CN114949002B - Application of akkermansia muciniphila in preparation of composition for preventing and treating atherosclerosis - Google Patents

Application of akkermansia muciniphila in preparation of composition for preventing and treating atherosclerosis Download PDF

Info

Publication number
CN114949002B
CN114949002B CN202210642432.7A CN202210642432A CN114949002B CN 114949002 B CN114949002 B CN 114949002B CN 202210642432 A CN202210642432 A CN 202210642432A CN 114949002 B CN114949002 B CN 114949002B
Authority
CN
China
Prior art keywords
akkermansia muciniphila
atherosclerosis
composition
mucin
cgmcc
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN202210642432.7A
Other languages
Chinese (zh)
Other versions
CN114949002A (en
Inventor
常秀娟
李永霞
王晔
李平
常磊
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Guangzhou Zhiyi Biotechnology Co Ltd
Original Assignee
Guangzhou Zhiyi Biotechnology Co Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Guangzhou Zhiyi Biotechnology Co Ltd filed Critical Guangzhou Zhiyi Biotechnology Co Ltd
Priority to CN202210642432.7A priority Critical patent/CN114949002B/en
Publication of CN114949002A publication Critical patent/CN114949002A/en
Application granted granted Critical
Publication of CN114949002B publication Critical patent/CN114949002B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/66—Microorganisms or materials therefrom
    • A61K35/74—Bacteria
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23L—FOODS, FOODSTUFFS, OR NON-ALCOHOLIC BEVERAGES, NOT COVERED BY SUBCLASSES A21D OR A23B-A23J; THEIR PREPARATION OR TREATMENT, e.g. COOKING, MODIFICATION OF NUTRITIVE QUALITIES, PHYSICAL TREATMENT; PRESERVATION OF FOODS OR FOODSTUFFS, IN GENERAL
    • A23L33/00—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof
    • A23L33/10—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof using additives
    • A23L33/135—Bacteria or derivatives thereof, e.g. probiotics
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00—Drugs for disorders of the cardiovascular system
    • A61P9/10—Drugs for disorders of the cardiovascular system for treating ischaemic or atherosclerotic diseases, e.g. antianginal drugs, coronary vasodilators, drugs for myocardial infarction, retinopathy, cerebrovascula insufficiency, renal arteriosclerosis
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/20—Bacteria; Culture media therefor
    • C12N1/205—Bacterial isolates
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23V—INDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
    • A23V2002/00—Food compositions, function of food ingredients or processes for food or foodstuffs
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
    • C12R2001/00—Microorganisms ; Processes using microorganisms
    • C12R2001/01—Bacteria or Actinomycetales ; using bacteria or Actinomycetales
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Abstract

The invention relates to application of a mucin-philin Acremonium in preparing a composition for preventing and treating atherosclerosis, wherein the mucin-philin Acremonium is mucin-philin Acremonium AM06, mucin-philin Acremonium AM02 or a combination of the two; wherein, the mucin-philin Acremonium AM06 is preserved in China general microbiological culture Collection center with the preservation number of CGMCC No.22793; achroman mucin AM02 is preserved in China general microbiological culture Collection center (CGMCC) with the preservation number of CGMCC No.22794. In the application, the PA/LA ratio can be reduced, the atherosclerosis blood lipid level can be regulated, the vascular inflammation can be reduced, and the formation of the arteriosclerosis plaque can be effectively inhibited, so that the atherosclerosis can be effectively prevented and treated.

Description

Application of akkermansia muciniphila in preparation of composition for preventing and treating atherosclerosis
Technical Field
The invention relates to the technical field of atherosclerosis prevention and treatment, in particular to application of akkermansia muciniphila in preparation of a composition for preventing and treating atherosclerosis.
Background
Atherosclerosis (Atherosclerosis) is a common and important one of a group of vascular diseases called arteriosclerosis, and the appearance of lipids accumulated in the intima of arteries is yellow. Atherosclerosis is characterized by the combined presence of multiple lesions, including local lipid and complex carbohydrate accumulation, fibrous tissue hyperplasia and calcareous deposition to form plaque, and progressive degeneration of the middle layer of the artery, starting from the intima, with secondary lesions having intra-plaque bleeding, plaque rupture and local thrombosis (known as atherosclerosis-thrombosis). Atherosclerosis is the pathological basis of cardiovascular and cerebrovascular diseases.
Critical to the treatment of atherosclerosis are early intervention risk factors such as smoking, unbalanced diet, lack of physical activity, overweight and obesity, dyslipidemia, hypertension, diabetes, etc., protecting organs from damage. Such interventions often present compliance problems due to individual patient differentiation.
After the involvement of the relevant organ, the patient needs symptomatic treatment, mainly including lipid-regulating treatment (especially statin-enhancing treatment), antiplatelet treatment, anticoagulation and thrombolysis treatment, vascular dilation treatment, antioxidant treatment, anti-inflammatory treatment and interventional/surgical treatment. The above-mentioned drug treatments have more or less side effects, and it is difficult to improve other symptoms, and even other metabolic index abnormalities may be caused. The efficacy and safety of interventional/surgical treatments currently lacks evidence-based medical evidence. Therefore, there is a need to develop safer, more effective treatments for atherosclerosis.
Disclosure of Invention
Based on this, the invention object of the present application comprises providing an akkermansia muciniphila, which is akkermansia muciniphila AM06, akkermansia muciniphila AM02 or a combination of both, and the use of a composition comprising said akkermansia muciniphila for the preparation of a pharmaceutical composition for the prevention and treatment of atherosclerosis; wherein,
The Acremonium muciniphilum AM06 is preserved in China general microbiological culture Collection center (CGMCC) in the 28 th year of 2021, and the preservation number is CGMCC No. 22793;
the Acremonium muciniphilum AM02 is preserved in China general microbiological culture Collection center (CGMCC) in the 28 th year of 2021, and the preservation number is CGMCC No.22794.
In a first aspect of the invention, there is provided the use of akkermansia muciniphila, said akkermansia muciniphila being akkermansia muciniphila AM06, akkermansia muciniphila AM02 or a combination of both, for the preparation of a pharmaceutical composition for the prevention and treatment of atherosclerosis; wherein,
the Acremonium muciniphilum AM06 is preserved in China general microbiological culture Collection center (CGMCC) in the 28 th year of 2021, and the preservation number is CGMCC No. 22793;
the Acremonium muciniphilum AM02 is preserved in China general microbiological culture Collection center (CGMCC) in the 28 th year of 2021, and the preservation number is CGMCC No.22794.
In some embodiments, the akkermansia muciniphila AM06 and the akkermansia muciniphila AM02 are each independently a live bacterium, an inactivated bacterium, or a combination of live and inactivated bacteria.
In some embodiments, the atherosclerosis includes one or more of limb atherosclerosis, mesenteric atherosclerosis, renal atherosclerosis, cerebral atherosclerosis, and aortic atherosclerosis.
In some embodiments, the pharmaceutical composition is a pharmaceutical product in the form of a tablet, capsule, granule, pill, paste, solution, suspension, emulsion, cream, spray, drop, patch, or tube feeding formulation.
In some embodiments, the pharmaceutical composition comprises an effective amount of the akkermansia muciniphila.
In some embodiments, the subject is a mammal.
In some embodiments, the subject is a human or a mouse.
In a second aspect of the invention there is provided the use of a composition comprising akkermansia muciniphila, wherein the akkermansia muciniphila is as defined in the first aspect of the invention, in the manufacture of a pharmaceutical composition for the prevention and treatment of atherosclerosis.
In some embodiments, the composition comprising akkermansia muciniphila is a pharmaceutical composition.
In some embodiments, the composition comprising akkermansia muciniphila further comprises a second active ingredient that is a different drug than the akkermansia muciniphila.
In some embodiments, the composition comprising akkermansia muciniphila is a probiotic composition further comprising a probiotic different from the akkermansia muciniphila.
Compared with the prior art, the invention has the following beneficial effects:
the inventor of the application obtains bacterial strains AM06 (collection number CGMCC No. 22793) and AM02 (collection number CGMCC No. 22794) through separation, and the bacterial strains belong to mucin-philin Ackermans according to comprehensive analysis such as 16S rRNA analysis, morphological analysis, metabolite component analysis, efficacy analysis (such as tolerance of artificial gastric juice and artificial intestinal juice) and the like, and are identified as novel bacterial strains of mucin-philin Ackermans different from ATCC BAA-835 (standard bacterial strain) and the like.
The inventor finds that the isolated mucin-philin Achroman AM06 and/or AM02 can be used for preventing and treating atherosclerosis. The isolated mucin-philin Achroman AM06 and/or AM02 can reduce the PA/LA ratio, regulate the blood lipid level of atherosclerosis, reduce vascular inflammation, and effectively inhibit the formation of arteriosclerotic plaque, thereby effectively preventing and treating atherosclerosis.
Drawings
In order to more clearly illustrate the technical solutions in the embodiments of the present application and to more fully understand the present application and its advantageous effects, the following brief description will be given with reference to the accompanying drawings, which are required to be used in the description of the embodiments. It is obvious that the drawings in the following description are only some embodiments of the present application, and that other drawings may be obtained from these drawings without inventive effort to a person skilled in the art.
FIG. 1 is a graph showing colony characteristics of Achroman mucin AM02 cultured in accordance with an embodiment of the present invention;
FIG. 2 is a graph showing colony characteristics of Acremonium muciniphilum AM06 in accordance with one embodiment of the present invention;
FIG. 3 is a microscopic view of the culture of Achroman mucin AM02 according to an embodiment of the present invention after gram staining;
FIG. 4 is a microscopic view of the culture of Achroman mucin AM06 according to an embodiment of the present invention after gram staining;
FIG. 5 is a graph of PCA analysis of culture supernatant Xie Wu of several Acremonium mucins in accordance with one embodiment of the present invention.
Achroman mucin-philium AM06 isolated in the present invention is classified and designated asAkkermansia muciniphilaThe microorganism strain is preserved in China general microbiological culture Collection center, address: the preservation number of the Beijing city Chaoyang area North Chen Xili No. 1 and 3 is CGMCC No.22793; the strain was received from the collection at 28 of 2021 and registered, and was detected as a viable strain by the collection at 28 of 2021.
Achroman mucin AM02 isolated in the present invention is classified and namedAkkermansia muciniphilaThe microorganism strain is preserved in China general microbiological culture Collection center, address: the preservation number of the Beijing city Chaoyang area North Chen Xili No. 1 and 3 is CGMCC No.22794; the strain was received from the collection at 28 of 2021 and registered, and was detected as a viable strain by the collection at 28 of 2021.
Detailed Description
The present invention will be described in further detail with reference to the drawings, embodiments and examples. It should be understood that these embodiments and examples are provided solely for the purpose of illustrating the invention and are not intended to limit the scope of the invention in order that the present disclosure may be more thorough and complete. It will also be appreciated that the present invention may be embodied in many different forms and is not limited to the embodiments and examples described herein, but may be modified or altered by persons skilled in the art without departing from the spirit of the invention, and equivalents thereof are also intended to fall within the scope of the invention. Furthermore, in the following description, numerous specific details are set forth in order to provide a more thorough understanding of the invention, it being understood that the invention may be practiced without one or more of these details.
Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. The terminology used herein in the description of the invention is for the purpose of describing the embodiments and examples only and is not intended to be limiting of the invention.
Unless otherwise indicated or contradicted, terms or phrases used herein have the following meanings:
the term "and/or," "and/or," as used herein, includes any one of two or more of the listed items in relation to each other, as well as any and all combinations of the listed items in relation to each other, including any two of the listed items in relation to each other, any more of the listed items in relation to each other, or all combinations of the listed items in relation to each other. It should be noted that, when at least three items are connected by a combination of at least two conjunctions selected from "and/or", "or/and", "and/or", it should be understood that, in this application, the technical solutions certainly include technical solutions that all use "logical and" connection, and also certainly include technical solutions that all use "logical or" connection. For example, "a and/or B" includes three parallel schemes A, B and a+b. For another example, the technical schemes of "a, and/or B, and/or C, and/or D" include any one of A, B, C, D (i.e., the technical scheme of "logical or" connection), and also include any and all combinations of A, B, C, D, i.e., any two or three of A, B, C, D, and also include four combinations of A, B, C, D (i.e., the technical scheme of "logical and" connection).
The term "plural", and the like in the present invention refers to, unless otherwise specified, a number of 2 or more. For example, "one or more" means one kind or two or more kinds.
As used herein, "a combination thereof," "any combination thereof," and the like include all suitable combinations of any two or more of the listed items.
The "suitable" in the "suitable combination manner", "suitable manner", "any suitable manner" and the like herein refers to the fact that the technical scheme of the present invention can be implemented, the technical problem of the present invention is solved, and the technical effect expected by the present invention is achieved.
Herein, "preferred", "better", "preferred" are merely to describe better embodiments or examples, and it should be understood that they do not limit the scope of the invention. If there are multiple "preferences" in a solution, if there is no particular description and there is no conflict or constraint, then each "preference" is independent of the others.
In the present invention, "further", "still further", "particularly" and the like are used for descriptive purposes to indicate differences in content but should not be construed as limiting the scope of the invention.
In the present invention, "optional" means optional or not, that is, means any one selected from two parallel schemes of "with" or "without". If multiple "alternatives" occur in a technical solution, if no particular description exists and there is no contradiction or mutual constraint, then each "alternative" is independent.
In the present invention, the terms "first", "second", "third", etc. are used for descriptive purposes only and are not to be construed as indicating or implying a relative importance or quantity, nor as implying an importance or quantity of a technical feature being indicated. Moreover, "first," "second," "third," etc. are for non-exhaustive list description purposes only, and it should be understood that no closed limitation on the number is made.
In the invention, the technical characteristics described in an open mode comprise a closed technical scheme composed of the listed characteristics and also comprise an open technical scheme comprising the listed characteristics.
In the present invention, a numerical range (i.e., a numerical range) is referred to, and, unless otherwise indicated, a distribution of optional values within the numerical range is considered to be continuous and includes two numerical endpoints (i.e., a minimum value and a maximum value) of the numerical range, and each numerical value between the two numerical endpoints. When a numerical range merely points to integers within the numerical range, unless expressly stated otherwise, both endpoints of the numerical range are inclusive of the integer between the two endpoints, and each integer between the two endpoints is equivalent to the integer directly recited. When multiple numerical ranges are provided to describe a feature or characteristic, the numerical ranges may be combined. In other words, unless otherwise indicated, the numerical ranges disclosed herein are to be understood as including any and all subranges subsumed therein. The "numerical value" in the numerical interval may be any quantitative value, such as a number, a percentage, a proportion, or the like. "numerical interval" allows to broadly include quantitative intervals such as percentage intervals, proportion intervals, ratio intervals, etc.
The temperature parameter in the present invention is not particularly limited, and may be a constant temperature treatment or may vary within a predetermined temperature range. It should be appreciated that the constant temperature process described allows the temperature to fluctuate within the accuracy of the instrument control. Allows for fluctuations in a range such as + -5 deg.C, + -4 deg.C, + -3 deg.C, + -2 deg.C, + -1 deg.C.
In the present invention, the term "room temperature" generally means 4℃to 35℃and preferably 20.+ -. 5 ℃. In some embodiments of the invention, room temperature refers to 20 ℃ to 30 ℃.
In the present invention, referring to a unit of a data range, if a unit is only carried behind a right end point, the units indicating the left and right end points are the same. For example, 3 to 5 h means that the units of the left end point "3" and the right end point "5" are both h (hours).
All documents mentioned in this application are incorporated by reference as if each were individually incorporated by reference. Unless otherwise contradicted by purpose and/or technical solution of the present application, the cited documents related to the present invention are incorporated by reference in their entirety for all purposes. When reference is made to a cited document in the present invention, the definitions of the relevant technical features, terms, nouns, phrases, etc. in the cited document are also incorporated. In the case of the cited documents, examples and preferred modes of the cited relevant technical features are incorporated into the present application by reference, but are not limited to the embodiments that can be implemented. It should be understood that when a reference is made to the description herein, it is intended to control or adapt the present application in light of the description herein.
Ackermana muciniphilaAkkermansia muciniphila，A. muciniphila) Is an anaerobic bacterium, and accounts for 3-5% of intestinal microbiota of healthy adult. This bacterium is responsible for degrading mucin in the gut, and its lack leads to a variety of clinical diseases. Human and animal experiments indicate that a. Muciniphila controls the basic regulation system of glucose and energy metabolism. Meanwhile, the abundance of the compound is related to the metabolic disorder degree, and indexes such as metabolic endotoxemia, obesity insulin resistance, glucose tolerance and the like can be influenced.
First aspect of the invention
In a first aspect of the invention there is provided the use of akkermansia muciniphila, which is akkermansia muciniphila AM06, akkermansia muciniphila AM02 or a combination of both, in the manufacture of a pharmaceutical composition for the prevention and treatment of atherosclerosis.
The inventor of the application obtains bacterial strains AM06 (collection number CGMCC No. 22793) and AM02 (collection number CGMCC No. 22794) through separation, and the bacterial strains belong to mucin-philin Ackermans according to comprehensive analysis such as 16S rRNA analysis, morphological analysis, metabolite component analysis, efficacy analysis (such as tolerance of artificial gastric juice and artificial intestinal juice) and the like, and are identified as novel bacterial strains of mucin-philin Ackermans different from ATCC BAA-835 (standard bacterial strain) and the like.
Achroman mucin AM06 was deposited at the China general microbiological culture Collection center, having a accession number CGMCC No.22793, at 28, of 2021, and was isolated by the method of example 1 and strain identified by one or more methods including, but not limited to, examples 2 through 4.
In some embodiments, colony culture characteristics of akkermansia muciniphila AM06 include: round bumps, clean edges, opaque, white, non-uniform size colonies.
In some embodiments, the akkermansia muciniphila AM06 is isolated from breast milk.
Achroman mucin AM02 was deposited at the China general microbiological culture Collection center, having a accession number of CGMCC No.22794, at 28, of 2021, and was isolated by the method of example 1, and strain identification was performed by one or more methods including, but not limited to, examples 2 through 4.
In some embodiments, colony culturing characteristics of the akkermansia muciniphila AM02 of CGMCC No.22794 include: round bumps, clean edges, opaque, white, non-uniform size colonies.
In some embodiments, applicants have also performed an artificial gastric juice, artificial intestinal juice tolerance study. In the investigation of artificial gastric juice tolerance, the statistical analysis is carried out on the viable count after the anaerobic incubation for 0h, 1.5h and 3h at 37+/-2 ℃ on different groups of a 0.9wt% NaCl solution group, a pH3 artificial gastric juice group and a Ph2 artificial gastric juice group, and the result shows that the artificial gastric juice tolerance of the mucin-philic Ackerman strain is AM02 & gtAM 06 & gtstandard strain ATCC BAA-835 in sequence. In the artificial intestinal juice tolerance investigation experiment, the number of viable bacteria after anaerobic incubation for 0, 4 and 8 hours at 37+/-2 ℃ is statistically analyzed, and the artificial intestinal juice tolerance is superior to AM06> AM02> ATCC BAA-835.
The inventor finds that the isolated mucin-philin Achroman AM06 and/or AM02 can be used for preventing and treating atherosclerosis through a large number of experiments. The isolated mucin-philin Achroman AM06 and/or AM02 can reduce the PA/LA ratio, regulate the blood lipid level of atherosclerosis, reduce vascular inflammation, and effectively inhibit the formation of arteriosclerotic plaque, thereby effectively preventing and treating atherosclerosis.
In the present invention, "control" includes aspects of prevention, treatment, adjuvant treatment, and the like. As used herein, "controlling" refers to alleviating, slowing progression, attenuating, preventing, or maintaining an existing disease or condition. "controlling" also includes curing, preventing the development of, or alleviating to some extent one or more symptoms of a disease or disorder.
In the present invention, the "composition" may be a combination of a plurality of substances, and further, may be used in combination or may be a mixture of combinations.
The Acremoter mucin can be live bacteria, can retain biological activity through inactivation, gene recombination, transformation or modification, attenuation, chemical treatment and physical treatment, and can also be lysate, culture (such as supernatant) or component extracted from upper culture of the bacteria. Alternatively, the akkermansia muciniphila AM06 and the akkermansia muciniphila AM02 are each independently a live bacterium, an inactivated bacterium, or a combination of live and inactivated bacteria
In some embodiments, the pharmaceutical composition is a pharmaceutical product.
In the present invention, "drug" includes any agent, compound, composition or mixture that provides a physiological and/or pharmacological effect in vivo or in vitro, and often provides a beneficial effect. The range of physiological and/or pharmacological actions of the "drug" in the body is not particularly limited, and may be systemic or may be local. The activity of the "drug" is not particularly limited, and may be an active substance capable of interacting with other substances or an inert substance which does not interact with other substances.
In the present invention, the "pharmaceutical composition" means a composition having a pharmaceutically preventive effect and usable as a medicament.
In some embodiments, the pharmaceutical composition for preventing atherosclerosis is a liquid formulation or a solid formulation. Liquid formulations refer to formulations containing a liquid phase, such as, without limitation, solutions, suspensions, emulsions, and the like. Non-limiting examples of solid formulations are tablets, capsules, granules, pills, and the like.
In some embodiments, depending on the mode of administration, oral agents, injections, drops, patches, tube feeding formulations, and the like may be used.
In some embodiments, the pharmaceutical composition is in the form of a tablet, capsule, granule, pill, paste, solution, suspension, emulsion, cream, spray, drop, patch, or tube feeding formulation.
In some embodiments, the pharmaceutical composition for preventing and treating atherosclerosis comprises the akkermansia muciniphila and an adjuvant. The selected excipients may vary depending on the dosage form.
In some embodiments, the pharmaceutical composition comprises the akkermansia muciniphila and a pharmaceutically acceptable carrier.
In the present invention, "carrier" includes, but is not limited to, mannitol, sorbitol, sodium metabisulfite, sodium bisulphite, sodium thiosulfate, cysteine hydrochloride, thioglycolic acid, methionine, disodium vitamin C, EDTA, calcium sodium EDTA, monovalent alkali metal carbonates, acetates, phosphates or aqueous solutions thereof, hydrochloric acid, acetic acid, sulfuric acid, phosphoric acid, amino acids, sodium chloride, potassium chloride, sodium lactate, xylitol, maltose, glucose, fructose, dextran, glycine, starch, sucrose, lactose, mannitol, silicon derivatives, cellulose and derivatives thereof, alginates, gelatin, polyvinylpyrrolidone, glycerol, tween 80, agar, calcium carbonate, calcium bicarbonate, surfactants, polyethylene glycol, cyclodextrin, phospholipids, kaolin, talc, calcium stearate, magnesium stearate.
In the present invention, "pharmaceutically acceptable" refers to those ligands, materials, compositions, and/or dosage forms which are, within the scope of sound medical judgment, suitable for administration to patients and commensurate with a reasonable benefit/risk ratio.
In the present invention, a "pharmaceutically acceptable carrier" refers to a pharmaceutically acceptable material, composition or vehicle, such as a liquid or solid filler, diluent, excipient, solvent or encapsulating material. As used herein, the language "pharmaceutically acceptable carrier" includes buffers compatible with pharmaceutical administration, sterile water for injection, solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like. Each body must be "pharmaceutically acceptable" in the sense of being compatible with the other ingredients of the formulation and not deleterious to the patient. Suitable examples include, but are not limited to: (1) sugars such as lactose, glucose and sucrose; (2) Starches, such as corn starch, potato starch, and substituted or unsubstituted beta-cyclodextrin; (3) Cellulose and its derivatives, such as sodium carboxymethyl cellulose, ethyl cellulose, and cellulose acetate; (4) powdered tragacanth; (5) malt; (6) gelatin; (7) talc; (8) excipients, such as cocoa butter and suppository waxes; (9) Oils such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil, and soybean oil; (10) glycols, such as propylene glycol; (11) Polyols such as glycerol, sorbitol, mannitol and polyethylene glycol; (12) esters such as ethyl oleate and ethyl laurate; (13) agar; (14) buffering agents such as magnesium hydroxide and aluminum hydroxide; (15) alginic acid; (16) pyrogen-free water; (17) isotonic saline; (18) ringer's solution; (19) ethanol; (20) phosphate buffer; and (21) other non-toxic compatible substances employed in pharmaceutical formulations.
In some embodiments, the atherosclerosis-preventing composition contains an effective amount of the akkermansia muciniphila.
In the present invention, an "effective amount" refers to the amount of the component to which the term corresponds to effect treatment, prevention, alleviation and/or relief of a particular disease, disorder and/or condition in a subject, and in the present invention, unless otherwise specified, refers to the amount to effect treatment, prevention, alleviation and/or relief of an atherosclerotic disease, disorder and/or condition.
In the present invention, a "subject" is an animal, preferably a mammal, more preferably a human, and includes, but is not limited to, a patient having a disease, disorder, and/or symptom. The subject of the present invention is preferably a mammal. The term "mammal" refers primarily to warm-blooded vertebrates, including but not limited to: such as cats, dogs, rabbits, bears, foxes, wolves, monkeys, deer, mice (e.g., rats, mice), pigs, cows, sheep, horses, humans, etc., preferably primates, more preferably humans.
In some embodiments, the subject is a mammal.
In some embodiments, the subject is a human or mouse.
In the present invention, "patient" means an animal, preferably a mammal, more preferably a human. The term "mammal" refers primarily to warm-blooded vertebrates, including but not limited to: such as cats, dogs, rabbits, bears, foxes, wolves, monkeys, deer, mice, pigs, cattle, sheep, horses, humans, etc., preferably primates, more preferably humans.
In some embodiments, the composition for preventing atherosclerosis is a pharmaceutical composition. Further, the composition for preventing and treating atherosclerosis contains a therapeutically effective amount of the akkermansia muciniphila.
In the present invention, a "therapeutically effective amount" refers to an amount of a pharmaceutically active ingredient that will elicit a biological or medical response in an individual to a disease, disorder, and/or condition, such as an amount of a compound of the present invention that imparts a physiological and/or pharmacological positive effect on the individual, including but not limited to decreasing or inhibiting enzyme or protein activity or ameliorating symptoms, alleviating a disorder, slowing or delaying the progression of a disease, or preventing a disease, etc.
Second aspect of the invention
In a second aspect of the invention there is provided the use of a composition comprising akkermansia muciniphila, the definition of which is referred to in the first aspect of the invention, in the manufacture of a pharmaceutical composition for the prevention and treatment of atherosclerosis.
Further, the akkermansia muciniphila is akkermansia muciniphila AM06 (the preservation number is CGMCC No. 22793), akkermansia muciniphila AM02 (the preservation number is CGMCC No. 22794) or the combination of the two.
In some embodiments, the composition comprising Acremonium muciniphilum is a pharmaceutical composition
The definition of "composition", "control", "pharmaceutical composition" may refer to the first aspect of the invention.
In some embodiments, the composition comprising akkermansia muciniphila further comprises a second active ingredient.
In the present invention, the "active ingredient" means an ingredient having an atherosclerosis-preventing effect. The active ingredients in the invention at least comprise the mucin-philin Ackermans AM06 and/or the mucin-philin Ackermans AM02.
In some embodiments, non-limiting examples of the second active ingredient include: statin drugs, and the like.
Third aspect of the invention
In a third aspect of the invention, there is provided a method of controlling atherosclerosis comprising administering to a subject an effective amount of akkermansia muciniphila (i.e., administering to the subject an effective amount of akkermansia muciniphila).
In a third aspect of the invention, there is provided a method of controlling atherosclerosis comprising administering to a subject an effective amount of a composition comprising akkermansia muciniphila (i.e., administering to the subject an effective amount of a composition comprising akkermansia muciniphila).
The definition of "akkermansia muciniphila", "composition", "control", "effective amount", "active ingredient" can be referred to in the first or second aspect of the invention.
In some embodiments, the mode of administration of the drug includes, but is not limited to: oral, rectal, parenteral (intravenous, intramuscular or subcutaneous) injection, and topical administration, inhalation.
Solid dosage forms for oral administration may include capsules, tablets, pills, powders and granules. In these solid dosage forms, the active ingredient is admixed with at least one conventional inert excipient (or carrier), such as sodium citrate or dicalcium phosphate, or with the following ingredients: (a) Fillers or compatibilizers, for example, starch, lactose, sucrose, glucose, mannitol and silicic acid; (b) Binders, for example, hydroxymethyl cellulose, alginate, gelatin, polyvinylpyrrolidone, sucrose and acacia; (c) humectants, e.g., glycerin; (d) Disintegrants, for example, agar-agar, calcium carbonate, potato or tapioca starch, alginic acid, certain complex silicates, and sodium carbonate; (e) a slow solvent, such as paraffin; (f) an absorption accelerator, e.g., a quaternary amine compound; (g) Wetting agents, such as cetyl alcohol and glycerol monostearate; (h) an adsorbent, for example, kaolin; and (i) a lubricant, for example, talc, calcium stearate, magnesium stearate, solid polyethylene glycol, sodium lauryl sulfate, or mixtures thereof. In capsules, tablets and pills, the dosage forms may also comprise buffering agents. Solid dosage forms such as tablets, dragees, capsules, pills and granules can be prepared with coatings and shells, such as enteric coatings and other materials well known in the art. They may contain opacifying agents and the release of the active compound or compounds in such compositions may be released in a delayed manner in a certain part of the digestive tract. Examples of embedding components that can be used are polymeric substances and waxes. The active compound may also be in the form of microcapsules with one or more of the above excipients, if desired.
Liquid dosage forms for oral administration include pharmaceutically acceptable emulsions, solutions, suspensions, syrups or tinctures. In addition to the active ingredient, the liquid dosage forms may contain inert diluents commonly used in the art such as, for example, water or other solvents, solubilizing agents and emulsifiers such as ethyl alcohol, isopropyl alcohol, ethyl carbonate, ethyl acetate, propylene glycol, 1, 3-butylene glycol, dimethylformamide and oils, in particular, cottonseed, groundnut, corn germ, olive, castor and sesame oils or mixtures of these substances. In addition to these inert diluents, the compositions can also include adjuvants such as wetting agents, emulsifying and suspending agents, sweetening, flavoring, and perfuming agents. Such as suspensions, may contain suspending agents as, for example, particularly ethoxylated isostearyl alcohols, polyoxyethylene sorbitol and sorbitan esters, microcrystalline cellulose, aluminum methoxide and agar or mixtures of these substances.
Compositions for parenteral injection may comprise physiologically acceptable sterile aqueous or non-aqueous solutions, dispersions, suspensions or emulsions, as well as sterile powders for reconstitution into sterile injectable solutions or dispersions. Suitable aqueous or nonaqueous carriers, diluents, solvents or excipients include water, ethanol, polyols and suitable mixtures thereof.
Dosage forms for topical administration include ointments, powders, patches, sprays and inhalants. Is prepared by mixing the active ingredient under aseptic condition with pharmaceutically acceptable carrier and any preservative, buffer or propellant as required.
It will be appreciated that the medicament of the embodiments of the present invention may be formulated with different pharmaceutically acceptable excipients to provide suitable clinical dosage forms including, but not limited to, those described above.
Some specific examples are provided below.
Embodiments of the present invention will be described in detail below with reference to examples. It is to be understood that these examples are illustrative of the present invention and are not intended to limit the scope of the present invention. The experimental methods in the following examples, in which specific conditions are not noted, are preferably referred to the guidelines given in the present invention, and may be according to the experimental manual or conventional conditions in the art, the conditions suggested by the manufacturer, or the experimental methods known in the art.
In the specific examples described below, the measurement parameters relating to the raw material components, unless otherwise specified, may have fine deviations within the accuracy of weighing. Temperature and time parameters are involved, allowing acceptable deviations from instrument testing accuracy or operational accuracy.
With a sterile sampling spoon, soybean grain-sized feces (samples were derived from adult healthy men) were taken in a 10mL centrifuge tube, and immediately after sampling, the samples were transferred to a 37℃anaerobic workstation (85% N) 2 、10%H 2 、5%CO 2 ) According to the following steps of 1: dilution of the sample to 10 -9 1mL of each dilution solution is inoculated to 9mL of mucin serving as the only carbon sourceAnaerobic culture was performed for 7 days in the basal medium. Take 10 -4 Dilution of inoculated culture medium 1mL, 1:10 dilution method the culture solution was diluted to 10 -6 100. Mu.L of each dilution was spread on mucin agar medium, and cultured anaerobically for 7 days, and single colonies were picked and inoculated into 2mL of BHI broth (N-acetyl-D-glucosamine-containing medium). And (3) performing 16S RNA sequencing on the cultured bacterial liquid, and identifying the bacterial liquid as the akkermansia muciniphila, wherein the 16S RNA sequencing result is shown as SEQ ID NO: 1:
GTGACGGGCGGGGTGCATAGACATGCAGTCGAACGAGAGAATTGCTAGCTTGCTAATAATTCTCTAGTGGCGCACGGGTGAGTAACACGTGAGTAACCTGCCCCCGAGAGCGGGATAGCCCTGGGAAACTGGGATTAATACCGCATAGTATCGAAAGATTAAAGCAGCAATGCGCTTGGGGATGGGCTCGCGGCCTATTAGTTAGTTGGTGAGGTAACGGCTCACCAAGGCGATGACGGGTAGCCGGTCTGAGAGGATGTCCGGCCACACTGGAACTGAGACACGGTCCAGACACCTACGGGTGGCAGCAGTCGAGAATCATTCACAATGGGGGAAACCCTGATGGTGCGACGCCGCGTGGGGGAATGAAGGTCTTCGGATTGTAAACCCCTGTCATGTGGGAGCAAATTAAAAAGATAGTACCACAAGAGGAAGAGACGGCTAACTCTGTGCCAGCAGCCGCGGTAATACAGAGGTCTCAAGCGTTGTTCGGAATCACTGGGCGTAAAGCGTGCGTAGGCTGTTTCGTAAGTCGTGTGTGAAAGGCGCGGGCTCAACCCGCGGACGGCACATGATACTGCGAGACTAGAGTAATGGAGGGGGAACCGGAATTCTCGGTGTAGCAGTGAAATGCGTAGATATCGAGAGGAACACTCGTGGCGAAGGCGGGTTCCTGGACATTAACTGACGCTGAGGCACGAAGGCCAGGGGAGCGAAAGGGATTAGATACCCCTGTAGTCCTGGCAGTAAACGGTGCACGCTTGGTGTGCGGGGAATCGACCCCCTGCGTGCCGGAGCTAACGCGTTAAGCGTGCCGCCTGGGGAGTACGGTCGCAAGATTAAAACTCAAAGAAATTGACGGGGACCCGCACAAGCGGTGGAGTATGTGGCTTAATTCGATGCAACGCGAAGAACCTTACCTGGGCTTGACATGTAATGAACAACATGTGAAAGCATGCGACTCTTCGGAGGCGTTACAACAGGTGCTGCATGGCCGTCGTCAGCTCGTGTCGTGAGATGTTTGGTTAAGTCCAGCAACGAGCGCAACCCCTGTTGCCAGTTACCAGCACGTGAAGGTGGGGACTCTGGCGAGACTGCCCAGATCAACTGGGAGGAAGGTGGGGACGACGTCAGGTCAGTATGGCCCTTATGCCCAGGGCTGCACACGTACTACAATGCCCAGTACAGAGGGGGCCGAAGCCGCGAGGCGGAGGAAATCCTGAAAACTGGGCCCAGTTCGGACTGTAGGCTGCAACCCGCCTACACGAAGCCGGAATCGCTAGTAATGGCGCATCAGCTACGGCGCCGTGAATACGTTCCCGGGTCTTGTACACACCGCCCGTCACATCATGGAAGCCGGTCGCACCCGAAGTATCTGAAGCCAACCGCAAGGAGGCAGGTCCTAAGGTAGACTACTGTCTAT
the 16S sequence alignment of SEQ ID NO. 1 with ATCC BAA-835 shows a Per.Ident value of 99.43%.
Freshly collected breast milk samples (from adult healthy females) were immediately injected into 5mL anaerobic penicillin bottles for storage, and the samples were transferred to a 37 ℃ anaerobic workstation (85% n) 2 、10%H 2 、5%CO 2 ) According to the following steps of 1: dilution of the sample to 10 -6 1mL of each dilution solution was inoculated into 9mL of basal medium with mucin as the only carbon source, and anaerobic culture was performed for about 1 month. Take 10 -1 -10 -4 Dilution of inoculated culture medium 1mL, 1:10 dilution method the culture solution was diluted to 10 -6 100. Mu.L of each dilution was spread on mucin agar medium, and cultured anaerobically for 7 days, and single colonies were picked and inoculated into 2mL of BHI broth (N-acetyl-D-glucosamine-containing medium). And (3) performing 16S RNA sequencing identification on the cultured bacterial liquid, and performing sequence alignment on the 16S RNA sequence on NCBI, wherein the result is identified as the Alkermansia muciniphila, and the 16S RNA sequencing result is shown as SEQ ID NO: 2:
CGGATTACGGCGTGCTAAGACTGCAGTCGACGAGAGATTGCTAGCTTGCTAATAATTCTCTAGTGGCGCACGGGTGAGTAACACGTGAGTAACCTGCCCCCGAGAGCGGGATAGCCCTGGGAAACTGGGATTAATACCGCATAGTATCGAAAGATTAAAGCAGCAATGCGCTTGGGGATGGGCTCGCGGCCTATTAGTTAGTTGGTGAGGTAACGGCTCACCAAGGCGATGACGGGTAGCCGGTCTGAGAGGATGTCCGGCCACACTGGAACTGAGACACGGTCCAGACACCTACGGGTGGCAGCAGTCGAGAATCATTCACAATGGGGGAAACCCTGATGGTGCGACGCCGCGTGGGGGAATGAAGGTCTTCGGATTGTAAACCCCTGTCATGTGGGAGCAAATTAAAAAGATAGTACCACAAGAGGAAGAGACGGCTAACTCTGTGCCAGCAGCCGCGGTAATACAGAGGTCTCAAGCGTTGTTCGGAATCACTGGGCGTAAAGCGTGCGTAGGCTGTTTCGTAAGTCGTGTGTGAAAGGCGCGGGCTCAACCCGCGGACGGCACATGATACTGCGAGACTAGAGTAATGGAGGGGGAACCGGAATTCTCGGTGTAGCAGTGAAATGCGTAGATATCGAGAGGAACACTCGTGGCGAAGGCGGGTTCCTGGACATTAACTGACGCTGAGGCACGAAGGCCAGGGGAGCGAAAGGGATTAGATACCCCTGTAGTCCTGGCAGTAAACGGTGCACGCTTGGTGTGCGGGGAATCGACCCCCTGCGTGCCGGAGCTAACGCGTTAAGCGTGCCGCCTGGGGAGTACGGTCGCAAGATTAAAACTCAAAGAAATTGACGGGGACCCGCACAAGCGGTGGAGTATGTGGCTTAATTCGATGCAACGCGAAGAACCTTACCTGGGCTTGACATGTAATGAACAACATGTGAAAGCATGCGACTCTTCGGAGGCGTTACACAGGTGCTGCATGGCCGTCGTCAGCTCGTGTCGTGAGATGTTTGGTTAAGTCCAGCAACGAGCGCAACCCCTGTTGCCAGTTACCAGCACGTGAAGGTGGGGACTCTGGCGAGACTGCCCAGATCAACTGGGAGGAAGGTGGGGACGACGTCAGGTCAGTATGGCCCTTATGCCCAGGGCTGCACACGTACTACAATGCCCAGTACAGAGGGGGCCGAAGCCGCGAGGCGGAGGAAATCCTAAAAACTGGGCCCAGTTCGGACTGTAGGCTGCAACCCGCCTACACGAAGCCGGAATCGCTAGTAATGGCGCATCAGCTACGGCGCCGTGAATACGTTCCCGGGTCTTGTACACACCGCCCGTCACATCATGGAAGCCGGTCGCACCCGAAGTCATTACTGAAGCCAACCGCAAGGAGGCAGGTCCTAAAGTGAGACTATAACAA
the 16S sequence alignment of SEQ ID NO. 2 with ATCC BAA-835 shows a Per.Ident value of 99.22%.
Alkerman mucin-philins were streaked onto BHA plates and cultured anaerobically for 3 days. Colony morphology, staining characteristics, size, sphere shape, distribution, etc. were observed.
Colony characteristics: after 3 days of culture on the above medium, achroman muciniphilum exhibited round raised, clean-edged, opaque, white, non-uniform-sized colonies, see FIG. 1 (AM 02) and FIG. 2 (AM 06).
Morphology under microscope: the mucin-philin ackermannin bacteria were subjected to gram staining microscopy, as gram-negative bacteria, in oval, single or chain arrangement, see fig. 3 (AM 02) and fig. 4 (AM 06).
And (3) inoculating a single colony into BHI broth, culturing for 48 hours (the temperature is 37 ℃), centrifuging and precipitating the obtained bacterial liquid at the speed of 16000 Xg, centrifuging for 30min, removing the supernatant, and collecting the precipitate to obtain the mucin-philin Achroman bacterial mud.
And carrying out pasteurization on the obtained mucin-philin Acremonium mud to obtain mucin-philin Acremonium inactivated bacteria.
Respectively culturing to obtain AM02, AM06 and ATCC BAA-835 mucin-philin Ackermans.
(1) Experimental method and grouping
TABLE 1 grouping of experiments
TABLE 2 Experimental methods
"+" indicates detection
1) Taking 1 strain of Acremonium muciniphilum, removing the label, wiping and sterilizing the outer surface of the glycerol freezing tube by 75% alcohol, and uniformly mixing by vortex oscillation and opening. Absorbing 100-500 mu L of bacterial liquid, inoculating the bacterial liquid into 10 mL/tube of BHI broth, shaking uniformly, preparing 3 tubes in total, simultaneously taking the bacterial liquid as negative control, and placing the bacterial liquid at 37 ℃ for anaerobic culture for 2-4 days to obtain primary seed liquid.
The first seed liquid is subjected to gram staining microscopic examination and should be G-bacillus, free of spores and free of miscellaneous bacteria.
2) Taking 10mL of the primary seed solution, centrifuging for 10min at the temperature of 12000 Xg and 4 ℃, discarding the supernatant, adding 1mL of 0.9% NaCl solution for resuspension, and respectively preparing bacterial solutions for later use.
3) AM06, AM02 and standard bacterial strain bacterial solutions are respectively added into artificial gastric juice with the concentration of 0.9 percent of NaCl, the pH value of 3 and the pH value of 2 according to the table 2, and are evenly mixed, split into 5 mL/tube, placed in an anaerobic glove box for incubation at 37 ℃ for 0h, 1.5h and 3h, and then taken out for detection of the bacterial concentration of each sample. Each experimental group was made in 3 replicates.
4) Viable cell count determination:
taking an experimental sample, taking 100 mu L of diluent after 10-time serial dilution, inoculating the diluent onto a BHA flat plate, uniformly coating, making 2 plates for each diluent, generally making 2-3 dilutions, taking 100 mu L of diluent on the BHA flat plate at the same time as a negative control, culturing all coated plates for about 3-5 days under the normal anaerobic condition, observing colony growth conditions on the plates, and counting.
The viable count was calculated from the sum of the colony counts of 2 plates according to the following formula:
viable count (CFU/mL) =sum of 2 plate colony counts/2×10×final dilution
Survival rate calculation:
survival rate =×100%
(2) Experimental results
TABLE 3 statistical Table of results of survival rate of artificial gastric juice tolerance of Achroman mucin
As can be seen from the table, the artificial gastric juice tolerance of different mucin-philin Ackerman strains is AM02 > AM06 > standard strain in turn.
(1) Experimental method and grouping
TABLE 4 grouping of experiments
1) Preparation of first-level seed liquid
Taking 1 Acremonium muciniphilum strain to remove the label, wiping and sterilizing the outer surface of the glycerol cryopreservation tube with 75% alcohol, and stirring, mixing and opening. 100 mu L of bacterial liquid is absorbed and inoculated into 10 mL/tube of BHI broth, and the mixture is shaken uniformly to prepare 3 tubes, and meanwhile, the bacterial liquid is not inoculated as negative control, and is placed in anaerobic culture at 37 ℃ for 2-4 days, so that first-stage seed liquid is obtained.
The first seed liquid is subjected to gram staining microscopic examination and should be G-bacillus, free of spores and free of miscellaneous bacteria.
2) Preparation of bacterial mud
Subpackaging the first-stage seed solution into 1.5 mL/tube, centrifuging at 12000rpm for 10min, and discarding supernatant to obtain bacterial sludge, and respectively preparing 3 tubes of bacterial sludge from AM06, AM02 and standard strain.
3) Evaluation of Artificial intestinal juice tolerance of Strain
As shown in Table 5, 1.5mL of artificial intestinal juice is added to each tube of the bacterial sludge prepared in 2), the mixture is uniformly mixed, then each tube of solution is split-packed according to 0.5 mL/branch, 3 tubes are split-packed, anaerobic incubation is carried out at 37 ℃ for 0h, 4h and 8h respectively, and the number of living bacteria is sampled and detected. Each group was made in 3 parallels.
TABLE 5 Experimental methods
"+" indicates detection
4) Viable cell count measurement
Taking 100 mu L of the incubated sample, inoculating the sample onto a BHA flat plate, uniformly coating, making 2 plates for each dilution, generally making 2-3 dilutions, taking 100 mu L of the dilution on the BHA flat plate at the same time as a negative control, culturing all the coated plates under the anaerobic condition for about 3-5 days, observing the colony growth condition on the plates, and counting.
Viable count (CFU/mL) =sum of 2 plate colony counts/2×10×final dilution
Survival rate calculation:
survival rate = number of viable bacteria per time point/number of viable bacteria corresponding to 0h x 100%
(2) Experimental results
TABLE 6 survival statistics
As shown in the table, ATCC BAA-835, AM02, AM06 strain artificial intestinal juice tolerance is good.
(1) Sample preparation
After the culture supernatants of the respective mucin-philins Acremonium (AM 02, AM06, ATCC BAA-835) obtained in example 1 were centrifuged at 12000rpm for 5min, the supernatants were filtered through a 0.22 μm filter, and the filtrates were used as samples to be tested for non-targeted metabonomics analysis. 5 parallel samples to be tested were prepared for each strain.
(2) Experimental results
PCA is a data dimension-reducing method, namely, reducing dimensions of a plurality of variables to a group of new comprehensive variables, and then selecting the first few main components reflecting original variable information as much as possible, thereby achieving the purpose of dimension reduction. The PCA chart reflects the real distribution condition of the samples, is mainly used for observing the separation trend among sample groups and whether abnormal points appear or not, and reflects the variation degree among groups and in groups from the original data.
The experimental results are shown in fig. 5, which contains the QC samples and PCA analysis of all samples. Wherein, each QC sample is gathered together in two principal component analysis charts, which shows that the instrument is stable during the detection period and the repeatability of the acquired data is good. The results also show that the metabolites in AM06 culture supernatants are closer to BAA-835 and that AM02 differs significantly from the culture supernatant metabolites of BAA-835.
The results of comparing the amounts of the differential metabolites between the strains are shown in Table 7. It can be seen that the difference metabolites detected in positive (pos) and negative (neg) modes were 205 and 135, respectively, for AM02 compared to the standard strain BAA-835, and 111 and 62, respectively, for AM06 compared to the standard strain BAA-835.
TABLE 7 statistical tables of differential metabolites
1. Experimental design and flow
SPF-grade SD rats 130, 6-7 weeks old, male and female halves, weighing 180-200g, were purchased from Zhejiang Vetong Lihua laboratory animal technologies Co. After one week of adaptive feeding, 110 rats were randomly selected for atherosclerosis modeling based on body weight: the stomach was irrigated with a daily morning high fat emulsion (8 mL/kg) for eight weeks; after one week of gastric lavage, vitamin D is injected intraperitoneally 3 (70U/kg). The formula (wt%) of the high-fat emulsion comprises: lard (15%), cholesterol (2.5%), yolk powder (2.5%), sodium hyocholate (0.5%), propylthiouracil (0.25%), glucose (2.5%), tween-80 (1%), distilled water (75.75%). The remaining 20 rats were infused with 1.5mL of physiological saline daily in the morning and after one week of gastric lavage, an equal volume of physiological saline was injected intraperitoneally.
After molding for 8 weeks, 110 rats successfully molded are selected and randomly divided into 11 groups of 10 rats: model group, positive drug group (atorvastatin calcium, 0.45g/kg, congo.) and AKK bacterium AM06 live bacteria low dose (10) 6 CFU/dose, high dose (10) 10 CFU/group only), AM02 viable bacteria (10) 10 CFU/group alone), AM06 viable bacteria and AM02 viable bacteria combined group (10) 10 CFU/alone),BAA-835 live bacterial group (10) 10 CFU/animal, AKK bacterium AM06, AM02 inactivated bacterium group (10) 10 cell/cell), AM06 inactivated bacteria and AM02 inactivated bacteria combined group (10) 10 cell/only), BAA-835 inactivated bacteria group (10) 10 cell/cell only). Another 10 non-model rats were taken as normal control.
Administration started after grouping (D0): the normal control group and the model group are filled with 0.5mL of physiological saline in the afternoon every day, and the corresponding doses of medicaments are simultaneously and continuously administered for 8 weeks. During the administration period, the model group and each administration group perfuse the gastric high-fat emulsion, and the normal control group perfuse the gastric physiological saline.
After the end of the administration, the animals were fasted without water inhibition for 12 hours, the chloral hydrate was anesthetized, the abdominal aorta was bled, and ELISA was used to measure the total plasma cholesterol (TC), triglyceride (TG), IL-6 and TNF-alpha levels in rats; rats were sacrificed immediately after blood collection, the aorta was removed, 4% paraformaldehyde was fixed, the sections were cut after embedding, and Image G calculated aortic Plaque Area (PA) and aortic Lumen Area (LA), and aortic PA/LA ratios were calculated for each group of rats.
Data analysis was performed using SPSS25.0, with p <0.05 considered statistically different.
2. Experimental results
(1) Aortic PA/LA ratio
Table 8, rat aortic PA/LA ratio (mean+ -SD) for each group
Note that: compared to the model group, x represents a significant difference p <0.05; represents a very significant difference p <0.01.
The PA/LA ratio directly reflects the size of the atherosclerotic plaque. As shown in the table above, the model group PA/LA was significantly elevated compared to the normal control group, and the modeling was successful. The PA/LA ratio was decreased for each dosing group compared to the model group, with significant differences in positive drug. This suggests that AKK bacteria are effective in inhibiting the formation of atherosclerotic plaques in rats.
(2) Blood fat index
Table 9, serum TC, TG levels (mean+ -SD) in each group of rats
Note that: compared to the model group, x represents a significant difference p <0.05; represents a very significant difference p <0.01.
As shown in the table above, the plasma TC, TG levels were significantly elevated in the rats of the model group compared to the normal control group. Compared with the model group, the plasma TC and TG levels of rats in each administration group are reduced, and the positive drugs, AM06 and AM02 and the inactivated bacteria in each group have obvious differences. This suggests that AKK bacteria are effective in regulating blood lipid levels in atherosclerotic rats.
(3) Plasma inflammatory factor
Table 10, plasma inflammatory factor levels (mean+ -SD) for rats of each group
Note that: compared to the model group, x represents a significant difference p <0.05; * Represents a very significant difference p <0.01.
The process of atherosclerosis is mainly manifested by inflammation of the vessel wall, and IL-6 and TNF-alpha are known as inflammatory factors.
As shown in the above table, the IL-6 and TNF- α levels were both significantly elevated in the model group compared to the normal control group. IL-6 and TNF- α levels were reduced in each of the dosing groups compared to the model group. This suggests that AKK bacteria can regulate rat plasma inflammatory factors and reduce vascular inflammation.
In conclusion, AKK bacteria can effectively treat experimental atherosclerosis of rats.
Example 6 Acremonium muciniphilum prevention of ApoE -/- Efficacy experiment of experimental atherosclerosis in mice
1. Experimental design and flow
SPF-class inbred line C57BL/6J background male ApoE of 6-7 weeks old -/- 140 mice were purchased from laboratory animals in Guangdong provinceAnd (5) a heart. After 1 week of adaptive feeding, the animals were randomly divided into 14 groups of 10 animals each according to body weight: normal control group, model group, positive drug group (simvastatin, moxadong, 5 mg/kg), AKK strain AM06 live strain low dose (10) 6 CFU/dose, high dose (10) 10 CFU/group only), AM02 viable bacteria (10) 10 CFU/only), AM06 live bacteria and simvastatin combination group (10) 10 CFU/4, 5 mg/kg), AM02 live bacteria and simvastatin combination group (10) 10 CFU/1, 5 mg/kg), BAA-835 live bacterial group (10 10 CFU/animal, AKK bacterium AM06, AM02 inactivated bacterium group (10) 10 cell/alone), AM06 inactivated bacteria and simvastatin combination group (10) 10 cell/, 5 mg/kg), AM02 inactivated bacteria and simvastatin combination group (10) 10 cell/5 mg/kg), BAA-835 inactivated bacteria group (10) 10 cell/cell only). Normal control group was given normal feed after grouping, model group and each group was given high fat feed (cholesterol 1%, lard 5%).
The day of grouping (D0) starts dosing: the normal control group and the model group were perfused with 0.5% sodium hydroxymethyl cellulose (CMCNa) 0.5mL once daily; each dosing group was given the corresponding dose of drug for 6 weeks.
After the last dose, all mice were fasted for 12h,3% pentobarbital sodium was intraperitoneally injected with 1mL of anesthesia, the eyeballs were taken for blood collection, and the ELISA was used to detect total serum cholesterol (TC), triglyceride (TG), TNF- α and IL-6 in the mice; after blood collection, the aorta was sacrificed, 4% paraformaldehyde was removed for fixation, stained with oil red O, and Image-Pro 5.0 was analyzed for aortic plaque area.
Data analysis was performed using SPSS25.0, with p <0.05 considered statistically different.
2. Experimental results
(1) Aortic plaque area
Table 11, aortic plaque area (mean.+ -. SD) for each group of mice
Note that: compared to the model group, x represents a significant difference p <0.05; represents a very significant difference p <0.01.
As shown in the table above, the model group showed significant arteriosclerotic plaque compared to the normal control group, and the molding was successful. Each dosing group down-regulated the area of arteriosclerotic plaque compared to the model group. This demonstrates that AKK bacteria are effective in inhibiting ApoE -/- Formation of arteriosclerotic plaque in mice.
(2) Blood fat index
Table 12, blood lipid index (mean+ -SD) of mice in each group
Note that: compared to the model group, x represents a significant difference p <0.05; * Represents a very significant difference p <0.01.
As shown in the table above, model group serum TC was significantly elevated compared to the normal control group. Compared with the model group, each administration group down-regulates the serum TC of the mice, and each group of positive drugs, AM06 and inactivated bacteria has obvious difference.
Model group serum TG was elevated compared to normal control group. Mice serum TG was down-regulated by each dosing group compared to the model group. This demonstrates that AKK bacteria are effective in modulating ApoE -/- Blood lipid levels in mice.
(3) Serum inflammatory factor
TABLE 13 serum inflammatory factors (mean+ -SD) for mice of each group
Note that: compared to the model group, x represents a significant difference p <0.05; * Represents a very significant difference p <0.01.
As shown in the table above, the model group of mice had significantly elevated TNF- α compared to the normal control group. The TNF-alpha levels were reduced in each of the dosing groups compared to the model group.
Model group mice had significantly elevated IL-6 compared to normal control group. Mice in each group had a reduced IL-6 level compared to the model group. This suggests that AKK bacteria are capable of modulating ApoE -/- Mouse serum inflammatory factor can inhibit vascular inflammation.
In conclusion, AKK bacteria can effectively prevent ApoE -/- Experimental atherosclerosis in mice.
The technical features of the above embodiments and examples may be combined in any suitable manner, and for brevity of description, all of the possible combinations of the technical features of the above embodiments and examples are not described, however, as long as there is no contradiction between the combinations of the technical features, they should be considered to be within the scope described in the present specification.
The above examples merely illustrate several embodiments of the present invention, which facilitate specific and detailed understanding of the technical solutions of the present invention, but should not be construed as limiting the scope of protection of the present invention. It should be noted that it will be apparent to those skilled in the art that several variations and modifications can be made without departing from the spirit of the invention, which are all within the scope of the invention. Further, it is understood that various changes and modifications of the present invention may be made by those skilled in the art after reading the above teachings, and equivalents thereof are intended to fall within the scope of the present invention. It should also be understood that, based on the technical solutions provided by the present invention, those skilled in the art obtain technical solutions through logical analysis, reasoning or limited experiments, all of which are within the scope of protection of the appended claims. The scope of the patent is therefore intended to be covered by the appended claims, and the description and drawings may be interpreted as illustrative of the contents of the claims.

Claims (10)

1. The application of the akkermansia muciniphila in preparing the pharmaceutical composition for preventing and treating atherosclerosis is characterized in that the akkermansia muciniphila is akkermansia muciniphila AM06, akkermansia muciniphila AM02 or the combination of the two; wherein,
the Acremonium muciniphilum AM06 is preserved in China general microbiological culture Collection center (CGMCC) in the 28 th year of 2021, and the preservation number is CGMCC No.22793;
the Acremonium muciniphilum AM02 is preserved in China general microbiological culture Collection center (CGMCC) in the 28 th year of 2021, and the preservation number is CGMCC No.22794;
the pharmaceutical composition contains an effective amount of the akkermansia muciniphila.
2. The use according to claim 1, wherein said akkermansia muciniphila AM06 and said akkermansia muciniphila AM02 are each independently a live bacterium, an inactivated bacterium or a combination of live and inactivated bacteria.
3. The use of claim 1, wherein the atherosclerosis comprises one or more of limb atherosclerosis, mesenteric atherosclerosis, renal atherosclerosis, cerebral atherosclerosis and aortic atherosclerosis.
4. The use according to claim 1, wherein the pharmaceutical composition is a pharmaceutical product in the form of a tablet, capsule, granule, pill, paste, solution, suspension, emulsion, cream, spray, drop, patch or tube feeding formulation.
5. The use according to any one of claims 1 to 4, wherein the subject is a mammal.
6. The use of claim 5, wherein the subject is a human or a mouse.
7. Use of a composition comprising akkermansia muciniphila for the preparation of a pharmaceutical composition for the prevention and treatment of atherosclerosis, characterized in that the akkermansia muciniphila is as defined in claim 1 or 2.
8. The use according to claim 7, wherein the composition comprising akkermansia muciniphila is a pharmaceutical composition.
9. The use according to claim 7 or 8, wherein the composition comprising akkermansia muciniphila further comprises a second active ingredient which is a different medicament than the akkermansia muciniphila.
10. The use according to claim 7 or 8, wherein the composition comprising akkermansia muciniphila is a probiotic composition further comprising a probiotic different from the akkermansia muciniphila.
CN202210642432.7A 2022-06-08 2022-06-08 Application of akkermansia muciniphila in preparation of composition for preventing and treating atherosclerosis Active CN114949002B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202210642432.7A CN114949002B (en) 2022-06-08 2022-06-08 Application of akkermansia muciniphila in preparation of composition for preventing and treating atherosclerosis

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202210642432.7A CN114949002B (en) 2022-06-08 2022-06-08 Application of akkermansia muciniphila in preparation of composition for preventing and treating atherosclerosis

Publications (2)

Publication Number Publication Date
CN114949002A CN114949002A (en) 2022-08-30
CN114949002B true CN114949002B (en) 2024-03-19

Family

ID=82962445

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202210642432.7A Active CN114949002B (en) 2022-06-08 2022-06-08 Application of akkermansia muciniphila in preparation of composition for preventing and treating atherosclerosis

Country Status (1)

Country Link
CN (1) CN114949002B (en)

Citations (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
AU2013346726A1 (en) * 2012-11-19 2015-06-04 Universite Catholique De Louvain Use of akkermansia for treating metabolic disorders
WO2016049827A1 (en) * 2014-09-30 2016-04-07 Bgi Shenzhen Co., Limited Use of bacteroides in prevention and treatment for coronary artery disease
AU2016319221A1 (en) * 2015-09-10 2018-03-29 Université Catholique de Louvain Use of pasteurized Akkermansia for treating metabolic disorders
CN110964650A (en) * 2018-09-27 2020-04-07 上海上药信谊药厂有限公司 Bacterial strain for preventing and treating metabolic diseases and application thereof
KR102271821B1 (en) * 2020-12-18 2021-07-01 주식회사 엔테로바이옴 Composition Comprising Orlistat and Akkermansia muciniphila EB-AMDK19
CN113330109A (en) * 2018-10-11 2021-08-31 Ko生物技术有限公司 Akkermansia muciniphila strain and application thereof
CN113862193A (en) * 2021-10-28 2021-12-31 江西普瑞森基因科技有限公司 Ackermanella muciniphila and application thereof in preparation of antitumor drugs
CN114250179A (en) * 2021-12-22 2022-03-29 苏州普瑞森生物科技有限公司 Microbial composition with weight-losing effect and application thereof

Patent Citations (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
AU2013346726A1 (en) * 2012-11-19 2015-06-04 Universite Catholique De Louvain Use of akkermansia for treating metabolic disorders
CN111603488A (en) * 2012-11-19 2020-09-01 卢万天主教大学 Use of akkermansia for the treatment of metabolic disorders
WO2016049827A1 (en) * 2014-09-30 2016-04-07 Bgi Shenzhen Co., Limited Use of bacteroides in prevention and treatment for coronary artery disease
AU2016319221A1 (en) * 2015-09-10 2018-03-29 Université Catholique de Louvain Use of pasteurized Akkermansia for treating metabolic disorders
CN110964650A (en) * 2018-09-27 2020-04-07 上海上药信谊药厂有限公司 Bacterial strain for preventing and treating metabolic diseases and application thereof
CN113330109A (en) * 2018-10-11 2021-08-31 Ko生物技术有限公司 Akkermansia muciniphila strain and application thereof
KR102271821B1 (en) * 2020-12-18 2021-07-01 주식회사 엔테로바이옴 Composition Comprising Orlistat and Akkermansia muciniphila EB-AMDK19
CN113862193A (en) * 2021-10-28 2021-12-31 江西普瑞森基因科技有限公司 Ackermanella muciniphila and application thereof in preparation of antitumor drugs
CN114250179A (en) * 2021-12-22 2022-03-29 苏州普瑞森生物科技有限公司 Microbial composition with weight-losing effect and application thereof

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
Akkermansia Muciniphila Protects Against Atherosclerosis by Preventing Metabolic Endotoxemia-Induced Inflammation in Apoe−/− Mice;jin li 等;circulation;第133卷(第24期);第2434-2446页 *

Also Published As

Publication number Publication date
CN114949002A (en) 2022-08-30

Similar Documents

Publication Publication Date Title
CN110122877B (en) Lactobacillus rhamnosus and application thereof
US7785581B2 (en) Composition and method for reducing feces toxins and treating digestive disorders
CN108641988B (en) Lactobacillus plantarum NA136 and application thereof in relieving non-alcoholic fatty liver disease
CN114949003B (en) Acremonium muciniphilum, application and culture method thereof
CN108567799A (en) A kind of full caprophyl complex capsule and its preparation method and application
CN114832019A (en) Application of akkermansia muciniphila in preparation of pharmaceutical composition for preventing and treating obesity, composition and application thereof
CN112535700B (en) Weight-losing powder based on lactobacillus and preparation method thereof
CN112760247A (en) Lactobacillus rhamnosus for preventing and/or treating diseases caused by genital tract flora disorder and/or bone loss
CN114854638B (en) Lactobacillus paracasei capable of efficiently expressing adenosine deaminase mRNA to relieve colonitis
CN115381859A (en) Application of akkermansia muciniphila in preparation of pharmaceutical composition for preventing and treating diabetes, composition and application thereof
CN110693916B (en) Application of blautia in preparation of product for enhancing efficacy of hypolipidemic drug for treating hyperlipidemia
CN114657084B (en) Bifidobacterium longum for relieving ulcerative colitis and application thereof
CN113797232B (en) Composition with insulin resistance relieving function and application thereof
CN114949002B (en) Application of akkermansia muciniphila in preparation of composition for preventing and treating atherosclerosis
CN116115647A (en) Application of akkermansia muciniphila in preparation of pharmaceutical composition or health-care product composition for improving metabolic syndrome
CN112889967A (en) Preparation method of Pu-Er ripe tea extract and application of Pu-Er ripe tea extract in intestinal drug health-care products
CN115252651A (en) Application of akkermansia muciniphila in preparation of composition for preventing and treating hypertension and composition containing akkermansia muciniphila
CN114933992B (en) Application of bifidobacterium longum and composite preparation thereof in relieving ulcerative colitis
CN111714524A (en) Application of lactobacillus murinus in preparation of composition for preventing and treating intestinal ischemia reperfusion injury
CN116121154A (en) Leuconostoc lactis and application thereof
CN116445360A (en) Lactobacillus rhamnosus with effect of relieving chronic alcoholic liver injury and application thereof
CN114949004B (en) Application of akkermansia muciniphila in preparation of composition for preventing and treating hyperlipidemia and composition containing akkermansia muciniphila
CN114949004A (en) Application of akkermansia muciniphila in preparation of composition for preventing and treating hyperlipidemia and composition containing akkermansia muciniphila
CN114921378B (en) Enterococcus faecium and application of composite preparation thereof in relieving ulcerative colitis
CN116076569A (en) Use of MN-Gup for the preparation of a dairy product for preventing or alleviating obesity or weight gain

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
CB03 Change of inventor or designer information
CB03 Change of inventor or designer information

Inventor after: Chang Xiujuan

Inventor after: Li Yongxia

Inventor after: Wang Ye

Inventor after: Li Ping

Inventor after: Chang Lei

Inventor before: Chang Xiujuan

Inventor before: Li Yongxia

Inventor before: Zhou Qiuyun

Inventor before: Wang Ye

Inventor before: Li Ping

Inventor before: Chang Lei

GR01 Patent grant
GR01 Patent grant