CN114891792A - Promoter capable of responding to plant drought induction and application thereof - Google Patents

Abstract

The invention discloses a promoter capable of responding to plant drought induction and application thereof, and relates to the technical field of genetic engineering, wherein the promoter is a nucleotide sequence shown as SEQ ID NO.1 or a truncated sequence thereof. By luciferaseLUCTransient transformation activity analysis shows that the promoter can respond to drought stress to regulate downstream gene expression, the luciferase activity expressed in the-650 bp segment is strongest, and the luciferase activity is obviously weakened when reaching the-200 bp segment, which indicates thatThe core regulatory region of the promoter is located in a region from-650 bp to-200 bp. According to bioinformatics analysis, the promoter comprises 2 MYB and 2 MBS elements.

Description

Promoter capable of responding to plant drought induction and application thereof

Technical Field

The invention relates to the technical field of genetic engineering, in particular to a promoter capable of responding to plant drought induction and application thereof.

Background

Corn is an important cereal crop, a major source of food, feed and fuel, with great yield potential and nutritional value. Although the yield of modern corn is remarkably increased, the production of the corn at each stage of plant growth is easily affected by adverse factors such as drought stress, heat stress and salt damage, and the yield and the quality are reduced. Drought stress can cause a series of physiological and biochemical reactions in plants to change, such as limiting photosynthesis, enhancing stomatal closure, changing cellular components, stimulating osmotic factor production, and accumulating active oxygen.

Plants respond to abiotic stress in several respects, including hormones, osmolytes, reactive oxygen scavenging systems and proteins. Among them, Transcription Factor (TF) plays an important role in abiotic stress, when a plant is subjected to external abiotic stress, a series of signal transduction processes occur in vivo, and finally the expression of plant-related resistance genes can be induced, and the transcription factor plays a role of molecular switch in the process. Recent studies have shown that the transcription factors involved in plant stress response are mainly of several types: NAC type, AP2/EREBP type, bZip/HD-Zip type, MYB/MYC type, and WRKY type.

Research shows that the abiotic stress resistance of plants can be obviously changed by regulating the expression of the abiotic stress response transcription factor. For example, WRKY is one of the largest transcription factor families, the action of the plant in responding to abiotic stress is widely researched in various plants, the Arabidopsis AtWRKY57 transgenic rice positively regulates the drought resistance by regulating the water loss rate, the malondialdehyde content and the like, and the expression of some stress response genes in the transgenic plant is up-regulated; the ZmbZIP4 gene of corn can be induced and expressed by high salt, drought, high temperature, abscisic acid treatment and the like, and ZmbZIP4 regulates the tolerance of plants to abiotic stress by regulating the expression of ZmLEA2, ZmRD20, NCED, ABA1 and other genes. The expression transcription regulation of the gene is one of the main mechanisms of the plant responding to abiotic stress, and is closely related to various transcription factors and the interaction between the transcription factors and cis-regulatory sequences, and the activation/inhibition of the promoter under the stress condition plays an important role in determining the transcription rate, regulating the gene expression and the like.

Based on the above, a promoter capable of responding to plant drought induction and application thereof are provided.

Disclosure of Invention

The invention aims to provide a promoter capable of responding to plant drought induction.

The invention realizes the purpose through the following technical scheme:

the invention provides a promoter capable of responding to plant drought induction, which is a nucleotide sequence shown as SEQ ID NO.1 or a truncated sequence thereof.

The further improvement is that the promoter is a downstream sequence obtained by truncating a nucleotide sequence shown as SEQ ID NO.1 at-650 bp or upstream thereof.

The further improvement is that the nucleotide sequence of the promoter is shown as any one of SEQ ID 2-5.

The further improvement is that the nucleotide sequence of the promoter is shown as SEQ ID NO.5, and the sequence has a total length of 650 bp.

The invention also provides application of the promoter in response to plant drought induction regulation and control of downstream gene expression.

In a further improvement, the plant is tobacco or corn.

The invention also provides a method for obtaining the promoter, which comprises the steps of taking the corn B73 genome as a template, and carrying out PCR amplification by using a specific amplification primer to obtain the promoter capable of responding to plant drought induction, wherein the specific amplification primer comprises an upstream primer and a downstream primer;

the upstream primer is selected from any one of the following sequences:

P2000-F: GACTCTTGGTTGGGATGTAAAAT, amplifying the promoter sequence shown in SEQ ID NO. 1;

P1800-F: TAGGTGGACGATGAGCTGGAC, amplifying a promoter sequence shown in SEQ ID NO. 2;

P1500-F: CAAGAAGAAACATGGATTCATGTT, amplifying a promoter sequence shown in SEQ ID NO. 3;

P1200-F: AAACACACATGTGGTGTAGTGGTA, amplifying a promoter sequence shown in SEQ ID NO. 4;

P650-F: TTGCTTTGGTTAGAGGAA, amplifying the promoter sequence shown in SEQ ID NO. 5;

P200-F: AAAGTGACAAATACTCTGGCTCC, amplifying the promoter sequence shown in SEQ ID NO. 6;

the downstream primer is as follows:

P2000-R：GGTGGCTGCAGGCTTTCC。

the invention has the following beneficial effects:

the promoter capable of responding to plant drought induction shows that the promoter can respond to drought stress to regulate and control downstream gene expression through luciferase LUC transient transformation activity analysis. The luciferase activity expressed by the-650 bp segment is found to be strongest, and the luciferase activity is obviously weakened when reaching the-200 bp segment, thereby identifying that the core regulatory region of the promoter is positioned in the region from-650 bp to-200 bp, wherein the core regulatory region comprises 2 MYB and 2 MBS elements.

Drawings

FIG. 1 is an electrophoretogram of promoter amplification in the present invention (M: DL 5000 Marker; 1: promoter);

FIG. 2 is a bioinformatic analysis of the promoter of the present invention;

FIG. 3 is a diagram showing the analysis of promoter drought-induced activity in the present invention (A: luminescent images before and after pGreenII 0800-2000pro-LUC drought treatment; B: luminescent images before and after pGreenII 0800-CaMV35S-LUC drought treatment; C: LUC/REN ratio before and after pGreenII 0800-2000pro-LUC and pGreenII 0800-CaMV35S-LUC treatment);

FIG. 4 is a schematic diagram of the construction of a promoter 5' deletion vector according to the present invention;

FIG. 5 shows the restriction enzyme digestion verification of the promoter 5' deletion vector of the present invention (M: DL 5000 Marker; 1-6: pGreenII 0800-200-LUC, pGreenII 0800-650-LUC, pGreenII 0800-1200-LUC, pGreenII 0800-1500-LUC, pGreenII 0800-1800-LUC, pGreenII 0800-2000-LUC);

FIG. 6 shows the dual luciferase activity analysis of different deletion fragments of the promoter (A: pGreenII 0800-LUC luminescence image at the upper left, pGreenII 0800-CaMV35S-LUC luminescence image at the lower left, luminescence image of experimental group at the right, and luciferase activity analysis at B).

Detailed Description

The present application will now be described in further detail with reference to the drawings, it should be noted that the following detailed description is given for illustrative purposes only and is not to be construed as limiting the scope of the present application, as those skilled in the art will be able to make numerous insubstantial modifications and adaptations to the present application based on the above disclosure.

1. Material

All reagents used in the experiment are conventional reagents unless specified otherwise, are prepared by using deionized water, and instruments used are conventional laboratory instruments.

2. Method of producing a composite material

2.1 analysis of promoter drought-induced Activity

2.1.1 cloning and sequence analysis of the promoter

Specific primers were designed using the maize B73 genome as a template to amplify the promoter fragment using Primer Premier5.0 software. Specific primers are as follows:

TABLE 1 primer sequences (1)

The promoter was amplified using high fidelity enzymes as follows:

TABLE 2 PCR reaction System

After the PCR reaction, the product was subjected to agarose gel electrophoresis to detect a target band of about 2000bp, the gel block was excised as shown in FIG. 1, the target band gel was recovered (gel recovery procedure is described in AxyPrep gel recovery Specification), and the purified gel recovery product was ligated to a Blunt simple vector as follows:

TABLE 3 connection system (1)

Ligation was performed overnight at 4 ℃. The ligation products were transformed into Trans1-T1 competent cells, after the culture medium developed plaque, the cells were shaken by picking, and individual clones were picked into liquid LB medium containing 50. mu.g/mL Kan, and shaken at 37 ℃ for 220 r/min. After the bacterial liquid is cultured for 10-12h, one part of the bacterial liquid is preserved in an ultra-clean workbench, one part of the bacterial liquid is sent to a company for sequencing, and the rest extracted plasmid is preserved (the step of the extracted plasmid refers to the specification of AxyPrep company).

Based on the sequencing results of the promoter, it was aligned with the promoter sequence (SEQ ID NO.1) obtained from the MaizeGDB website (https:// www.maizegdb.org /), and then the full-length sequence of the promoter was aligned using PlantCARE (R) ((SEQ ID NO. 1))http://bioinformatics.psb.ugent.be/webtools/plantcare/ html/)The tool analyzes the cis-acting elements contained in the promoter and the distribution thereof. The results showed that some cis-acting elements associated with abiotic stress were included in the promoter sequence, as shown in fig. 2, including 3 ABRE elements associated with abscisic acid response, 2 DRE core elements associated with drought response, 1 DER1 element associated with drought response, 1 LTR element associated with low temperature response, and 4 MYB and 2 MBS binding sites involved in drought response, as shown in table 4.

TABLE 4 cis-acting elements contained in the promoter

2.1.2 promoter transient expression vector construction

In order to identify the ability of the promoter to regulate downstream genes, a full-length promoter transient expression vector was constructed. pGreenII 0800-LUC vector is used as a vector required by experiments, a plasmid successfully cloned and connected to a Blunt sample vector is used as a template, a primer is redesigned according to a transient expression vector pGreenII 0800-LUC sequence, BamHI (GGATCC) is selected as an enzyme cutting site according to a promoter sequence, and meanwhile, a positive control expression vector pGreenII 0800-CaMV35S-LUC is constructed, and the design primer is as follows:

TABLE 5 primer sequences (2)

The vector pGreenII 0800-LUC is linearized by adopting a single enzyme digestion mode, and the enzyme digestion system is as follows:

TABLE 5 enzyme digestion System (1)

And (3) after sample addition, placing the sample in a metal bath at 37 ℃ for 3h, taking no load as a control, checking the enzyme digestion result through electrophoresis, recovering the target band, purifying and storing for later use. Connecting the PCR gel recovery product with pGreenII 0800-LUC plasmid digested gel recovery product according to a homologous recombination mode, wherein the system is as follows:

TABLE 7 connection system (2)

Adding sample, mixing, and connecting at 25 deg.C for 15 min. And after the reaction is finished, placing the mixture on ice for cooling for a plurality of seconds, then using the recombinant product for transformation, transforming the recombinant product into Trans1-T1 competent cells, transforming, coating plates, picking up spots and shaking bacteria, extracting plasmids, and carrying out single enzyme digestion on the plasmids to check whether the vectors are successfully constructed. Sequence alignment was performed by sequencing and using MEGA 6. The sequencing result shows that the sequencing sequence is completely consistent with the database sequence, and the sequencing result and the enzyme digestion result both prove that the promoter vector pGreenII 0800-2000pro-LUC is successfully constructed. pGreenII 0800-CaMV35S-LUC vector was constructed in the same manner.

2.1.3 promoter drought Induction Activity analysis

(I) recombinant plasmid transformed Agrobacterium

GV3101 Agrobacterium competence with pSoup and p19 was selected and transformed as follows:

(1) taking out the agrobacterium-infected strain from a refrigerator at minus 80 ℃, melting with ease, and inserting into ice when the strain is in a semi-molten state;

(2) after the competence is completely melted, adding pGreenII 0800-2000pro-LUC vector and pGreenII 0800-CaMV35S-LUC vector into the competence, slightly flicking the centrifuge tube, uniformly mixing the vectors, and inserting the centrifuge tube into ice for 5 min;

(3) quickly freezing in liquid nitrogen for 5 min;

(4) after the quick freezing is finished, putting the mixture into a 42 ℃ water bath pot for hot shock for 5 min;

(5) cooling in ice after hot shock;

(6) adding 500 mu L of fresh YEP liquid into a centrifugal tube filled with the competence mixture in a clean bench;

(7) placing the centrifuge tube in a shaker at 28 deg.C, and shaking for 2-3 hr;

(8) after the shaking is finished, sucking 80 mu L of bacterial liquid, uniformly spreading the bacterial liquid on a double antibody (50 mu g/mL Kana and 50 mu g/mL Rif) YEP solid culture medium, and carrying out inverted culture in an incubator at 28 ℃ for 36-48 h;

(9) selecting and shaking bacteria, and selecting bacterial plaque into a liquid culture medium containing kanamycin and rifampicin to shake greatly;

(10) and (4) preserving bacteria after shaking and mixing the bacteria liquid, carrying out PCR verification on the bacteria liquid, and preserving the bacteria liquid capable of amplifying the target strip for later use.

(II) infection of tobacco

Culturing the verified agrobacterium at 28 ℃ overnight until bacterial liquid OD ₆₀₀ When the value reaches 1.5, the mixture is centrifuged at 6000r/min for 5min to collect the bacteria, the supernatant is discarded after the bacteria collection, and tobacco staining solution (0.5mol/L MES and 1mol/L MgCl) is used ₂ 0.1mol/L Acetosyringone (AS)), OD of each bacterial solution ₆₀₀ The value was adjusted to 1.0. The mixture was left in the dark for 2 hours. Tobacco leaves 6 weeks old were selected for injection, 3 tobacco per inoculum for 3 biological replicates. After aspirating the invaded liquid with a 2mL syringe, the needle was pulled off and the whole was removedInjecting the infection liquid into the leaves lightly on the back of the tobacco, symmetrically injecting two positions into each leaf, ensuring that the infection range is not too large, and placing the injected tobacco in the dark for 36-48h for subsequent activity analysis. In order to investigate whether the promoter regulates the expression of downstream genes in response to drought stress, a 20% PEG solution was poured into 6 weeks old tobacco as a drought treatment the day before injection.

(III) luciferase Activity assay

(1) Qualitative analysis

Taking out the dark-treated tobacco leaves, spraying a substrate of luciferase on the injection position at the back of the leaves, placing the leaves in the dark for ten minutes, and then placing the leaves in a plant living body imager to detect the luminescence condition, wherein the intensity of the luminescence represents the starting capability of the promoter. Each experimental group was replicated 3 times with 3 different leaves as 3 organisms.

(2) Quantitative analysis

Quantitative analysis was performed according to the instructions of the Dual-Luciferase assay system kit, and three tobacco plants of the same size were collected from each experimental group, pulverized with liquid nitrogen, and filled in a 1.5mL centrifuge tube. Add 100. mu.L of 1 XPLB buffer, mix well with shaking, and let stand at room temperature for 25 min. Centrifuging to obtain 50 μ L of supernatant, adding 50 μ L of LARII reagent (lyophilized powder dissolved by Luciferase Assay Buffer II) into each sample, placing the 96-well plate in LB 942 multimode microplate reader to detect Luciferase content, taking out the 96-well plate, and adding 50 μ L of Stop into each well with reagent&Glo Reagent (1 volume Stop)&

Substrate (50X) with 50 times volume Stop&

Buffer mixing) to detect the content of renilla luciferase, and finally judging the activity of the promoter according to the ratio of the luciferase to the renilla luciferase.

Qualitative results show that the promoter can start the activity of downstream luciferase before drought treatment, and obviously activate the expression of downstream LUC genes after drought induction treatment. The CaMV35S promoter is used as a positive control, and can obviously start the expression of downstream luciferase before and after drought induction, but the activity change before and after the induction is not large. The quantitative analysis result is consistent with the qualitative result, and as shown in fig. 3, the promoter can respond to drought induction to regulate and control the expression of downstream genes.

2.2 identification of the core region of the promoter

2.2.1 construction of transient expression vectors for promoter 5' deleted fragments

In order to identify the core region of the promoter for the downstream gene regulation, transient expression vectors of different deletion lengths need to be constructed.

According to the analysis of the distribution of cis-acting elements of the full-length promoter by the online website of PlantCARE, different 5' fragment deletions are carried out on the full-length promoter, and 5 truncated fragments are obtained in total, as shown in FIG. 4. The sequence lengths are 1800bp (shown as SEQ ID NO. 2), 1500bp (shown as SEQ ID NO. 3), 1200bp (shown as SEQ ID NO. 4), 650bp (shown as SEQ ID NO. 5) and 200bp (shown as SEQ ID NO. 6), respectively designing upstream primers according to pGreenII 0800-LUC vector maps, and selecting BamHI as an enzyme cutting site, wherein the primers are as follows:

TABLE 6 primer sequences (3)

Respectively carrying out PCR amplification by taking plasmids carrying full-length promoters as templates, carrying out electrophoresis detection to obtain target bands, connecting PCR gel recovery products to the BamHI sites of the linearized pGreenII 0800-LUC vectors in a homologous recombination mode, respectively transforming and shaking the connection products to obtain plasmids which are respectively named as pGreenII 0800-LUC, pGreenII 0800-1500-LUC, pGreenII 0800-1200-LUC, pGreenII 0800-650-LUC and pGreenII 0800-200-LUC. The obtained plasmid was verified by digestion, and the band detected by electrophoresis was consistent with the expected result, as shown in FIG. 5. Meanwhile, the bacterial liquid of the recombinant plasmid is subjected to sequencing verification, and after the verification is successful, the bacterial liquid is stored for subsequent experiments.

2.2.2 identification of promoter core regulatory region

In order to identify the core regulatory region of the promoter, the activity of the promoter is judged according to the activity of luciferase by adopting a mode of transient transformation of tobacco. The constructed transient transformation vector of 5 truncated sequences and a full-length promoter, positive control pGreenII 0800-CaMV35S-LUC and pGreenII 0800-LUC no-load negative control are respectively transformed into an agrobacterium competent strain GV3101(pSoup-p19), the transformed agrobacterium competent strain GV is smeared on a YEP solid culture medium containing 50 mu g/mL Kana and 50 mu g/mL Rif, inverted culture is carried out for 36-48h at 28 ℃, and plaque selection and shaking are carried out to preserve bacteria for later use. And (3) detecting whether the agrobacterium is successfully transferred into the agrobacterium by using the agrobacterium liquid as a template in a colony PCR (polymerase chain reaction) mode. Successfully verified agrobacterium is cultured overnight at 28 ℃ until OD ₆₀₀ And (4) when the value reaches 1.5, centrifugally collecting the bacteria, infecting the tobacco in the same way, and after infection is finished, growing the tobacco in a dark environment for 36-48h for subsequent luciferase activity analysis.

The expression of the transient transformation reporter gene LUC is observed in a qualitative mode and a quantitative mode, a plant living body imaging system is used for collecting a luminescence image of a tobacco leaf, the luciferase activity expressed by a-650 bp segment is the strongest, the luciferase activity is obviously weakened when the luciferase activity reaches a-200 bp segment, the activities of other segments are weakened to different degrees, and the quantitative result is consistent with the qualitative result, as shown in figure 6. The result shows that the core regulatory fragment of the promoter is 450bp sequence located in the upstream-650 bp to-200 bp region of the gene ATG. The sequence structure analysis shows that the gene contains 2 MBS and 2 MYB cis-acting elements related to drought.

The above-mentioned embodiments only express several embodiments of the present invention, and the description thereof is more specific and detailed, but not construed as limiting the scope of the present invention. It should be noted that, for a person skilled in the art, several variations and modifications can be made without departing from the inventive concept, which falls within the scope of the present invention.

Sequence listing

<110> agriculture university of Anhui

<120> promoter capable of responding to plant drought induction and application thereof

<160> 6

<170> SIPOSequenceListing 1.0

<210> 1

<211> 2000

<212> DNA

<213> corn (Zea mays L)

<400> 1

gactcttggt tgggatgtaa aataaagtgc acctcgggct catcagcaag gtagtacccc 60

tagccgttgc accaccggat gcgctactcc tctacataca tcgtgttcga ggacactcat 120

acaacgtcag gaacggccat cgtctcagcg cacaagaatt tatggccagt cagtagcgac 180

ttacgtggca ggttgggctt taggtggacg atgagctgga cgacgtgtcg tcgtcgtcga 240

atgcggtgcc cagaacaacc cgagagtcgc cgacattggc gacgaccatg cggtccccct 300

gcttgacgat ggacagcgcg gagcggccgc tctgcaccgc gtaagcggcg gctgcgccgg 360

agcttgtcgt acatagcggc acatgcggcc acgtaggact gtttctagag gtcgaactgg 420

cagtcgctaa gtttcttctt atcgtcgatg agcgacccca acgcgagtgc ctcctgctaa 480

tggtatttgt tcggggtttt caagaagaaa catggattca tgtttggcgt tggtttatac 540

aaatgactca caagtcagat ccatggaaaa aatattatga agaataaatg tcacgcatgc 600

aaaaaagaaa tttaatttga aaacattatt caaacaaaag aaattgcatg caaggctctt 660

ctttaaatac tactccctcc atcaaaaata taattcaaga atctcggtga tacttatcta 720

ctactacgca ttgtacaagg gtagcaggtg ggcttgggga gagatatagt agatgtgttt 780

tctgttatag atatagaaat aaacacacat gtggtgtagt ggtagctact gctagcattt 840

gcttaagagg ttgtgggttt gaattccctt ggtgccatgt gaattttttt aattttagct 900

aggcgtcggc tgtacggggg gggggggaat atgaatggga atgggttttg cggggaggga 960

aaatgataat gatagataga atgatgacag aacatgtgaa tggactgtgc gcgaggagac 1020

tactattgca gccttaataa gtagtagaga tatcttggac taatttattt ggataagttt 1080

taaactcgat ttgaatcctc ttgaagcttc ttcacatatt ttgagtgatt atcttgttga 1140

tgttggattt attatttgtg catcccatca acacaattca aacacatggg tccgcgttct 1200

cgtgaattaa gccatatgag accactagaa gtaataaaac atataagcaa tatgaattca 1260

aactttttag ttttcaatga atgtcctaat tcatgtctat atgcactagc catatctggt 1320

aaggtatgaa aggcacaacc tattttacct ttgctttggt tagaggaaac actagtcata 1380

attgatgttt tttaactcgc gttcgaatca taaaaaatat ttacttcatt tcttagcatg 1440

taaaatattt ctttatctag tggcttggta aatatattga ccagttgatc ttggtcatct 1500

agactcgcaa cttcaatttt tggcacttga aaaataaaca attcaactgt atgtaaatga 1560

cctagggaaa agagatatgt ttttcgatac aaaagtataa gagataaaac agtactgtat 1620

aaaaatggtt gtaaaaatac tttagaattc ttgatacaaa attgtttatg tgcgatatat 1680

tgaaaataaa aacaaacaaa caaataggcc ttctactctt tttttcaact tgaaaatttt 1740

attaactagt tttgttttca gcgactattg tagatgctca tgctctacca gaaaccaaac 1800

aaagtgacaa atactctggc tccaaccacc gtcaggtttg cggtgcagga gaaataacac 1860

ctccctaaat agaaaacaac acaagtcacc atcgaataga aacgaaatat ttttaatccg 1920

cttttcggtt ggtggtgcct ggcatctacc gtgcggaggg ggaagaggga gaggccagga 1980

gaggaaagcc tgcagccacc 2066

<210> 2

<211> 1800

<212> DNA

<213> corn (Zea mays L)

<400> 2

taggtggacg atgagctgga cgacgtgtcg tcgtcgtcga atgcggtgcc cagaacaacc 60

cgagagtcgc cgacattggc gacgaccatg cggtccccct gcttgacgat ggacagcgcg 120

gagcggccgc tctgcaccgc gtaagcggcg gctgcgccgg agcttgtcgt acatagcggc 180

acatgcggcc acgtaggact gtttctagag gtcgaactgg cagtcgctaa gtttcttctt 240

atcgtcgatg agcgacccca acgcgagtgc ctcctgctaa tggtatttgt tcggggtttt 300

caagaagaaa catggattca tgtttggcgt tggtttatac aaatgactca caagtcagat 360

ccatggaaaa aatattatga agaataaatg tcacgcatgc aaaaaagaaa tttaatttga 420

aaacattatt caaacaaaag aaattgcatg caaggctctt ctttaaatac tactccctcc 480

atcaaaaata taattcaaga atctcggtga tacttatcta ctactacgca ttgtacaagg 540

gtagcaggtg ggcttgggga gagatatagt agatgtgttt tctgttatag atatagaaat 600

aaacacacat gtggtgtagt ggtagctact gctagcattt gcttaagagg ttgtgggttt 660

gaattccctt ggtgccatgt gaattttttt aattttagct aggcgtcggc tgtacggggg 720

gggggggaat atgaatggga atgggttttg cggggaggga aaatgataat gatagataga 780

atgatgacag aacatgtgaa tggactgtgc gcgaggagac tactattgca gccttaataa 840

gtagtagaga tatcttggac taatttattt ggataagttt taaactcgat ttgaatcctc 900

ttgaagcttc ttcacatatt ttgagtgatt atcttgttga tgttggattt attatttgtg 960

catcccatca acacaattca aacacatggg tccgcgttct cgtgaattaa gccatatgag 1020

accactagaa gtaataaaac atataagcaa tatgaattca aactttttag ttttcaatga 1080

atgtcctaat tcatgtctat atgcactagc catatctggt aaggtatgaa aggcacaacc 1140

tattttacct ttgctttggt tagaggaaac actagtcata attgatgttt tttaactcgc 1200

gttcgaatca taaaaaatat ttacttcatt tcttagcatg taaaatattt ctttatctag 1260

tggcttggta aatatattga ccagttgatc ttggtcatct agactcgcaa cttcaatttt 1320

tggcacttga aaaataaaca attcaactgt atgtaaatga cctagggaaa agagatatgt 1380

ttttcgatac aaaagtataa gagataaaac agtactgtat aaaaatggtt gtaaaaatac 1440

tttagaattc ttgatacaaa attgtttatg tgcgatatat tgaaaataaa aacaaacaaa 1500

caaataggcc ttctactctt tttttcaact tgaaaatttt attaactagt tttgttttca 1560

gcgactattg tagatgctca tgctctacca gaaaccaaac aaagtgacaa atactctggc 1620

tccaaccacc gtcaggtttg cggtgcagga gaaataacac ctccctaaat agaaaacaac 1680

acaagtcacc atcgaataga aacgaaatat ttttaatccg cttttcggtt ggtggtgcct 1740

ggcatctacc gtgcggaggg ggaagaggga gaggccagga gaggaaagcc tgcagccacc 1858

<210> 3

<211> 1500

<212> DNA

<213> corn (Zea mays L)

<400> 3

caagaagaaa catggattca tgtttggcgt tggtttatac aaatgactca caagtcagat 60

ccatggaaaa aatattatga agaataaatg tcacgcatgc aaaaaagaaa tttaatttga 120

aaacattatt caaacaaaag aaattgcatg caaggctctt ctttaaatac tactccctcc 180

atcaaaaata taattcaaga atctcggtga tacttatcta ctactacgca ttgtacaagg 240

gtagcaggtg ggcttgggga gagatatagt agatgtgttt tctgttatag atatagaaat 300

aaacacacat gtggtgtagt ggtagctact gctagcattt gcttaagagg ttgtgggttt 360

gaattccctt ggtgccatgt gaattttttt aattttagct aggcgtcggc tgtacggggg 420

gggggggaat atgaatggga atgggttttg cggggaggga aaatgataat gatagataga 480

atgatgacag aacatgtgaa tggactgtgc gcgaggagac tactattgca gccttaataa 540

gtagtagaga tatcttggac taatttattt ggataagttt taaactcgat ttgaatcctc 600

ttgaagcttc ttcacatatt ttgagtgatt atcttgttga tgttggattt attatttgtg 660

catcccatca acacaattca aacacatggg tccgcgttct cgtgaattaa gccatatgag 720

accactagaa gtaataaaac atataagcaa tatgaattca aactttttag ttttcaatga 780

atgtcctaat tcatgtctat atgcactagc catatctggt aaggtatgaa aggcacaacc 840

tattttacct ttgctttggt tagaggaaac actagtcata attgatgttt tttaactcgc 900

gttcgaatca taaaaaatat ttacttcatt tcttagcatg taaaatattt ctttatctag 960

tggcttggta aatatattga ccagttgatc ttggtcatct agactcgcaa cttcaatttt 1020

tggcacttga aaaataaaca attcaactgt atgtaaatga cctagggaaa agagatatgt 1080

ttttcgatac aaaagtataa gagataaaac agtactgtat aaaaatggtt gtaaaaatac 1140

tttagaattc ttgatacaaa attgtttatg tgcgatatat tgaaaataaa aacaaacaaa 1200

caaataggcc ttctactctt tttttcaact tgaaaatttt attaactagt tttgttttca 1260

gcgactattg tagatgctca tgctctacca gaaaccaaac aaagtgacaa atactctggc 1320

tccaaccacc gtcaggtttg cggtgcagga gaaataacac ctccctaaat agaaaacaac 1380

acaagtcacc atcgaataga aacgaaatat ttttaatccg cttttcggtt ggtggtgcct 1440

ggcatctacc gtgcggaggg ggaagaggga gaggccagga gaggaaagcc tgcagccacc 1548

<210> 4

<211> 1200

<212> DNA

<213> corn (Zea mays L)

<400> 4

aaacacacat gtggtgtagt ggtagctact gctagcattt gcttaagagg ttgtgggttt 60

gaattccctt ggtgccatgt gaattttttt aattttagct aggcgtcggc tgtacggggg 120

gggggggaat atgaatggga atgggttttg cggggaggga aaatgataat gatagataga 180

atgatgacag aacatgtgaa tggactgtgc gcgaggagac tactattgca gccttaataa 240

gtagtagaga tatcttggac taatttattt ggataagttt taaactcgat ttgaatcctc 300

ttgaagcttc ttcacatatt ttgagtgatt atcttgttga tgttggattt attatttgtg 360

catcccatca acacaattca aacacatggg tccgcgttct cgtgaattaa gccatatgag 420

accactagaa gtaataaaac atataagcaa tatgaattca aactttttag ttttcaatga 480

atgtcctaat tcatgtctat atgcactagc catatctggt aaggtatgaa aggcacaacc 540

tattttacct ttgctttggt tagaggaaac actagtcata attgatgttt tttaactcgc 600

gttcgaatca taaaaaatat ttacttcatt tcttagcatg taaaatattt ctttatctag 660

tggcttggta aatatattga ccagttgatc ttggtcatct agactcgcaa cttcaatttt 720

tggcacttga aaaataaaca attcaactgt atgtaaatga cctagggaaa agagatatgt 780

ttttcgatac aaaagtataa gagataaaac agtactgtat aaaaatggtt gtaaaaatac 840

tttagaattc ttgatacaaa attgtttatg tgcgatatat tgaaaataaa aacaaacaaa 900

caaataggcc ttctactctt tttttcaact tgaaaatttt attaactagt tttgttttca 960

gcgactattg tagatgctca tgctctacca gaaaccaaac aaagtgacaa atactctggc 1020

tccaaccacc gtcaggtttg cggtgcagga gaaataacac ctccctaaat agaaaacaac 1080

acaagtcacc atcgaataga aacgaaatat ttttaatccg cttttcggtt ggtggtgcct 1140

ggcatctacc gtgcggaggg ggaagaggga gaggccagga gaggaaagcc tgcagccacc 1238

<210> 5

<211> 650

<212> DNA

<213> corn (Zea mays L)

<400> 5

ttgctttggt tagaggaaac actagtcata attgatgttt tttaactcgc gttcgaatca 60

taaaaaatat ttacttcatt tcttagcatg taaaatattt ctttatctag tggcttggta 120

aatatattga ccagttgatc ttggtcatct agactcgcaa cttcaatttt tggcacttga 180

aaaataaaca attcaactgt atgtaaatga cctagggaaa agagatatgt ttttcgatac 240

aaaagtataa gagataaaac agtactgtat aaaaatggtt gtaaaaatac tttagaattc 300

ttgatacaaa attgtttatg tgcgatatat tgaaaataaa aacaaacaaa caaataggcc 360

ttctactctt tttttcaact tgaaaatttt attaactagt tttgttttca gcgactattg 420

tagatgctca tgctctacca gaaaccaaac aaagtgacaa atactctggc tccaaccacc 480

gtcaggtttg cggtgcagga gaaataacac ctccctaaat agaaaacaac acaagtcacc 540

atcgaataga aacgaaatat ttttaatccg cttttcggtt ggtggtgcct ggcatctacc 600

gtgcggaggg ggaagaggga gaggccagga gaggaaagcc tgcagccacc 650

<210> 6

<211> 200

<212> DNA

<213> corn (Zea mays L)

<400> 6

aaagtgacaa atactctggc tccaaccacc gtcaggtttg cggtgcagga gaaataacac 60

ctccctaaat agaaaacaac acaagtcacc atcgaataga aacgaaatat ttttaatccg 120

cttttcggtt ggtggtgcct ggcatctacc gtgcggaggg ggaagaggga gaggccagga 180

gaggaaagcc tgcagccacc 200

Claims (7)

1. A promoter capable of responding to plant drought induction is characterized in that the promoter is a nucleotide sequence shown as SEQ ID NO.1 or a truncated sequence thereof.

2. The promoter capable of responding to plant drought induction according to claim 1, wherein the promoter is a downstream sequence obtained by truncating the nucleotide sequence shown as SEQ ID No.1 at-650 bp or upstream thereof.

3. The promoter capable of responding to plant drought induction according to claim 2, wherein the nucleotide sequence of the promoter is shown in any one of SEQ ID 2-5.

4. The promoter capable of responding to plant drought induction according to claim 3, wherein the nucleotide sequence of the promoter is shown as SEQ ID NO.5, and the sequence has a total length of 650 bp.

5. Use of a promoter according to any one of claims 1 to 4 for the inducible regulation of downstream gene expression in response to drought in a plant.

6. Use according to claim 5, wherein the plant is tobacco or maize.

7. The method for obtaining the promoter as claimed in claim 1, wherein the corn B73 genome is used as a template, and PCR amplification is carried out by using specific amplification primers to obtain the promoter capable of responding to plant drought induction, wherein the specific amplification primers comprise an upstream primer and a downstream primer;

the upstream primer is selected from any one of the following sequences:

P2000-F: GACTCTTGGTTGGGATGTAAAAT, amplifying the promoter sequence shown in SEQ ID NO. 1;

P1800-F: TAGGTGGACGATGAGCTGGAC, amplifying the promoter sequence shown in SEQ ID NO. 2;

P1500-F: CAAGAAGAAACATGGATTCATGTT, amplifying a promoter sequence shown in SEQ ID NO. 3;

P1200-F: AAACACACATGTGGTGTAGTGGTA, amplifying a promoter sequence shown in SEQ ID NO. 4;

P650-F: TTGCTTTGGTTAGAGGAA, amplifying the promoter sequence shown in SEQ ID NO. 5;

P200-F: AAAGTGACAAATACTCTGGCTCC, amplifying the promoter sequence shown in SEQ ID NO. 6;

the downstream primer is as follows:

P2000-R：GGTGGCTGCAGGCTTTCC。

Images