CN114891117A

CN114891117A - Chimeric antigen receptor T cell targeting CCR8 and preparation method and application thereof

Info

Publication number: CN114891117A
Application number: CN202210446897.5A
Authority: CN
Inventors: 不公告发明人
Original assignee: Shenzhen In Vivo Biomedicine Technology Ltd
Current assignee: Shenzhen In Vivo Biomedicine Technology Ltd
Priority date: 2022-04-26
Filing date: 2022-04-26
Publication date: 2022-08-12
Anticipated expiration: 2042-04-26
Also published as: CN114891117B; WO2023206938A1

Abstract

The invention provides a chimeric antigen receptor T cell targeting CCR8, and a preparation method and application thereof. The chimeric antigen receptor specifically binds to CCR8, the chimeric antigen receptor comprising a signal peptide, an extracellular recognition domain, a transmembrane domain and a signaling domain, the extracellular recognition domain comprising an anti-CCR8 single chain antibody, the anti-CCR8 single chain antibody comprising the amino acid sequence shown in SEQ ID No.1 or SEQ ID No. 2. The CAR-T cell targeting CCR8 shows obvious anti-tumor effect in ATLL cell models or animal models, and has obvious killing property on T-ALL cells expressing CCR 8. The chimeric antigen receptor T cells targeting CCR8 in the invention provide novel targets and therapeutic strategies for CAR-T treatment regimens targeting ATLL and CCR8 expressing T-ALL and other tumors.

Description

Chimeric antigen receptor T cell targeting CCR8 and preparation method and application thereof

Technical Field

The invention belongs to the technical field of biology, and particularly relates to a chimeric antigen receptor T cell targeting CCR8, and a preparation method and application thereof.

Background

T cell malignancies are tumors arising from clonal growth and T cell dysfunction, which are often defined as high risk individuals, who have hematopoietic failure, medullary and extramedullary infiltrates and a high probability of affecting the central nervous system of the patient. Among these adult T cell leukemia/lymphoma tumors (ATLL) is one of the common T cell malignancies, ATLL being a malignancy induced by HTLV-1 virus. Clinical stages of ATLL patients are mainly acute, lymphoma, chronic and fuming, with four-year survival rates of 11%, 16%, 36% and 52%, respectively.

Chimeric Antigen Receptors (CARs) are genetically modified receptors that redirect T cells to surface antigens of various tumors. CAR molecules were originally generated in the late 1980 s and developed rapidly by the early 2010 s. Currently, common CAR molecules typically comprise an extracellular antigen binding domain, an intracellular signaling domain and one or two additional intracellular co-stimulatory signaling domains. In clinical use, T cells are first harvested from a patient or healthy donor, genetically edited to express a particular receptor protein, and then expanded in vitro for injection into the patient. CAR-T cell therapy is rapidly evolving as a live drug to be one of the most promising new therapies for the treatment of hematologic and non-hematologic malignancies.

In 2017, the FDA approved tisagenlecellectel by noval for the treatment of childhood B cell precursor Acute Lymphoblastic Leukemia (ALL), the FDA approved axicabtagene cilolectel by kit for adult diffuse large B cell lymphoma, and CAR-T cell therapy was rapidly developed. CAR-T therapy has had great success in treating hematological tumors, encouraging and motivating more people to invest in CAR-T therapy studies of solid tumors. CAR-T therapy is expected to have similar success in solid tumors as well. Currently, the challenges facing the treatment of T cell tumors mainly include lack of tumor specific antigens, limited T cell expansion, and the need for third party donor or T cell receptor alpha site (TRAC) gene editing, thus there is an urgent need to investigate new targets for tumor treatment.

There are studies reporting that anti-CD7 CAR-T can be used to treat hematological tumors, but CD7 knock-out on a T cell basis and TRAC expression in third party donors is required, and many patients relapse after treatment without CD7 expression in ATLL. Currently, ATLL-targeted CAR-T therapy targets only CCR4, but CCR4 is a marker that is significantly upregulated after T cell activation, and CCR 4-targeted CAR-T cells are more depleted, and therefore a greater number of bases are required for CAR-T cell production. CCR8 is mainly expressed on tumor-infiltrated Treg cells, is secondarily expressed on a part of Th2 cells, but is not expressed on Th1 cells, and is an ideal potential target. Therefore, the new CAR-T cell for treating hematological tumor and the preparation method thereof, which take CCR8 as the target point of CAR-T, have important application value.

Disclosure of Invention

Aiming at the defects in the prior art, the invention aims to provide a chimeric antigen receptor T cell targeting CCR8, and a preparation method and application thereof. The chimeric antigen receptor uses CCR8 as a target, constructs a CAR-T cell targeting CCR8, and proves that CCR8 cannot influence proliferation of T cells, and the CAR-T cell targeting CCR8 shows an obvious anti-tumor effect in an ATLL cell model or an animal model, and has an obvious killing characteristic on T-ALL cells expressing CCR 8. Provides a new target and a treatment strategy for CAR-T treatment schemes targeting ATLL and T-ALL expressing CCR8 and other tumors.

The invention firstly proposes that CCR8 is used as a target spot of adult T-lymphocyte leukemia, the CCR 8-targeted CAR-T cell is constructed for the first time, and the CCR 8-targeted CAR-T cell has a good anti-tumor effect, has a good killing effect on tumor cells in vitro and in vivo, and provides a new target spot and a new strategy for treating the adult T-lymphocyte leukemia.

In order to achieve the purpose, the invention adopts the following technical scheme:

in a first aspect, the present invention provides a chimeric antigen receptor that specifically binds CCR 8;

the chimeric antigen receptor comprises a signal peptide, an extracellular recognition domain, a transmembrane domain, and a signaling domain;

the extracellular recognition domain comprises an anti-CCR8 single chain antibody, and the anti-CCR8 single chain antibody comprises an amino acid sequence shown in SEQ ID No.1 or SEQ ID No. 2.

SEQ ID No.1：

EIVMTQSPATLSVSPGERATLSCRSSKSLLHSNGNTYLYWYQQKPGQAPRLLIYRVSNLASGIPARFSGSGSGTEFTLTISSLQSEDFAVYYCMQHLEYPFTFGQGTKLEIKGSGGGGSGGGGSGGGGSEVQLVESGGALVKPGGSLRLSCAASGFTFSTYAMYWVRQAPGKGLEWVGRIRSKSNNYATYYADSVKDRFTISRDDSKNTLYLQMNSLKTEDTAVYYCTRGGYGNYRYAMDYWGQGTTVTVSS。

SEQ ID No.2：

DIVMTQSPDSLAVSLGERATINCRSSKSLLHSNGNTYLYWYQQKPGQPPKLLIYRMSNLASGVPDRFSGSGSGTDFILTISSLQAEDVAVYYCMQHLEYPLTFGQGTKLEIKRTGSGGGGSGGGGSGGGGSEVQLVESGGALVKPGGSLRLSCAASGFTFSTYALYWVRQAPGKGLEWVGRIRSKSNNYATYYADSVKDRFTISRDDSKNTLYLQMNSLKTEDTAVYYCTRARFYYSDYGYAMDYWGQGTLVTVSS。

Preferably, the transmembrane domain comprises CD28 TM.

Preferably, the signaling domain comprises a combination of CD28, CD3 ζ and TLR 2.

Preferably, the chimeric antigen receptor consists of a signal peptide, an anti-CCR8 single chain antibody, CD28TM, CD28, CD3 ζ and TLR2 in tandem.

Preferably, the chimeric antigen receptor comprises the amino acid sequence shown in SEQ ID No.3 or SEQ ID No. 4.

SEQ ID No.3：

MLLLVTSLLLCELPHPAFLLIPEIVMTQSPATLSVSPGERATLSCRSSKSLLHSNGNTYLYWYQQKPGQAPRLLIYRVSNLASGIPARFSGSGSGTEFTLTISSLQSEDFAVYYCMQHLEYPFTFGQGTKLEIKGSGGGGSGGGGSGGGGSEVQLVESGGALVKPGGSLRLSCAASGFTFSTYAMYWVRQAPGKGLEWVGRIRSKSNNYATYYADSVKDRFTISRDDSKNTLYLQMNSLKTEDTAVYYCTRGGYGNYRYAMDYWGQGTTVTVSSTRIEVMYPPPYLDNEKSNGTIIHVKGKHLCPSPLFPGPSKPFWVLVVVGGVLACYSLLVTVAFIIFWVRSKRSRLLHSDYMNMTPRRPGPTRKHYQPYAPPRDFAAYRSRVKFSRSADAPAYQQGQNQLYNELNLGRREEYDVLDKRRGRDPEMGGKPRRKNPQEGLYNELQKDKMAEAYSEIGMKGERRRGKGHDGLYQGLSTATKDTYDALHMQALPPRQAKRKPRKAPSRNICYDAFVSYSERDAYWVENLMVQELENFNPPFKLCLHKRDFIPGKWIIDNIIDSIEKSHKTVFVLSENFVKSEWCKYELDFSHFRLFDENNDAAILILLEPIEKKAIPQRFCKLRKIMNTKTYLEWPMDEAQREGFWVNLRAAIKS。

SEQ ID No.4：

MLLLVTSLLLCELPHPAFLLIPDIVMTQSPDSLAVSLGERATINCRSSKSLLHSNGNTYLYWYQQKPGQPPKLLIYRMSNLASGVPDRFSGSGSGTDFILTISSLQAEDVAVYYCMQHLEYPLTFGQGTKLEIKRTGSGGGGSGGGGSGGGGSEVQLVESGGALVKPGGSLRLSCAASGFTFSTYALYWVRQAPGKGLEWVGRIRSKSNNYATYYADSVKDRFTISRDDSKNTLYLQMNSLKTEDTAVYYCTRARFYYSDYGYAMDYWGQGTLVTVSSTRIEVMYPPPYLDNEKSNGTIIHVKGKHLCPSPLFPGPSKPFWVLVVVGGVLACYSLLVTVAFIIFWVRSKRSRLLHSDYMNMTPRRPGPTRKHYQPYAPPRDFAAYRSRVKFSRSADAPAYQQGQNQLYNELNLGRREEYDVLDKRRGRDPEMGGKPRRKNPQEGLYNELQKDKMAEAYSEIGMKGERRRGKGHDGLYQGLSTATKDTYDALHMQALPPRQAKRKPRKAPSRNICYDAFVSYSERDAYWVENLMVQELENFNPPFKLCLHKRDFIPGKWIIDNIIDSIEKSHKTVFVLSENFVKSEWCKYELDFSHFRLFDENNDAAILILLEPIEKKAIPQRFCKLRKIMNTKTYLEWPMDEAQREGFWVNLRAAIKS。

In a second aspect, the present invention provides a nucleic acid molecule encoding the chimeric antigen receptor of the first aspect.

Preferably, the nucleic acid molecule comprises the nucleotide sequence shown as SEQ ID No.5 or SEQ ID No. 6.

SEQ ID No.5：

atgcttctcctggtgacaagccttctgctctgtgagttaccacacccagcattcctcctgatcccagagatcgtgatgacacagagccccgccacactgagcgtgagccccggcgagcgggccaccctgagctgccggagcagcaagagcctgctgcacagcaacgggaacacctacctgtactggtaccagcagaagcccggccaggcccccaggctgctgatctacagggtgagcaacctggccagcggcatccccgcccggttcagcgggagcgggagcggcaccgagttcacactgaccatcagcagcctgcagagcgaggatttcgccgtgtactactgcatgcagcacctggagtaccccttcacattcgggcaggggacaaagctggagatcaagggatccggtggcggtggcagcggcggtggtggttccggaggcggcggttctgaagtgcagctggtggagagcgggggggccctggtgaagcccggcggcagcctgaggctgagctgcgccgccagcgggttcaccttctccacctacgccatgtactgggtgaggcaggcccccggcaaggggctggagtgggtggggcggattaggagcaagagcaacaactacgccacatactacgccgatagcgtgaaggataggttcaccatcagccgggacgatagcaagaacacactgtacctgcagatgaacagcctcaagaccgaggacaccgccgtgtactactgcacaaggggcggctacggcaactaccggtacgccatggactactgggggcaggggacaacagtgacagtgagcagcacgcgtattgaagttatgtatcctcctccttacctagacaatgagaagagcaatggaaccattatccatgtgaaagggaaacacctttgtccaagtcccctatttcccggaccttctaagcccttttgggtgctggtggtggttgggggagtcctggcttgctatagcttgctagtaacagtggcctttattattttctgggtgaggagtaagaggagcaggctcctgcacagtgactacatgaacatgactccccgccgccccgggcccacccgcaagcattaccagccctatgccccaccacgcgacttcgcagcctatcgctccagagtgaagttcagcaggagcgcagacgcccccgcgtaccagcagggccagaaccagctctataacgagctcaatctaggacgaagagaggagtacgatgttttggacaagagacgtggccgggaccctgagatggggggaaagccgagaaggaagaaccctcaggaaggcctgtacaatgaactgcagaaagataagatggcggaggcctacagtgagattgggatgaaaggcgagcgccggaggggcaaggggcacgatggcctttaccagggtctcagtacagccaccaaggacacctacgacgcccttcacatgcaggccctgccccctcgccaggccaaaaggaagcccaggaaagctcccagcaggaacatctgctatgatgcatttgtttcttacagtgagcgggatgcctactgggtggagaaccttatggtccaggagctggagaacttcaatccccccttcaagttgtgtcttcataagcgggacttcattcctggcaagtggatcattgacaatatcattgactccattgaaaagagccacaaaactgtctttgtgctttctgaaaactttgtgaagagtgagtggtgcaagtatgaactggacttctcccatttccgtctttttgatgagaacaatgatgctgccattctcattcttctggagcccattgagaaaaaagccattccccagcgcttctgcaagctgcggaagataatgaacaccaagacctacctggagtggcccatggacgaggctcagcgggaaggattttgggtaaatctgagagctgcgataaagtcc。

SEQ ID No.6：

atgcttctcctggtgacaagccttctgctctgtgagttaccacacccagcattcctcctgatcccagatatcgtgatgacacagagccccgatagcctggccgtgagcctgggcgagcgggccacaatcaactgcaggagcagcaagagcctgctgcacagcaacgggaacacatacctgtactggtaccagcagaagcccggccagccccccaagctgctgatctaccggatgagcaacctggcctccggggtgcccgataggttcagcgggagcgggagcgggaccgacttcatcctgaccatcagcagcctgcaggccgaggacgtggccgtgtactactgcatgcagcacctggagtaccccctgaccttcggccagggcacaaagctggagatcaagaggacaggatccggtggcggtggcagcggcggtggtggttccggaggcggcggttctgaggtgcagctggtggagagcggcggcgccctggtgaagcccggcgggagcctgaggctgagctgcgccgccagcgggttcaccttcagcacatacgccctgtactgggtgaggcaggcccccggcaagggcctggagtgggtggggcggatcaggagcaagagcaacaactacgccacctactacgccgatagcgtgaaggataggttcacaatcagccgggatgatagcaagaacacactgtacctgcagatgaacagcctcaagaccgaggacaccgccgtgtactactgcacaagggcccggttctactacagcgactacgggtacgccatggactactgggggcagggcacactggtgacagtgagcagcacgcgtattgaagttatgtatcctcctccttacctagacaatgagaagagcaatggaaccattatccatgtgaaagggaaacacctttgtccaagtcccctatttcccggaccttctaagcccttttgggtgctggtggtggttgggggagtcctggcttgctatagcttgctagtaacagtggcctttattattttctgggtgaggagtaagaggagcaggctcctgcacagtgactacatgaacatgactccccgccgccccgggcccacccgcaagcattaccagccctatgccccaccacgcgacttcgcagcctatcgctccagagtgaagttcagcaggagcgcagacgcccccgcgtaccagcagggccagaaccagctctataacgagctcaatctaggacgaagagaggagtacgatgttttggacaagagacgtggccgggaccctgagatggggggaaagccgagaaggaagaaccctcaggaaggcctgtacaatgaactgcagaaagataagatggcggaggcctacagtgagattgggatgaaaggcgagcgccggaggggcaaggggcacgatggcctttaccagggtctcagtacagccaccaaggacacctacgacgcccttcacatgcaggccctgccccctcgccaggccaaaaggaagcccaggaaagctcccagcaggaacatctgctatgatgcatttgtttcttacagtgagcgggatgcctactgggtggagaaccttatggtccaggagctggagaacttcaatccccccttcaagttgtgtcttcataagcgggacttcattcctggcaagtggatcattgacaatatcattgactccattgaaaagagccacaaaactgtctttgtgctttctgaaaactttgtgaagagtgagtggtgcaagtatgaactggacttctcccatttccgtctttttgatgagaacaatgatgctgccattctcattcttctggagcccattgagaaaaaagccattccccagcgcttctgcaagctgcggaagataatgaacaccaagacctacctggagtggcccatggacgaggctcagcgggaaggattttgggtaaatctgagagctgcgataaagtcc。

In a third aspect, the present invention provides an expression vector comprising at least one copy of the nucleic acid molecule of the second aspect.

Preferably, the expression vector comprises a viral vector.

Preferably, the viral vector comprises any one of a lentiviral vector, a retroviral vector or an adeno-associated viral vector, preferably a lentiviral vector.

In a fourth aspect, the invention provides a recombinant lentivirus, which is prepared by cotransfecting the expression vector and the packaging plasmid of the third aspect into a virus packaging cell.

In a fifth aspect, the present invention provides a chimeric antigen receptor T cell targeting CCR8, wherein the chimeric antigen receptor T cell targeting CCR8 expresses the chimeric antigen receptor of the first aspect.

In a sixth aspect, the present invention provides a method for preparing the chimeric antigen receptor T cell targeting CCR8 according to the fifth aspect, wherein the preparation method comprises the following steps:

(1) constructing an expression vector encoding a chimeric antigen receptor;

(2) co-transfecting the expression vector and the packaging plasmid in the step (1) into a virus packaging cell to prepare a recombinant lentivirus;

(3) introducing the recombinant lentivirus obtained in the step (2) into T cells to prepare chimeric antigen receptor T cells expressing CCR 8.

In a seventh aspect, the present invention provides a pharmaceutical composition comprising the chimeric antigen receptor T cell targeting CCR8 of the fifth aspect.

Preferably, the pharmaceutical composition further comprises any one or a combination of at least two of a pharmaceutically acceptable carrier, excipient or diluent.

In an eighth aspect, the invention provides a chimeric antigen receptor T cell targeting CCR8 in the fifth aspect and/or a pharmaceutical composition in the seventh aspect, for use in the preparation of a medicament for the treatment of tumors.

Preferably, the tumor comprises a CCR8 positive tumor.

Preferably, the CCR8 positive tumor comprises a T lymphocyte leukemia.

Compared with the prior art, the invention has the following beneficial effects:

(1) the CAR-T cell targeting CCR8 shows obvious anti-tumor effect in an ATLL cell model or an animal model, CCR8 does not influence the proliferation of the T cell, and the CAR-T cell has obvious killing effect on the cell expressing CCR 8T-ALL.

(2) The invention firstly proposes that CCR8 is used as a target spot of adult T-lymphocyte leukemia, the CCR 8-targeted CAR-T cell is constructed for the first time, and the CCR 8-targeted CAR-T cell has a good anti-tumor effect, has a good killing effect on tumor cells in vitro and in vivo, and provides a new target spot and a new strategy for treating the adult T-lymphocyte leukemia.

Drawings

FIGS. 1A and 1B are the expression levels of CCR8 and CD7 in ATLL patients' CD4T cells versus normal CD4T cells in example 1.

FIGS. 1C and 1D are expression levels of CCR8 and CD7 in MT-4 cells and C8166 cells from example 1.

FIG. 2 is a schematic diagram of the structures of the C1928z plasmid, the C1028z plasmid and the 1928z plasmid in example 2.

FIG. 3 is an expansion curve of CAR-T cells in test example 1.

FIG. 4A is a graph that measures killing activity of CAR-T cells on MT-4-GL cells and C8166-GL cells in example 2.

FIG. 4B is a graph showing the statistics of the secretion of granzyme after coculture of CAR-T cells with MT-4-GL cells and C8166-GL cells in test example 2.

FIG. 4C is a statistical chart of the amount of IFN- γ secretion in test example 2 after the CAR-T cells were co-cultured with MT-4-GL cells and C8166-GL cells.

FIGS. 5A, 5B and 5C are the results of the test of the antitumor activity of CAR-T cells in test example 3; FIG. 5A is a graph showing the results of in vivo imaging of mice, FIG. 5B is a statistical graph showing the amplification results of MT-4-GL cells in mice, and FIG. 5C is a survival curve of MT-4-GL mice.

FIG. 6A is a graph showing the expression level of CCR8 in Jurkat cells and molt-4 cells tested in example 4.

FIG. 6B is a graph of CAR-T cells detecting killing activity against Jurkat cells in test example 4.

FIG. 6C is a statistical graph of the secretion amount of granzyme after the CAR-T cells were co-cultured with Jurkat cells in test example 4.

FIG. 6D is a statistical chart of IFN-. gamma.secretion after the CAR-T cells were co-cultured with Jurkat cells in test example 4.

Fig. 6E is a graph showing the results of in vivo imaging of the mouse in test example 4.

FIG. 6F is a statistical graph showing the in vivo expansion of Jurkat cells in mouse in test example 4.

FIG. 6G is a survival curve of Jurkat mice in test example 4.

Detailed Description

The technical solution of the present invention is further explained by the following embodiments. It should be understood by those skilled in the art that the examples are only for the understanding of the present invention and should not be construed as the specific limitations of the present invention.

The examples do not show the specific techniques or conditions, according to the technical or conditions described in the literature in the field, or according to the product specifications. The reagents or apparatus used are conventional products commercially available from normal sources, not indicated by the manufacturer.

Example 1

This example demonstrates the specific expression of CCR8 in ATLL patients and ATLL cell lines

Data from ATLL patient CD4T cells and Normal CD4T cells (Normal CD4T) were downloaded at GEO database (GSE33615) for T-test analysis, and the results are shown in FIGS. 1A and 1B, with high expression of CCR8 in ATLL patient CD4T cells compared to Normal CD4T cells.

Flow detection of CD7 and CCR8 expression in ATLL cell lines (including MT-4 cell line and C8166 cell line):

respectively culturing MT-4 cell line and C8166 cell line with RPMI-1640 culture medium, 10% FBS and 1% P/S at 37 deg.C and 5% CO ₂ Half-change of the culture medium is carried out every two days to ensure that the concentration of the cultured cells does not exceed 3 multiplied by 10 ⁶ cells/mL.

The culture medium of MT-4 cell line and C8166 cell line were diluted to 2X 10 with PBS buffer solution ⁵ cells/mL of cell suspension; to the cell suspension, 0.5. mu.L of CD7 flow antibody and 0.5. mu.L of CCR8 flow antibody were added, and stained at 4 ℃ for 30min, washed with 1mL of PBS buffer after staining, centrifuged at 300g for 5min, and then added to 100. mu.L of PBS buffer for detection on a machine.

The detection results are shown in FIG. 1C and FIG. 1D, and the detection results show that CCR8 is highly expressed in MT-4 cell line and C8166 cell line.

Example 2

Construction of lentiviral expression vectors in this example (plasmid C1928z, plasmid C1028z, and plasmid 1928 z)

Construction of lentiviral expression vectors: the synthetic sequence Anti-CCR8(19D7) -CD28-CD3 zeta-TLR 2 and the sequence Anti-CCR8(10A11) -CD28-CD3 zeta-TLR 2 (synthesized by Biotechnology (Shanghai) GmbH) were cleaved with two restriction enzymes MssI and BcuI, respectively, and the pWPXLD-2A-eGFP lentiviral backbone carrying the eGFP reporter gene was cleaved with MssI and BcuI at the same time under the conditions: the enzyme was cleaved at 37 ℃ for 2 h.

After enzyme digestion, the target fragment was separated by agarose gel electrophoresis, and the instrument was set at 120V for 30 min. The fragments of interest were recovered using a gel recovery kit and then ligated with Solutioni ligase for 1h at 16 ℃ in a metal bath. The ligation products and competent cells TransStbl3 were incubated on ice for 30min, heat-shocked at 42 ℃ for 45s, placed on ice for 3min, added with 200. mu.L of non-resistant LB medium, shake-cultured at 37 ℃ for 45min, spread evenly on LB plates with ampicillin resistance, and placed upside down in an incubator at 37 ℃ for overnight culture.

Selecting well-growing circular bacterial colony, inoculating the bacterial colony into ampicillin resistant liquid LB culture medium for culture (2 mL LB culture medium is filled in a 15mL centrifuge tube), wherein the culture conditions are as follows: shaking at 37 deg.C, and culturing at 220r/min for 8 h.

After the culture is finished, extracting plasmids by using a plasmid miniprep kit, identifying and sequencing the extracted plasmids by using restriction enzymes MssI, BcuI or NdeI, inoculating 100 mu L of correctly identified clone bacterial liquid into an ampicillin resistant liquid LB culture medium for culture (30 mL of LB culture medium is filled in a 50mL centrifuge tube), wherein the culture conditions are as follows: shaking at 37 deg.C, and culturing at 220r/min for 20 h.

After the culture is finished, extracting plasmids by using an endotoxin-free plasmid extraction kit, identifying and sequencing the extracted plasmids by using restriction enzymes MssI, BcuI or NdeI again, and storing the correctly identified plasmids in a refrigerator at the temperature of-20 ℃.

The same procedure was used to construct a lentiviral vector containing the coding sequence for a CAR targeting a single chain antibody to CD19 (pwxld-FMC 63-CD28TM-CD28-CD3 ζ -TLR2-2A-eGFP) as a control (1928z plasmid).

The plasmids C1928z, C1028z and 1928z are obtained after construction, wherein the structural schematic diagrams of the plasmids C1928z, C1028z and 1928z are shown in FIG. 2, and the 1928z plasmid in FIG. 2 is a control group.

The nucleotide sequence of the C1928z plasmid pWPXLD-CCR8(19D7) -CD28TM-CD28-CD3 zeta-TLR 2-2A-eGFP is shown as SEQ ID No. 5;

the nucleotide sequence of the C1028z plasmid pWPXLD-CCR8(10A11) -CD28TM-CD28-CD3 zeta-TLR 2-2A-eGFP is shown as SEQ ID No. 6.

Example 3

This example prepared C1928z recombinant lentivirus, C1028z recombinant lentivirus and 1928z recombinant lentivirus

And (3) slow virus packaging:

(1) HEK293T cells (6X 10) were added to 100mm cell culture dishes ⁶ Left and right of one cell) (cat # iCell-h237) and 8mL DMEM medium (DMEM + 10% FBS + 1% P/S), the cell culture dish was placed in a cell culture incubator for culture.

(2) The cells were observed under a fluorescent inverted microscope until they were spread over 80% of the bottom of the culture dish. If the cells are uniformly distributed and well conditioned, they can be used for virus packaging experiments. The culture supernatant was aspirated, 6mL of DMEM virus packaging medium (DMEM + 1% FBS + 1% P/S) was added, and the mixture was placed in an incubator and subjected to starvation for 2 hours.

(3) The helper plasmids pMD2.G (cat. No. P0262), psPAX2 (cat. No. P0261) and the examples2Mixing the plasmids of the lentiviral expression vector C1928z prepared in (1), mixing the plasmid C1928z, the helper plasmid pMD2.G and the helper plasmid psPAX2 in a mass (ug) of 9:3:12, adding the mixture to 0.5mL of Opti-MEM (labeled as solution A), adding 72 ug of PEI (polyethyleneimine) to 0.5mL of Opti-MEM (labeled as solution B), and standing at room temperature for 5 min; mixing solution A and solution B, and standing at room temperature for 20 min; the mixture was added dropwise to the starved HEK293T cell culture dish, gently shaken, and then placed in an incubator for culture.

(4) After 6h of culture, the cells were observed under a fluorescent inverted microscope, and it was found that sporadic cells emitted green fluorescence. The medium supernatant was aspirated, 10mL of fresh pre-warmed DMEM virus packaging medium (DMEM + 1% FBS + 1% P/S) was added, and the mixture was returned to the incubator for further culture.

(5) Collecting culture medium supernatant every 24h, adding appropriate amount of fresh preheated DMEM virus packaging culture medium (DMEM + 1% FBS + 1% P/S), and placing into the incubator; the collected viral supernatant was filtered through a 0.45 μm filter to obtain C1928z recombinant lentivirus, which was stored in a refrigerator at 4 ℃ for use within a week.

The same method was used to prepare C1028z recombinant lentivirus and 1928z recombinant lentivirus.

Example 4

This example prepared CAR-T cells, including C1928z T cells, C1028z T cells, and 1928z T cells.

The CAR-T cells were prepared as follows:

activated T cells were centrifuged, supernatant removed, resuspended in T cell media (T551H 3+ 10% FBS + 1% P/S +300IU/mL IL-2) and counted.

Dilution of T cells to approximately 2X 10 ⁶ cells/mL, the C1928z recombinant lentivirus described in example 3 (ratio of viral particle number to cell number 5:1) and polybrene (8. mu.g/mL) were added, mixed and placed at 37 ℃ in 5% CO ₂ Infecting in an incubator for 24H, changing the culture medium, and culturing T cells with T cell culture medium (T551H 3+ 10% FBS + 1% P/S +300IU/mL IL-2) to 7 days after changing the culture medium to ensure that the culture density of the T cells is (1-2). times.10 ⁶ . Counting C1928z T cells, centrifuging, adding freezing medium (90% FBS + 10% DMSO), mixing well, freezing density is 1 × 10 ⁸ cell/mL; 1mL of cell homogenate was added to each vial. Placing the freezing tube in a gradient freezing box, and cooling in a refrigerator at-80 ℃; and transferring to a liquid nitrogen tank for preservation after 12 h.

C1028z T cells and 1928z T cells were prepared in the same manner.

Test example 1

CAR-T cells of example 4 were cultured and expansion curves of CAR-T cells were generated

CAR-T cells (including C1928z T cells, C1028z T cells and 1928z T cells) were diluted to 1 × 10 ⁶ cells/mL of cell suspension, culturing under T551H 3+ 10% FBS + 1% P/S +300U/mL IL-2, observing the state of CAR-T cells and the color of the culture medium every 2 days under an inverted fluorescence microscope; flow counting cells on

days

3, 5, 7 and 9; during the culture of the CAR-T cells, the fresh T cell culture medium is generally replaced once every 2 days, and the expansion culture is carried out in vitro for 10 days; CAR-T cells were cultured to day 10, CAR-T cells were transferred to appropriate centrifuge tubes, centrifuged at 380g for 3.5min at room temperature, the supernatant was aspirated, resuspended in 1mL of T cell culture medium, 10 μ L T cell suspension was taken for cell counting and CAR-T cell number recorded. The amplification curve of CAR-T cells is shown in figure 3.

Test example 2

Example 4 validation of killing of CAR-T cells and cytokine secretion assay

An appropriate amount of the CAR-T cells of example 4 were removed into a 15mL centrifuge tube, centrifuged at 300g for 5min to remove supernatant, the CAR-T cells were resuspended in PBS buffer, washed once and centrifuged again, resuspended in IL-2 free 1640 medium (1640+ 10% FBS + 1% P/S), counted and CAR-T cells diluted to the appropriate concentration.

mu.L of 1640 medium (1640+ 10% FBS + 1% P/S) was added to the white bottom 96-well plate and 100. mu.L of adjusted density CAR-T cells was added to the first row. Mix well with a row gun and add 100 μ L into the next row. Then serially diluted in multiple ratios (2-fold) for a total of 7 gradients and a medium-only blank gradient.

Preparing target cells (including MT-4-GL cells and C8166-GL cells), centrifuging, discarding supernatant, resuspending with PBS buffer solution, washing, centrifuging, discarding supernatant, resuspending with 1640 medium (1640+ 10% FBS + 1% P/S), diluting to 1 × 10 ⁵ cells/mL. Add 100. mu.L of target cells per well in a white-bottomed 96-well plate. Thus, the final concentration was 8:1, 4:1, 2:1, 1:2, 1:4, 1:8 and 0:1 CAR-T cell to target cell (E: T) ratios; the mixed cells were placed in an incubator at 37 ℃ for 24 hours.

After 24h incubation, the white-bottomed 96-well plates were removed, diluted luciferase substrate (150. mu.g/mL) was added to each well of the white-bottomed 96-well plates, and the fluorescence values were read on a luminometer, and the cell killing ratio was calculated at different E: T ratios.

And taking the supernatant after killing, and detecting the secretion amount of the cell factors according to the operational instructions of a Granzyme-B and IFN-gamma Elisa kit.

The detection results are shown in fig. 4A, 4B, and 4C. FIG. 4A is a graph of killing activity of CAR-T cells on MT-4-GL cells and C8166-GL cells; FIG. 4B is a graph of granzyme secretion statistics after co-culture of CAR-T cells with MT-4-GL cells and C8166-GL cells; FIG. 4C is a statistical plot of IFN- γ secretion after coculture of CAR-T cells with MT-4-GL cells and C8166-GL cells.

After co-culture of CAR-T cells with MT-4 and C8166 cells, CAR-T cells targeting CCR8 (C1928zT and C1028z T cells) showed up-regulated activation markers and secreted abundant cytokines (granzyme B and IFN- γ) that were critical to T cell immunity. CAR-T cells targeting CCR8 also exert an increasing cytotoxic effect, from low to high E: T ratios.

Test example 3

Example 4 validation of CAR-T cells for anti-tumor Activity in vivo

On the first day, 8-week-old NSI mice of the same sex were collected, and 100. mu.L of MT-4-GL cell suspension (8X 10) was aspirated by an insulin syringe ⁵ Cells/mouse), tail vein injection. Live imaging was performed the next day and grouped according to imaging data.

Recovering frozen CAR-T cells, taking C1928z T cells and C1028z T cells as experimental groups, taking 1928z T cells as control group, counting, and resuspending to CAR-T cell density of 5 × 10 ⁷ cells/mL and split into 100. mu.L per tube. I.e. 5X 10 per tube ⁶ And injecting the CAR-T cells into the mice by adopting an intraperitoneal injection mode. Three groups of mice were imaged in vivo weekly and analyzed.

The results of the measurement of antitumor activity are shown in fig. 5A, 5B and 5C. FIG. 5A is a graph showing the results of in vivo imaging of mice, FIG. 5B is a statistical graph showing the amplification results of MT-4-GL cells in mice, and FIG. 5C is a survival curve of MT-4-GL mice. It can be seen from the figure that the experimental group of CAR-T cells was effective in inhibiting the progress of amplification of MT-4-GL cells in vivo.

Test example 4

The inhibitory effect of CAR-T cells on the growth of CCR8 positive T cell malignancies in vitro and in vivo was demonstrated in example 4.

(1) Flow detection of expression of CCR8 in Jurkat cells and molt 4 cells

Culturing Jurkat cells and molt 4 cells in RPMI-1640 medium, 10% FBS and 1% P/S at 37 deg.C and 5% CO ₂ Half-change of the culture medium is carried out every two days to ensure that the concentration of the cultured cells does not exceed 3 multiplied by 10 ⁶ cells/mL.

The culture solutions of Jurkat cells and molt 4 cells were each buffered with PBSDiluting the solution to 2 × 10 ⁵ cell/mL suspension; separately, 0.5. mu.L of CCR8 flow antibody was added, stained at 4 ℃ for 30min, washed with 1mL of PBS buffer, centrifuged at 300g for 5min, and then added to 100. mu.L of PBS buffer for detection on a computer. The results of the assay are shown in FIG. 6A, and FIG. 6A is the expression level of CCR8 in Jurkat cells and molt-4 cells, wherein CCR8 is highly expressed in Jurkat cells.

(2) Validation of killing of Jurkat cells by CAR-T cells and cytokine secretion

Appropriate amount of CAR-T cells were removed into 15mL centrifuge tubes, centrifuged at 300g for 5min to remove supernatant, re-centrifuged after re-suspension washing with PBS buffer, re-suspended in IL-2 free 1640 medium (1640+ 10% FBS + 1% P/S), counted and CAR-T cells diluted to appropriate concentration.

Preparing target cells (Jurkat cells), centrifuging, discarding the supernatant, resuspending in PBS buffer, washing, centrifuging, discarding the supernatant, resuspending in 1640 medium (1640+ 10% FBS + 1% P/S), diluting to 1X 10 ⁵ cells/mL. Add 100. mu.L of target cells per well in a white-bottomed 96-well plate. Thus, the final concentration was 8:1, 4:1, 2:1, 1:2, 1:4, 1:8 and 0:1 CAR-T cell to target cell (E: T) ratios; the mixed cells were placed in an incubator at 37 ℃ for 24 hours.

After 24h of co-incubation, the white-bottomed 96-well plates were removed, and diluted luciferase substrate (150. mu.g/mL) was added to each well of the white-bottomed 96-well plates to read the fluorescence value on a fluorometer, and the cell killing ratio was calculated at different E: T ratios.

And taking the supernatant after killing, and detecting the secretion of the cell factors according to the operation of a Granzyme-B and IFN-gamma Elisa kit.

The detection results are shown in fig. 6B, 6C, and 6D. FIG. 6B is a graph of the killing activity of CAR-T cells on Jurkat cells; FIG. 6C is a histogram of granzyme secretion after co-culture of CAR-T cells with Jurkat cells; FIG. 6D is a statistical plot of IFN- γ secretion after CAR-T cells co-cultured with Jurkat cells.

After co-culture of CAR-T cells with Jurkat cells, CAR-T cells targeting CCR8 (C1928z T cells and C1028z T cells) displayed up-regulated activation markers and secreted abundant cytokines (granzyme B and IFN- γ) that were critical to T cell immunity. CAR-T cells targeting CCR8 also exert increasingly more cytotoxic effects from low to high E: T ratios.

(3) CAR-T cell anti-tumor activity in vivo:

on day one, 8 weeks old NSI mice of the same sex were harvested and 100. mu.L of Jurkat cell suspension (8X 10) was aspirated by an insulin pump ⁵ Cells/mouse), tail vein injection. Live imaging was performed the next day and grouped according to imaging data.

Recovering the frozen CAR-T cells, taking C1928z T cells and C1028z T cells as experimental groups and 1928z-T cells as a control group, counting, and then re-suspending until the density of the CAR-T cells is 5 × 10 ⁷ cells/mL and split into 100. mu.L per tube. I.e. 5X 10 per tube ⁶ And injecting the CAR-T cells into the mice by adopting an intraperitoneal injection mode. Three groups of mice were imaged in vivo weekly and analyzed.

The results of the measurement of antitumor activity are shown in fig. 6E, 6F and 6G. FIG. 6E is a graph showing the result of in vivo imaging of a mouse, FIG. 6F is a statistical graph showing the result of in vivo amplification of Jurkat cells in a mouse, and FIG. 6G is a survival curve of Jurkat mice (mice injected with Jurkat). It can be seen from the figure that the experimental group of CAR-cells was effective in inhibiting the progress of the expansion of Jurkat cells in vivo.

The results of the above experiments indicate that CAR-T cells significantly inhibit the growth of CCR8 positive T cell malignancies both in vitro and in vivo.

In conclusion, the invention firstly proposes that CCR8 is used as a target point of adult T-lymphocyte leukemia, CCR8 is used as a target point of CAR-T for the first time, the target point has good treatment effect, the target point has good killing effect on tumor cells in vitro and in vivo, and a new target point and a new strategy are provided for the treatment of adult T-lymphocyte leukemia. The application provides that CAR-T cells targeting CCR8 show significant anti-tumor effects in ATLL cell models or animal models, and have significant killing properties on cells expressing CCR 8T-ALL.

The applicant declares that the above description is only a specific embodiment of the present invention, but the scope of the present invention is not limited thereto, and it should be understood by those skilled in the art that any changes or substitutions that can be easily conceived by those skilled in the art within the technical scope of the present invention are within the scope and disclosure of the present invention.

Sequence listing

<110> Shenzhen City internal biomedical science and technology Limited

<120> chimeric antigen receptor T cell targeting CCR8, and preparation method and application thereof

<130> 2022

<160> 6

<170> PatentIn version 3.3

<210> 1

<211> 252

<212> PRT

<213> Artificial sequence

<400> 1

Glu Ile Val Met Thr Gln Ser Pro Ala Thr Leu Ser Val Ser Pro Gly

1 5 10 15

Glu Arg Ala Thr Leu Ser Cys Arg Ser Ser Lys Ser Leu Leu His Ser

20 25 30

Asn Gly Asn Thr Tyr Leu Tyr Trp Tyr Gln Gln Lys Pro Gly Gln Ala

35 40 45

Pro Arg Leu Leu Ile Tyr Arg Val Ser Asn Leu Ala Ser Gly Ile Pro

50 55 60

Ala Arg Phe Ser Gly Ser Gly Ser Gly Thr Glu Phe Thr Leu Thr Ile

65 70 75 80

Ser Ser Leu Gln Ser Glu Asp Phe Ala Val Tyr Tyr Cys Met Gln His

85 90 95

Leu Glu Tyr Pro Phe Thr Phe Gly Gln Gly Thr Lys Leu Glu Ile Lys

100 105 110

Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly

115 120 125

Ser Glu Val Gln Leu Val Glu Ser Gly Gly Ala Leu Val Lys Pro Gly

130 135 140

Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Thr

145 150 155 160

Tyr Ala Met Tyr Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp

165 170 175

Val Gly Arg Ile Arg Ser Lys Ser Asn Asn Tyr Ala Thr Tyr Tyr Ala

180 185 190

Asp Ser Val Lys Asp Arg Phe Thr Ile Ser Arg Asp Asp Ser Lys Asn

195 200 205

Thr Leu Tyr Leu Gln Met Asn Ser Leu Lys Thr Glu Asp Thr Ala Val

210 215 220

Tyr Tyr Cys Thr Arg Gly Gly Tyr Gly Asn Tyr Arg Tyr Ala Met Asp

225 230 235 240

Tyr Trp Gly Gln Gly Thr Thr Val Thr Val Ser Ser

245 250

<210> 2

<211> 256

<212> PRT

<213> Artificial sequence

<400> 2

Asp Ile Val Met Thr Gln Ser Pro Asp Ser Leu Ala Val Ser Leu Gly

1 5 10 15

Glu Arg Ala Thr Ile Asn Cys Arg Ser Ser Lys Ser Leu Leu His Ser

20 25 30

Asn Gly Asn Thr Tyr Leu Tyr Trp Tyr Gln Gln Lys Pro Gly Gln Pro

35 40 45

Pro Lys Leu Leu Ile Tyr Arg Met Ser Asn Leu Ala Ser Gly Val Pro

50 55 60

Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Ile Leu Thr Ile

65 70 75 80

Ser Ser Leu Gln Ala Glu Asp Val Ala Val Tyr Tyr Cys Met Gln His

85 90 95

Leu Glu Tyr Pro Leu Thr Phe Gly Gln Gly Thr Lys Leu Glu Ile Lys

100 105 110

Arg Thr Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly

115 120 125

Gly Gly Ser Glu Val Gln Leu Val Glu Ser Gly Gly Ala Leu Val Lys

130 135 140

Pro Gly Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe

145 150 155 160

Ser Thr Tyr Ala Leu Tyr Trp Val Arg Gln Ala Pro Gly Lys Gly Leu

165 170 175

Glu Trp Val Gly Arg Ile Arg Ser Lys Ser Asn Asn Tyr Ala Thr Tyr

180 185 190

Tyr Ala Asp Ser Val Lys Asp Arg Phe Thr Ile Ser Arg Asp Asp Ser

195 200 205

Lys Asn Thr Leu Tyr Leu Gln Met Asn Ser Leu Lys Thr Glu Asp Thr

210 215 220

Ala Val Tyr Tyr Cys Thr Arg Ala Arg Phe Tyr Tyr Ser Asp Tyr Gly

225 230 235 240

Tyr Ala Met Asp Tyr Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser

245 250 255

<210> 3

<211> 654

<212> PRT

<213> Artificial sequence

<400> 3

Met Leu Leu Leu Val Thr Ser Leu Leu Leu Cys Glu Leu Pro His Pro

1 5 10 15

Ala Phe Leu Leu Ile Pro Glu Ile Val Met Thr Gln Ser Pro Ala Thr

20 25 30

Leu Ser Val Ser Pro Gly Glu Arg Ala Thr Leu Ser Cys Arg Ser Ser

35 40 45

Lys Ser Leu Leu His Ser Asn Gly Asn Thr Tyr Leu Tyr Trp Tyr Gln

50 55 60

Gln Lys Pro Gly Gln Ala Pro Arg Leu Leu Ile Tyr Arg Val Ser Asn

65 70 75 80

Leu Ala Ser Gly Ile Pro Ala Arg Phe Ser Gly Ser Gly Ser Gly Thr

85 90 95

Glu Phe Thr Leu Thr Ile Ser Ser Leu Gln Ser Glu Asp Phe Ala Val

100 105 110

Tyr Tyr Cys Met Gln His Leu Glu Tyr Pro Phe Thr Phe Gly Gln Gly

115 120 125

Thr Lys Leu Glu Ile Lys Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly

130 135 140

Gly Ser Gly Gly Gly Gly Ser Glu Val Gln Leu Val Glu Ser Gly Gly

145 150 155 160

Ala Leu Val Lys Pro Gly Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser

165 170 175

Gly Phe Thr Phe Ser Thr Tyr Ala Met Tyr Trp Val Arg Gln Ala Pro

180 185 190

Gly Lys Gly Leu Glu Trp Val Gly Arg Ile Arg Ser Lys Ser Asn Asn

195 200 205

Tyr Ala Thr Tyr Tyr Ala Asp Ser Val Lys Asp Arg Phe Thr Ile Ser

210 215 220

Arg Asp Asp Ser Lys Asn Thr Leu Tyr Leu Gln Met Asn Ser Leu Lys

225 230 235 240

Thr Glu Asp Thr Ala Val Tyr Tyr Cys Thr Arg Gly Gly Tyr Gly Asn

245 250 255

Tyr Arg Tyr Ala Met Asp Tyr Trp Gly Gln Gly Thr Thr Val Thr Val

260 265 270

Ser Ser Thr Arg Ile Glu Val Met Tyr Pro Pro Pro Tyr Leu Asp Asn

275 280 285

Glu Lys Ser Asn Gly Thr Ile Ile His Val Lys Gly Lys His Leu Cys

290 295 300

Pro Ser Pro Leu Phe Pro Gly Pro Ser Lys Pro Phe Trp Val Leu Val

305 310 315 320

Val Val Gly Gly Val Leu Ala Cys Tyr Ser Leu Leu Val Thr Val Ala

325 330 335

Phe Ile Ile Phe Trp Val Arg Ser Lys Arg Ser Arg Leu Leu His Ser

340 345 350

Asp Tyr Met Asn Met Thr Pro Arg Arg Pro Gly Pro Thr Arg Lys His

355 360 365

Tyr Gln Pro Tyr Ala Pro Pro Arg Asp Phe Ala Ala Tyr Arg Ser Arg

370 375 380

Val Lys Phe Ser Arg Ser Ala Asp Ala Pro Ala Tyr Gln Gln Gly Gln

385 390 395 400

Asn Gln Leu Tyr Asn Glu Leu Asn Leu Gly Arg Arg Glu Glu Tyr Asp

405 410 415

Val Leu Asp Lys Arg Arg Gly Arg Asp Pro Glu Met Gly Gly Lys Pro

420 425 430

Arg Arg Lys Asn Pro Gln Glu Gly Leu Tyr Asn Glu Leu Gln Lys Asp

435 440 445

Lys Met Ala Glu Ala Tyr Ser Glu Ile Gly Met Lys Gly Glu Arg Arg

450 455 460

Arg Gly Lys Gly His Asp Gly Leu Tyr Gln Gly Leu Ser Thr Ala Thr

465 470 475 480

Lys Asp Thr Tyr Asp Ala Leu His Met Gln Ala Leu Pro Pro Arg Gln

485 490 495

Ala Lys Arg Lys Pro Arg Lys Ala Pro Ser Arg Asn Ile Cys Tyr Asp

500 505 510

Ala Phe Val Ser Tyr Ser Glu Arg Asp Ala Tyr Trp Val Glu Asn Leu

515 520 525

Met Val Gln Glu Leu Glu Asn Phe Asn Pro Pro Phe Lys Leu Cys Leu

530 535 540

His Lys Arg Asp Phe Ile Pro Gly Lys Trp Ile Ile Asp Asn Ile Ile

545 550 555 560

Asp Ser Ile Glu Lys Ser His Lys Thr Val Phe Val Leu Ser Glu Asn

565 570 575

Phe Val Lys Ser Glu Trp Cys Lys Tyr Glu Leu Asp Phe Ser His Phe

580 585 590

Arg Leu Phe Asp Glu Asn Asn Asp Ala Ala Ile Leu Ile Leu Leu Glu

595 600 605

Pro Ile Glu Lys Lys Ala Ile Pro Gln Arg Phe Cys Lys Leu Arg Lys

610 615 620

Ile Met Asn Thr Lys Thr Tyr Leu Glu Trp Pro Met Asp Glu Ala Gln

625 630 635 640

Arg Glu Gly Phe Trp Val Asn Leu Arg Ala Ala Ile Lys Ser

645 650

<210> 4

<211> 658

<212> PRT

<213> Artificial sequence

<400> 4

Met Leu Leu Leu Val Thr Ser Leu Leu Leu Cys Glu Leu Pro His Pro

1 5 10 15

Ala Phe Leu Leu Ile Pro Asp Ile Val Met Thr Gln Ser Pro Asp Ser

20 25 30

Leu Ala Val Ser Leu Gly Glu Arg Ala Thr Ile Asn Cys Arg Ser Ser

35 40 45

Lys Ser Leu Leu His Ser Asn Gly Asn Thr Tyr Leu Tyr Trp Tyr Gln

50 55 60

Gln Lys Pro Gly Gln Pro Pro Lys Leu Leu Ile Tyr Arg Met Ser Asn

65 70 75 80

Leu Ala Ser Gly Val Pro Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr

85 90 95

Asp Phe Ile Leu Thr Ile Ser Ser Leu Gln Ala Glu Asp Val Ala Val

100 105 110

Tyr Tyr Cys Met Gln His Leu Glu Tyr Pro Leu Thr Phe Gly Gln Gly

115 120 125

Thr Lys Leu Glu Ile Lys Arg Thr Gly Ser Gly Gly Gly Gly Ser Gly

130 135 140

Gly Gly Gly Ser Gly Gly Gly Gly Ser Glu Val Gln Leu Val Glu Ser

145 150 155 160

Gly Gly Ala Leu Val Lys Pro Gly Gly Ser Leu Arg Leu Ser Cys Ala

165 170 175

Ala Ser Gly Phe Thr Phe Ser Thr Tyr Ala Leu Tyr Trp Val Arg Gln

180 185 190

Ala Pro Gly Lys Gly Leu Glu Trp Val Gly Arg Ile Arg Ser Lys Ser

195 200 205

Asn Asn Tyr Ala Thr Tyr Tyr Ala Asp Ser Val Lys Asp Arg Phe Thr

210 215 220

Ile Ser Arg Asp Asp Ser Lys Asn Thr Leu Tyr Leu Gln Met Asn Ser

225 230 235 240

Leu Lys Thr Glu Asp Thr Ala Val Tyr Tyr Cys Thr Arg Ala Arg Phe

245 250 255

Tyr Tyr Ser Asp Tyr Gly Tyr Ala Met Asp Tyr Trp Gly Gln Gly Thr

260 265 270

Leu Val Thr Val Ser Ser Thr Arg Ile Glu Val Met Tyr Pro Pro Pro

275 280 285

Tyr Leu Asp Asn Glu Lys Ser Asn Gly Thr Ile Ile His Val Lys Gly

290 295 300

Lys His Leu Cys Pro Ser Pro Leu Phe Pro Gly Pro Ser Lys Pro Phe

305 310 315 320

Trp Val Leu Val Val Val Gly Gly Val Leu Ala Cys Tyr Ser Leu Leu

325 330 335

Val Thr Val Ala Phe Ile Ile Phe Trp Val Arg Ser Lys Arg Ser Arg

340 345 350

Leu Leu His Ser Asp Tyr Met Asn Met Thr Pro Arg Arg Pro Gly Pro

355 360 365

Thr Arg Lys His Tyr Gln Pro Tyr Ala Pro Pro Arg Asp Phe Ala Ala

370 375 380

Tyr Arg Ser Arg Val Lys Phe Ser Arg Ser Ala Asp Ala Pro Ala Tyr

385 390 395 400

Gln Gln Gly Gln Asn Gln Leu Tyr Asn Glu Leu Asn Leu Gly Arg Arg

405 410 415

Glu Glu Tyr Asp Val Leu Asp Lys Arg Arg Gly Arg Asp Pro Glu Met

420 425 430

Gly Gly Lys Pro Arg Arg Lys Asn Pro Gln Glu Gly Leu Tyr Asn Glu

435 440 445

Leu Gln Lys Asp Lys Met Ala Glu Ala Tyr Ser Glu Ile Gly Met Lys

450 455 460

Gly Glu Arg Arg Arg Gly Lys Gly His Asp Gly Leu Tyr Gln Gly Leu

465 470 475 480

Ser Thr Ala Thr Lys Asp Thr Tyr Asp Ala Leu His Met Gln Ala Leu

485 490 495

Pro Pro Arg Gln Ala Lys Arg Lys Pro Arg Lys Ala Pro Ser Arg Asn

500 505 510

Ile Cys Tyr Asp Ala Phe Val Ser Tyr Ser Glu Arg Asp Ala Tyr Trp

515 520 525

Val Glu Asn Leu Met Val Gln Glu Leu Glu Asn Phe Asn Pro Pro Phe

530 535 540

Lys Leu Cys Leu His Lys Arg Asp Phe Ile Pro Gly Lys Trp Ile Ile

545 550 555 560

Asp Asn Ile Ile Asp Ser Ile Glu Lys Ser His Lys Thr Val Phe Val

565 570 575

Leu Ser Glu Asn Phe Val Lys Ser Glu Trp Cys Lys Tyr Glu Leu Asp

580 585 590

Phe Ser His Phe Arg Leu Phe Asp Glu Asn Asn Asp Ala Ala Ile Leu

595 600 605

Ile Leu Leu Glu Pro Ile Glu Lys Lys Ala Ile Pro Gln Arg Phe Cys

610 615 620

Lys Leu Arg Lys Ile Met Asn Thr Lys Thr Tyr Leu Glu Trp Pro Met

625 630 635 640

Asp Glu Ala Gln Arg Glu Gly Phe Trp Val Asn Leu Arg Ala Ala Ile

645 650 655

Lys Ser

<210> 5

<211> 1962

<212> DNA

<213> Artificial sequence

<400> 5

atgcttctcc tggtgacaag ccttctgctc tgtgagttac cacacccagc attcctcctg 60

atcccagaga tcgtgatgac acagagcccc gccacactga gcgtgagccc cggcgagcgg 120

gccaccctga gctgccggag cagcaagagc ctgctgcaca gcaacgggaa cacctacctg 180

tactggtacc agcagaagcc cggccaggcc cccaggctgc tgatctacag ggtgagcaac 240

ctggccagcg gcatccccgc ccggttcagc gggagcggga gcggcaccga gttcacactg 300

accatcagca gcctgcagag cgaggatttc gccgtgtact actgcatgca gcacctggag 360

taccccttca cattcgggca ggggacaaag ctggagatca agggatccgg tggcggtggc 420

agcggcggtg gtggttccgg aggcggcggt tctgaagtgc agctggtgga gagcgggggg 480

gccctggtga agcccggcgg cagcctgagg ctgagctgcg ccgccagcgg gttcaccttc 540

tccacctacg ccatgtactg ggtgaggcag gcccccggca aggggctgga gtgggtgggg 600

cggattagga gcaagagcaa caactacgcc acatactacg ccgatagcgt gaaggatagg 660

ttcaccatca gccgggacga tagcaagaac acactgtacc tgcagatgaa cagcctcaag 720

accgaggaca ccgccgtgta ctactgcaca aggggcggct acggcaacta ccggtacgcc 780

atggactact gggggcaggg gacaacagtg acagtgagca gcacgcgtat tgaagttatg 840

tatcctcctc cttacctaga caatgagaag agcaatggaa ccattatcca tgtgaaaggg 900

aaacaccttt gtccaagtcc cctatttccc ggaccttcta agcccttttg ggtgctggtg 960

gtggttgggg gagtcctggc ttgctatagc ttgctagtaa cagtggcctt tattattttc 1020

tgggtgagga gtaagaggag caggctcctg cacagtgact acatgaacat gactccccgc 1080

cgccccgggc ccacccgcaa gcattaccag ccctatgccc caccacgcga cttcgcagcc 1140

tatcgctcca gagtgaagtt cagcaggagc gcagacgccc ccgcgtacca gcagggccag 1200

aaccagctct ataacgagct caatctagga cgaagagagg agtacgatgt tttggacaag 1260

agacgtggcc gggaccctga gatgggggga aagccgagaa ggaagaaccc tcaggaaggc 1320

ctgtacaatg aactgcagaa agataagatg gcggaggcct acagtgagat tgggatgaaa 1380

ggcgagcgcc ggaggggcaa ggggcacgat ggcctttacc agggtctcag tacagccacc 1440

aaggacacct acgacgccct tcacatgcag gccctgcccc ctcgccaggc caaaaggaag 1500

cccaggaaag ctcccagcag gaacatctgc tatgatgcat ttgtttctta cagtgagcgg 1560

gatgcctact gggtggagaa ccttatggtc caggagctgg agaacttcaa tccccccttc 1620

aagttgtgtc ttcataagcg ggacttcatt cctggcaagt ggatcattga caatatcatt 1680

gactccattg aaaagagcca caaaactgtc tttgtgcttt ctgaaaactt tgtgaagagt 1740

gagtggtgca agtatgaact ggacttctcc catttccgtc tttttgatga gaacaatgat 1800

gctgccattc tcattcttct ggagcccatt gagaaaaaag ccattcccca gcgcttctgc 1860

aagctgcgga agataatgaa caccaagacc tacctggagt ggcccatgga cgaggctcag 1920

cgggaaggat tttgggtaaa tctgagagct gcgataaagt cc 1962

<210> 6

<211> 1974

<212> DNA

<213> Artificial sequence

<400> 6

atgcttctcc tggtgacaag ccttctgctc tgtgagttac cacacccagc attcctcctg 60

atcccagata tcgtgatgac acagagcccc gatagcctgg ccgtgagcct gggcgagcgg 120

gccacaatca actgcaggag cagcaagagc ctgctgcaca gcaacgggaa cacatacctg 180

tactggtacc agcagaagcc cggccagccc cccaagctgc tgatctaccg gatgagcaac 240

ctggcctccg gggtgcccga taggttcagc gggagcggga gcgggaccga cttcatcctg 300

accatcagca gcctgcaggc cgaggacgtg gccgtgtact actgcatgca gcacctggag 360

taccccctga ccttcggcca gggcacaaag ctggagatca agaggacagg atccggtggc 420

ggtggcagcg gcggtggtgg ttccggaggc ggcggttctg aggtgcagct ggtggagagc 480

ggcggcgccc tggtgaagcc cggcgggagc ctgaggctga gctgcgccgc cagcgggttc 540

accttcagca catacgccct gtactgggtg aggcaggccc ccggcaaggg cctggagtgg 600

gtggggcgga tcaggagcaa gagcaacaac tacgccacct actacgccga tagcgtgaag 660

gataggttca caatcagccg ggatgatagc aagaacacac tgtacctgca gatgaacagc 720

ctcaagaccg aggacaccgc cgtgtactac tgcacaaggg cccggttcta ctacagcgac 780

tacgggtacg ccatggacta ctgggggcag ggcacactgg tgacagtgag cagcacgcgt 840

attgaagtta tgtatcctcc tccttaccta gacaatgaga agagcaatgg aaccattatc 900

catgtgaaag ggaaacacct ttgtccaagt cccctatttc ccggaccttc taagcccttt 960

tgggtgctgg tggtggttgg gggagtcctg gcttgctata gcttgctagt aacagtggcc 1020

tttattattt tctgggtgag gagtaagagg agcaggctcc tgcacagtga ctacatgaac 1080

atgactcccc gccgccccgg gcccacccgc aagcattacc agccctatgc cccaccacgc 1140

gacttcgcag cctatcgctc cagagtgaag ttcagcagga gcgcagacgc ccccgcgtac 1200

cagcagggcc agaaccagct ctataacgag ctcaatctag gacgaagaga ggagtacgat 1260

gttttggaca agagacgtgg ccgggaccct gagatggggg gaaagccgag aaggaagaac 1320

cctcaggaag gcctgtacaa tgaactgcag aaagataaga tggcggaggc ctacagtgag 1380

attgggatga aaggcgagcg ccggaggggc aaggggcacg atggccttta ccagggtctc 1440

agtacagcca ccaaggacac ctacgacgcc cttcacatgc aggccctgcc ccctcgccag 1500

gccaaaagga agcccaggaa agctcccagc aggaacatct gctatgatgc atttgtttct 1560

tacagtgagc gggatgccta ctgggtggag aaccttatgg tccaggagct ggagaacttc 1620

aatcccccct tcaagttgtg tcttcataag cgggacttca ttcctggcaa gtggatcatt 1680

gacaatatca ttgactccat tgaaaagagc cacaaaactg tctttgtgct ttctgaaaac 1740

tttgtgaaga gtgagtggtg caagtatgaa ctggacttct cccatttccg tctttttgat 1800

gagaacaatg atgctgccat tctcattctt ctggagccca ttgagaaaaa agccattccc 1860

cagcgcttct gcaagctgcg gaagataatg aacaccaaga cctacctgga gtggcccatg 1920

gacgaggctc agcgggaagg attttgggta aatctgagag ctgcgataaa gtcc 1974

Claims

1. A chimeric antigen receptor that specifically binds CCR 8;

2. The chimeric antigen receptor according to claim 1, wherein the transmembrane domain comprises CD28 TM;

3. The chimeric antigen receptor according to claim 1 or 2, characterized in that it consists of a signal peptide, an anti-CCR8 single chain antibody, CD28TM, CD28, CD3 ζ and TLR2 in sequential tandem;

4. A nucleic acid molecule encoding the chimeric antigen receptor of any one of claims 1-3;

5. An expression vector comprising at least one copy of the nucleic acid molecule of claim 4;

preferably, the expression vector comprises a viral vector;

6. A recombinant lentivirus prepared by cotransfecting a viral packaging cell with the expression vector of claim 5 and a packaging plasmid.

7. A chimeric antigen receptor T cell targeting CCR8, wherein the chimeric antigen receptor T cell targeting CCR8 expresses the chimeric antigen receptor of any one of claims 1-3.

8. A method for preparing a chimeric antigen receptor T cell targeting CCR8 according to claim 7, wherein the method comprises the following steps:

(1) constructing an expression vector encoding a chimeric antigen receptor;

9. A pharmaceutical composition comprising the chimeric antigen receptor T cell targeting CCR8 of claim 7;

10. Use of a chimeric antigen receptor T cell targeting CCR8 according to claim 7 and/or a pharmaceutical composition according to claim 9 for the preparation of a medicament for the treatment of tumors;

preferably, the tumor comprises a CCR8 positive tumor;

preferably, the CCR8 positive tumor comprises a T lymphocyte leukemia.