CN114921346A

CN114921346A - Heterosporangium allochrum APS-1 and application thereof

Info

Publication number: CN114921346A
Application number: CN202210550927.7A
Authority: CN
Inventors: 张霞; 李莹; 宋新颖; 何康; 许曼琳; 郭志青; 于静; 迟玉成
Original assignee: Shandong Peanut Research Institute
Current assignee: Shandong Peanut Research Institute
Priority date: 2022-05-18
Filing date: 2022-05-18
Publication date: 2022-08-19
Anticipated expiration: 2042-05-18
Also published as: CN114921346B

Abstract

The invention belongs to the technical field of microorganisms, and relates to a heteroclite rhizosporangium APS-1 and application thereof, wherein the preservation number of the strain is CGMCC No. 40116. The strain APS-1 is applied to promoting peanut growth and preventing and controlling peanut pathogenic fungi, and by inoculating heterorhizospora heteroclita APS-1 in the growth process of peanuts, the growth of the peanuts is promoted, and meanwhile, the resistance of the peanuts to the pathogenic fungi such as southern blight and the like is improved. The method for promoting the growth of the peanuts and preventing and controlling the peanut pathogenic fungi by applying the heteroclita encephala APS-1 belongs to the field of biological prevention and control, is safe, quick and effective, and is beneficial to the healthy and green production of the peanuts and the comprehensive prevention and control of the peanut diseases.

Description

Heterosporangium allochrum APS-1 and application thereof

Technical Field

The invention belongs to the technical field of microorganisms, relates to symbiotic mycorrhizal endomycorrhizal cyst mold, and particularly relates to separation and identification of heteromycorrhizal endomycorrhizal cyst mold APS-1 with growth promoting effects on various peanut varieties and application of the heteromycorrhizal endomycorrhizal cyst mold APS-1 in growth promotion of peanuts and prevention and control of peanut pathogenic fungi.

Background

Peanuts are used as important economic crops and oil crops in China, the planting area is continuously increased, the economic benefit is good, but the disease seriously affects the healthy production of the peanuts and causes serious economic loss, wherein southern blight caused by sclerotinia rolfsii (Sclerotium rolfsii) is used as one of the most serious soil-borne diseases, and the yield loss of the peanuts is more than 50%. At present, the southern blight is controlled by chemical bactericides and agricultural measures such as crop rotation with non-hosts or covering infected crops by deep ploughing, but the bactericides can cause the problems of pesticide residues, enhanced resistance of pathogenic bacteria, environmental pollution and the like, and the agricultural measures can only prevent the diseases, so that a method which can effectively control the southern blight and is environment-friendly needs to be found.

Biological control is a safe and environment-friendly substitute for crops, wherein Arbuscular Mycorrhizal Fungi (AMF) are a microbial resource with great application potential in the aspects of biologically controlling plant diseases and improving plant resistance/disease tolerance. AMF is a common colonizer in soil, can be symbiotic with more than 90% of terrestrial plants, and is a microbial resource with great application potential in the aspects of biologically preventing and treating soil-borne diseases and improving the disease resistance/tolerance of plants. According to the invention, the prevention and treatment effect of the arbuscular mycorrhizal fungi on the southern blight of the peanuts is researched by establishing a symbiotic system of the arbuscular mycorrhizal fungi and the peanuts and by means of a mutualistic symbiotic relationship.

Disclosure of Invention

The invention aims to solve the problems in the prior art and provides a heteroclita squarrosum APS-1 strain and application thereof, wherein heteroclita squarrosum is inoculated on peanuts, and the growth of the peanuts is promoted and the resistance of the peanuts to southern blight is improved by establishing a symbiotic system of the heteroclita squarrosum APS-1 strain and the peanuts and by means of a mutualistic symbiotic relationship.

The technical scheme of the invention is as follows:

a strain of Rhizopus niveus (Rhizopus irregularis) APS-1 is preserved in China general microbiological culture Collection center of China Committee for culture Collection of microorganisms with the preservation number of CGMCC No. 40116.

The invention also protects the application of the Heterospora heteroclita APS-1 in preventing and treating peanut pathogenic fungi.

Further, the peanut pathogenic fungi comprise peanut southern blight.

Further, the application form is spore suspension of the strain APS-1.

The invention also protects the application of the Heterospora heteroclita APS-1 in promoting the growth of peanuts.

Further, the application form is spore suspension of the strain APS-1.

The invention also protects a microbial inoculum for preventing and treating peanut southern blight, the active component of which is the heterorhizopus APS-1.

Biological material sample preservation information:

the strain APS-1 is Rhizopus heterosporum (Rhizopus irregularis) and is preserved in China general microbiological culture Collection center (CGMCC), and the preservation address is as follows: west road No. 1, north west of the morning area, beijing, institute of microbiology, china academy of sciences, date of deposit: 22/03/2022 with the preservation number of CGMCC No. 40116.

The invention has the beneficial effects that:

according to the method, the heteroclite root cyst mold APS-1 is inoculated in the growth process of the peanuts, on one hand, the heteroclite root cyst mold APS-1 can establish a good symbiotic relationship with the peanuts, promote the absorption of the peanuts on mineral elements, promote the growth of the peanuts and improve the resistance of the peanuts to biological stress and abiotic stress; on the other hand, the heterospora heteroclita APS-1 can improve the resistance of peanuts to pathogenic fungi such as southern blight and the like.

The method for promoting the growth of the peanuts and preventing and controlling the peanut pathogenic fungi by applying the Heterosporangium APS-1 belongs to the field of biological prevention and control, is safe, quick and effective, is beneficial to the healthy and green production of the peanuts, and provides technical support for the comprehensive prevention and control of the peanut diseases.

Drawings

FIG. 1 is a schematic representation of co-cultivation of strain APS-1 with peanut hairy roots;

FIG. 2 is a morphological feature of strain APS-1;

FIG. 3 is a phylogenetic tree constructed from strain APS-1 based on the SSU-ITS-LSU fragment;

FIG. 4 is a schematic view of microscopic examination of the root characteristics of peanuts without and with inoculated strain APS-1;

FIG. 5 is the effect of strain APS-1 on the growth of the peanut;

FIG. 6 is a schematic diagram showing the calculation results of the mycorrhiza dependence of peanuts;

FIG. 7 shows the effect of strain APS-1 on the development of southern blight;

FIG. 8 shows the control effect of the strain APS-1 on southern blight.

Detailed Description

For further understanding of the present invention, the technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. All other embodiments, which can be obtained by a person skilled in the art without making any creative effort based on the embodiments in the present invention, belong to the protection scope of the present invention.

Materials, reagents and the like used in the following examples are commercially available unless otherwise specified; unless otherwise specified, the experimental procedures used in the following examples are all conventional procedures.

Example 1

Separation, rapid propagation and identification of heterogloea heterosporum APS-1

1. Separation of arbuscular mycorrhizal fungi:

collecting peanut rhizosphere soil in Lexi city, taking soil 5-20 cm away from the ground surface, placing the soil in a shade place for natural air drying, and then separating arbuscular mycorrhizal fungal spores in the soil by a wet sieve decantation method. The spores were initially classified by means of microscopy, with the dominant bacterium being designated APS-1. The bacterial strain APS-1 spores are spherical, nearly spherical or irregular in shape, brown, 70-153 μm in long axis and contain oily substances.

2. Rapidly propagating peanut hairy roots APS-1:

culturing peanut variety flower-cultured No. 45 cotyledon under aseptic condition, infecting peanut cotyledon with Agrobacterium rhizogenes A4, inducing transgenic peanut hairy root to generate, screening, and propagating to obtain great amount of hairy root. And (3) sterilizing the surface of the spore of the APS-1 obtained by separation, placing the spore and the peanut hairy root on an MSR culture medium, and carrying out dark culture at 25 ℃. When hyphae and spores appear on the culture medium, subculturing the peanut roots to obtain APS-1-containing peanut hairy roots, as shown in figure 1, and then culturing the mycorrhiza by using a double aseptic culture method so as to obtain a large amount of spores and hyphae of APS-1, wherein the shapes of the spores and the hyphae are shown in figure 2.

3. And (3) identification of strains:

spores and hyphae of arbuscular mycorrhizal fungi APS-1 are collected, genomes are extracted, and the SSU-ITS-LSU fragment is subjected to PCR amplification by respectively using 18S rDNA universal primer SSU-Glom1(5 'ATTACGTCCCTGCCCTTTGTACA 3') (SEQ ID NO: 1) and 28S rDNA universal primer NDL22(5 'TGGTCCGTGTTTCAAGACG 3') (SEQ ID NO: 2). The PCR product is sent to Beijing Ongchou Biotechnology Co., Ltd for sequencing. The full length of the 28S rDNA sequence is 1377bp, and the sequence is shown as SEQ ID NO: 3, respectively.

The sequences obtained were aligned by BLAST analysis and the SSU-ITS-LSU fragment was used to construct a phylogenetic tree using MEGA7 software, as shown in FIG. 3. The results show that the strain APS-1 and the arbuscular mycorrhizal fungus Rhizopus irregularis MUCL43205 are on the same branch, which indicates that the strain APS-1 is the Rhizopus heterosporum. The strain APS-1 is preserved in the common microorganism center of China Committee for culture Collection of microorganisms, and the preservation number is CGMCC No. 40116.

Example 2

Effect of Strain APS-1 spore suspension on peanut growth

Collecting spore and hypha of APS-1 strain, and making into spore suspension. The pots were filled with moist field soil and inoculated with a spore suspension of about 900 strains of APS-1 at 2/3 of the pot height, after which the pots were filled with soil to inoculate an equal volume of water as a control.

Peanut varieties Luhua No. 8 (LH8), Zhonghua No. 24 (ZH24), white sand 1016(BS1016), Yuhua 9620(YH9620), Huayu No. 917(HY917) and Huayu No. 33 (HY33) are sown in flowerpots, 4 seeds are sown in each flowerpot, and 3 peanuts are left after emergence of seedlings. Control and treat 6 pots each, repeat 3 times, all peanuts placed in a vinyl house, watered periodically. And taking 3 pots after 4 weeks, collecting the root system, carrying out trypan blue staining, and observing the infection condition of the root system through a microscope. After the peanuts are cultured for 8 weeks, the total fresh weight of the plants is weighed, and the total dry weight of the plants is weighed after drying. Mycorrhizal dependence is calculated as follows: mycorrhiza dependence (%) (inoculation treated dry weight-non-inoculation treated dry weight)/inoculation treated dry weight × 100. The microscopic examination result of the peanut root system is shown in fig. 4, wherein fig. 4A shows the characteristics of the peanut root system which is not inoculated, and fig. 4B and fig. 4C show the characteristics of the peanut root system of the inoculation strain APS-1; microscopic examination of peanut root systems shows that 6 peanuts can be symbiotic with a bacterial strain APS-1.

As shown in fig. 5 (where ×. indicates that the difference is very significant at p <0.01 level), it was statistically found that strain APS-1 was able to very significantly increase the main stem length, lateral shoot length, total fresh weight and total dry mass of 6 peanut varieties compared to the control.

As can be seen from fig. 5, the main stems of lu flower No. 8, zhong flower No. 24, baisha 1016, yuhua 9620, huayu 917 and huayu No. 33 were increased in length by 12.00%, 21.80%, 22.20%, 23.60%, 30.57% and 23.37% respectively as compared with the control; the lateral branches are long, and the treatment is respectively increased by 12.30%, 22.71%, 11.25%, 14.31%, 16.00% and 19.38% compared with the control; the total fresh mass is respectively increased by 17.11 percent, 13.42 percent, 13.27 percent, 21.63 percent, 16.91 percent and 16.69 percent compared with the control; total dry mass, treatment increased 34.59%, 47.90%, 12.30%, 34.79%, 26.95%, and 11.24% respectively over the control.

Mycorrhizal dependencies of luhua No. 8, Zhonghua No. 24, Baisha 1016, Yuhua No. 9620, Huayu No. 917 and Huayu No. 33 are shown in FIG. 6 as 25.70%, 32.29%, 10.95%, 25.20%, 20.89% and 10.08%, respectively.

Example 3

Effect of the spore suspension of Strain APS-1 on resistance to southern blight

The pots were filled with moist field soil and inoculated with a spore suspension of about 900 strains of APS-1 at 2/3 of the pot height, after which the pots were filled with soil to inoculate an equal volume of water as a control.

The peanut varieties Luhua No. 8, Zhonghua No. 24, Baisha 1016, Yuhua 9620, Huayu 917 and Huayu 33 are sown in flowerpots, 4 seeds are sown in each pot, and 3 peanuts are left after emergence. Control and treat 4 pots each, repeat 3 times, all peanuts placed in a vinyl house, watered periodically. After 6 weeks, inoculating oat grains full of sclerotium rolfsii at the base of peanut stem, investigating sclerotium rolfsii occurrence after 2 weeks, and calculating the prevention and treatment effect. Grading survey standard of southern blight: stage 1: lesions were found only on the stem, grade 2: full plant 1/4 wilting and death, grade 3: full plant 1/4-1/2 wilting and death, grade 4: wilting and death over the whole plant 1/2. Disease index ∑ (each grade value × each grade number of disease plants)/(highest grade × total number of investigated plants) × 100, incidence rate [ (% ]) number of diseased plants/total number of investigated plants × 100%, and control effect [ (] control disease index-treatment disease index)/control disease index × 100%).

Statistically, as shown in fig. 7 and 8, the strain APS-1 was able to significantly increase the resistance of 6 peanut varieties to southern blight compared to the control. Among them, the disease indexes of southern blight of luhua No. 8, zhonghua No. 24, baisha 1016, yuhua 9620, huayu 917 and huayu 33 were decreased by 63.21%, 31.65%, 61.64%, 85.35%, 74.61% and 43.76%, respectively, as compared with the control (fig. 7, wherein a indicates that the difference was very significant at a p <0.01 level); the incidence of southern blight was reduced by 63.04%, 30.12%, 58.82%, 78.19%, 54.89% and 53.34% respectively for treatment compared to control (fig. 7); the control effect is respectively 89.14%, 48.81%, 65.50%, 55.23%, 58.24% and 43.76% (figure 8).

Although the present invention has been described in detail with reference to the foregoing embodiments, it will be apparent to those skilled in the art that modifications may be made to the embodiments described above, or equivalents may be substituted for elements thereof. Any modification, equivalent replacement, or modification made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

Sequence listing

<110> institute for peanut research in Shandong province

<120> Rhizoctonia heteroclita APS-1 and application thereof

<160> 3

<170> SIPOSequenceListing 1.0

<210> 1

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

attacgtccc tgccctttgt aca 23

<210> 2

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

tggtccgtgt ttcaagacg 19

<210> 3

<211> 1377

<212> DNA

<213> Rhizopus heterosporum (Rhizophagus irregularis)

<400> 3

atggcttagt gaggccttcg gattgaaatt cggagactgg caacagactc ttggttttga 60

aaagttggac aaacttggtc atttagagga agtaaaagtc gtaacaaggt ttccgtaggt 120

gaacctgcgg aaggatcatt accgattttt agcggacctg atctttgatc atggtctcgc 180

gaaaacttgt atttaaaacc ccactcttat aaattgaatc attttatatt atgtatgtaa 240

taaataaaga tctctttcaa caacggatct cttgcctctc gcatcgatga acaacgtaac 300

gaagtgcgat aagtaatgtg aattgcataa ttccgtgaat catcgaatct ttgaacgcaa 360

attgcactct ctggtaaccc ggggagtatg cctgtttgag ggtcagtgtt aataaaaatc 420

ggtgcttggc aatttttgtg atgttccgga gtttgagata tcttatcttc tgggtttaag 480

aggcttaata ttgaccttct ttgtgcattt tagacgtaca taaatttttt ttattcgttt 540

atcttaatgc caaaatcaat tatatgcgac catatcgtgt ggtgccgtgc ctataaattt 600

ttcatgattt gacctcaaat caggtaggaa cacccgctga acttaagcat atcaataagc 660

ggaggaaaag aaaataacaa tgattcccct agtaactgcg agtgaagagg gacaagctca 720

aattttaaat ctatcgggtt ttacctgatc gagttgtaat ttgaagaagc gttttctgcg 780

tatttggtca gcctaagtcc tattgaatga ggcatcatgg agggtgataa tcccgtccgg 840

ttgatcattt gcgttttacg atacgctttc taagagtcaa gttgtttggg attgcagctt 900

aaaatgggag gtaaatttct cctaaggcta aataacggcg agagaccgat agcgaacaag 960

taccgtgagg gaaagatgaa aagaactttg aaaagagagt taaacagtac gtgaaattgt 1020

tgaaagggaa acgattgaag ccagtcgtac cttcgggtaa tcagcctttc gggtgcgatt 1080

ctgtggagtg tgaggagctt aaacaccttc atgttttgca tattcgtact cttgggtgta 1140

cttgcccgtg tggttggtta acatcaattt tggtggtcat aaaatggctg ggggaatgta 1200

gcttcgatct tgtattgaag tgttatagcc ttcggtagat gtgatgatcg agattgagga 1260

ttgcaacgga tacccttcgg ggctacctgt ctggtctctg atcgttgctc tggtgccgaa 1320

agcttgctta cggttatcaa agtcgatggt caataggtta gaacgggtta aattcgt 1377

Claims

1. Rhizopus niveus (Rhizopus irregularis) APS-1, which is characterized in that it is preserved in China general microbiological culture Collection center (CGMCC) with the preservation number of CGMCC No. 40116.

2. Use of the rhizospora heteroclita APS-1 of claim 1 for controlling peanut pathogenic fungi.

3. Use according to claim 2, wherein the peanut pathogenic fungus comprises peanut southern blight.

4. Use according to claim 2, in the form of a spore suspension of strain APS-1.

5. Use of the rhizospora heterothecoides APS-1 of claim 1 to promote peanut growth.

6. Use according to claim 5, in the form of a spore suspension of strain APS-1.

7. A fungicide for controlling peanut southern blight, which comprises the ascospora heteroclita APS-1 of claim 1 as an active ingredient.