats

1. Experimental design and procedure

130 male SD rats aged 8 weeks and with body mass of 130-150g are fed for 1 week, then 110 rats are randomly selected and fed with high-sugar and high-fat feed and gradient drinking wine for molding, and the rest 20 rats are fed with common feed and drinking water freely.

Group administration was carried out 4 weeks after feeding (D0): grouping by blood pressure data, selecting 110 rats successfully molded, and classifying into model group, valsartan group (positive drug, 5.7 mg/kg), and AKK AM06 viable bacteria low dose (10)⁶CFU/only), high dose (10)¹⁰CFU/only) group, AM02 live bacteria (10)¹⁰CFU/only), AM06 viable bacteria and valsartan combination, AM02 viable bacteria and valsartan combination (10)¹⁰CFU/only, 5.7 mg/kg), BAA-835 live bacteria (10)¹⁰CFU/only), AKK bacteria AM06, AM02, inactivated bacteria (10)¹⁰cell/cell) group, BAA-835 inactivated bacteria (10)¹⁰cell/only) group. Another 10 unmolded rats were used as normal control groups. The normal control group and the model group were given 1mL of physiological saline for intragastric administration, and each administration group was given the corresponding dose of the drug once a day for 6 weeks.

Measuring the blood pressure of the rat at the beginning of the administration and after the last administration; after the last administration, the patient is fasted without water prohibition for 12 hours, orbital venous plexus blood is taken for 4mL, the ET-1 content in the blood plasma is measured by an ELISA method, and the NO content in the blood plasma is measured by a chemical one-step method.

2. Results of the experiment

(1) Blood pressure of rat

TABLE 12 blood pressure of rats in each group (mean + -SD)

As shown in the table above, after the molding is finished, the blood pressure of the molded rat is higher than that of the normal control group rat, and the blood pressure of the model group rat and the blood pressure of the administration group rat are not obviously different, so the molding is successful. After 6 weeks of administration, the blood pressure of the rats in the normal control group was stable, and was equivalent to the level before administration; the blood pressure of the rats in the model group further increased, and the blood pressure of the rats in each administration group decreased.

(2) Plasma ET-1 and NO

TABLE 13 plasma ET-1 and NO content (mean + -SD) of rats in each group

Group of	ET-1(ng/L)	NO(μmol/L)
			Normal control	60.28±6.94*	40.11±6.04**
Model (model)	74.46±7.59	7.55±1.26
			Valsartan	66.64±7.48	28.92±5.40*
Low dosage of AM06 live bacteria	68.37±5.01	26.51±5.98*
			High dose of AM06 viable bacteria	67.86±9.61	25.88±6.06*
Live AM02 bacteria	68.82±7.36	25.86±7.52*
			AM06 viable bacteria + valsartan	62.46±7.23*	34.69±8.26**
AM02 viable bacteria + valsartan	63.18±8.29	32.53±7.47**
			BAA-835 live bacteria	70.27±8.76	24.37±6.82*
AM06 inactivated bacteria	68.74±6.21	26.92±5.89*
			AM02 viable bacteria	69.78±8.25	25.26±7.99*
BAA-835 inactivated bacteria	71.35±7.89	23.28±6.78*

As shown in the above table, model group ET-1 was significantly elevated compared to the normal control group; compared with the model group, the content of ET-1 in the plasma of rats is reduced in each administration group.

Compared with a normal control group, the NO of the model group is reduced remarkably; compared with the model group, the content of NO in the plasma of rats is remarkably increased in each administration group.

In conclusion, the akkermansia muciniphila can effectively prevent and treat metabolic hypertension caused by rat compound diet factors.

Example 8 efficacy experiment of Ackermansia muciniphila in combination with amlodipine for treatment of rats with isolated systolic hypertension

1. Experimental design and procedure

100 Wistar-Kyoto rats (WKY) with the age of 6-7 weeks, male animals and the body mass (190 +/-10) g, wherein 80 animals are randomly selected according to the body weight, and after 1 week of adaptive feeding, molding is started: vitamin K1 injection is injected subcutaneously on the back of 10 mg/(kg d), once a day; warfarin sodium tablet (5 mg/tablet, qilu pharmaceutical Co., ltd.) is ground into powder, and distilled water is mixed into suspension, and the suspension is subjected to intragastric administration according to warfarin sodium tablet 15 mg/(kg. D), once a day. Vitamin K1 is administered one week earlier than warfarin sodium. After 6 weeks of molding, judging the molding result, and determining that the molding is successful if the systolic pressure rises and continuously exceeds 18.67 kPa. The remaining 20 rats were gavaged at the same frequency and injected with normal saline.

After the molding is finished, 80 rats which are successfully molded are selected and divided into 8 groups, and each group comprises 10 rats: model group, amlodipine group (positive drug, 0.45mg/kg, peucedanum pharmaceuticals Co., ltd.), AKK bacterium AM06 viable bacterium group (10)¹⁰CFU/only), AM06 viable bacteria combined with amlodipine group, BAA-835 viable bacteria group (10)¹⁰CFU/only), AKK bacterium AM06 killed bacterial group (10)¹⁰cell/cell), AM06 inactivated bacteria in combination with amlodipine group and BAA-835 inactivated bacteria group (10)¹⁰cell/only). Another 10 unmolded rats were used as normal control groups. The normal control group and the model group are subjected to intragastric administration by 1mL of normal saline once a day; the corresponding dose of the drug is given to each administration group at the same frequency. The administration was carried out for 8 weeks.

After the last dose, rat blood pressure was measured; fasting and water-deprivation is 12h,10% chloral hydrate is used for anesthesia, abdominal aorta is used for taking 5mL of blood, and the levels of serum NO and AngII are measured by an ELISA method.

2. Results of the experiment

(1) Blood pressure of rat

TABLE 14 blood pressure of rats in each group (mean. + -. SD)

Group of	Pressure reduction (kPa)
		Normal control	11.41±0.98*
Model (model)	19.46±1.83
		Amlodipine (I)	13.24±1.21
Live AM06 bacterium	14.58±1.16
		AM06 viable bacteria + amlodipine	10.76±0.88*
BAA-835 live bacteria	15.67±1.25
		AM06 live kill	14.97±1.67
AM06 viable bacteria + amlodipine	11.22±1.04*
		BAA-835 inactivated bacteria	16.85±1.34

Note: indicates a significant difference p <0.05 compared to model group; * Indicates a very significant difference p <0.01.

As shown in the above table, the systolic blood pressure of the model group rats was significantly increased compared to that of the normal control group; compared with the model group, the systolic pressure of rats in each administration group is reduced, and the combination group has significant difference with the model group. This indicates that AKK can regulate blood pressure of rats and has better effect when combined with amlodipine.

(2) Serum NO, angII levels

TABLE 15 serum NO and AngII content (mean + -SD) of rats of each group

Group of	NO(μmol/L)	AngII(pgl/mL)
			Normal control	96.78±14.32*	34.54±8.87**
Model (model)	52.89±9.21	292.77±30.66
			Amlodipine (I) salt	97.71±16.53*	151.49±18.24*
Live AM06 bacterium	88.56±10.59*	173.93±12.08*
			AM06 viable bacteria + amlodipine	198.64±17.75**	48.26±9.78**
BAA-835 live bacteria	78.46±9.37*	192.46±17.78*
			AM06 inactivated bacteria	85.24±11.67*	176.15±12.27*
AM06 viable bacteria + amlodipine	192.48±19.79**	54.53±9.59**
			BAA-835 inactivated bacteria	77.46±11.67*	185.53±14.38*

As shown in the above table, the serum NO levels of the model group rats were significantly reduced compared to the normal control group. Compared with the model group, the serum NO of rats in each administration group is increased, the single medicine group and the model group have obvious difference, and the combined group and the model group have extremely obvious difference.

The level of AngII in the serum of the rats in the model group is obviously increased compared with that in the normal control group. Compared with the model group, the serum AngII of rats of each administration group is reduced, the single medicine group and the model group have obvious difference, and the combined group and the model group have extremely obvious difference. This shows that AKK bacteria can effectively regulate the levels of NO and AngII in the serum of rats, and the effect is better when the AKK bacteria is combined with amlodipine.

In conclusion, the AKK bacteria combined with the amlodipine can effectively prevent and treat the simple systolic hypertension of the rats.

The technical features of the above embodiments and examples can be combined in any suitable manner, and for the sake of brevity, all possible combinations of the technical features of the above embodiments and examples are not described, however, as long as there is no contradiction between the combinations of the technical features, the combinations of the technical features should be considered to be within the scope of the description in the present specification.

The above examples only show some embodiments of the present invention, so as to facilitate the detailed and detailed understanding of the technical solutions of the present invention, but not to be construed as limiting the scope of the present invention. It should be noted that various changes and modifications can be made by those skilled in the art without departing from the spirit of the invention, and these changes and modifications are all within the scope of the invention. Furthermore, it should be understood that various changes or modifications can be made by those skilled in the art after reading the above teachings of the present invention, and equivalents obtained thereby also fall within the scope of the present invention. It should also be understood that the technical solutions provided by the present invention, which are obtained by logical analysis, reasoning or limited experiments, are within the scope of the present invention as set forth in the appended claims. Therefore, the protection scope of the present invention should be subject to the content of the appended claims, and the description and the drawings can be used for explaining the content of the claims.

Claims

1. The application of akkermansia muciniphila in the preparation of a pharmaceutical composition for preventing and treating hypertension or a health-care product composition for improving the blood pressure level is characterized in that the akmansia muciniphila is akmansia muciniphila AM06, akmansia muciniphila AM02 or the combination of the two; wherein the content of the first and second substances,

2. The use according to claim 1, wherein said akkermansia muciniphila AM06 and said akkermansia muciniphila AM02 are each independently a live bacterium, an inactivated bacterium or a combination of live and inactivated bacteria.

3. The use of claim 1, wherein the hypertension comprises renal hypertension, idiopathic hypertension, metabolic hypertension due to complex dietary factors, or isolated systolic hypertension.

4. The use according to claim 1, wherein the pharmaceutical composition is a medicament in the form of a tablet, capsule, granule, pill, paste, solution, suspension, emulsion, cream, spray, drop, patch or tube feed; and/or the first and/or second light sources,

the health-care product composition is a health-care food, and the type of the health-care product composition is a dairy product or a fermented cereal food.

5. The use according to any one of claims 1 to 4, wherein the pharmaceutical composition or nutraceutical composition comprises an effective amount of Ackermansia muciniphila.

6. The use of any one of claims 1 to 4, wherein the subject is a mammal; optionally, the subject is a human or a mouse.

7. Use of a composition comprising akkermansia muciniphila for the preparation of a pharmaceutical composition for the prevention and treatment of hypertension or for the preparation of a nutraceutical composition for improving blood pressure levels, characterized in that akkermansia muciniphila is as defined in claim 1 or 2.

8. The use of claim 7, wherein the akkermansia muciniphila-containing composition is a nutraceutical composition, a pharmaceutical composition, or a probiotic composition, and wherein the probiotic composition further comprises a probiotic other than akkermansia muciniphila.

9. The use of claim 7 or 8, wherein the akkermansia muciniphila-containing composition further comprises a second active ingredient which is a different drug from the akkermansia muciniphila.

10. A composition comprising akkermansia muciniphila, characterized in that the composition further comprises one or more of telmisartan, captopril, valsartan and amlodipine; the akkermansia muciniphila is as defined in claim 1 or 2.