CN114315977B - Use of co-cultured CIK cells and TABP-EIC-WTN cells in combination for the treatment of prostate cancer - Google Patents

Abstract

The invention discloses an application of co-cultured CIK cells and TABP-EIC-WTN cells in treating prostate cancer, wherein the TABP-EIC-WTN cells are tumor antigen binding peptide-engineering immune cells obtained by taking one or more WTN polypeptides obtained by screening the invention as antigen recognition areas through linker tandem connection, and experiments prove that the co-cultured CIK cells and the TABP-EIC-WTN cells have better treatment effect on the prostate cancer.

Description

Use of co-cultured CIK cells and TABP-EIC-WTN cells in combination for the treatment of prostate cancer

Technical Field

The invention belongs to the technical field of biomedicine, and particularly relates to an application of co-cultured CIK cells and TABP-EIC-WTN cells in combination for treating prostate cancer.

Background

At present, tumors become the second leading cause of cardiovascular disease worldwide, and the number of patients is increasing year by year. Current methods of tumor treatment mainly include surgery, radiotherapy, chemotherapy, targeted drug therapy, etc., but these traditional methods of tumor treatment have certain limitations. Unlike traditional tumor treatment methods, tumor immunotherapy does not directly act on lesions, but rather combat tumors by modulating the immune defence mechanisms of the human body. In recent years, new targets and new technologies of tumor immunotherapy are emerging to reflect the unlimited potential of tumor immunotherapy, which is a therapeutic method for controlling and killing tumors by enhancing the immune system of an organism. With the continuous development and application of tumor immunotherapy means and clinical treatment, it has gradually become the "fourth largest" tumor treatment method following surgery, radiation therapy and chemotherapy. Compared with the traditional treatment method, the tumor immunotherapy has the advantages of small side effect, strong specificity, broad tumor killing spectrum, low recurrence rate and the like.

Tumor immunotherapy is mainly divided into three major categories, namely active immunotherapy, passive immunotherapy and adoptive immunotherapy, wherein active immunotherapy refers to a method of inputting an antigenic vaccine into an organism and stimulating the immune system of the organism to generate anti-tumor immunity so as to treat tumors; passive immunotherapy refers to a tumor immunotherapy approach that exerts an antitumor effect by injecting exogenous immune substances into the body, causing immune responses by these exogenous substances, inhibiting signaling pathways, and delivering drugs to lesions; adoptive immunotherapy is a therapeutic approach in which donor lymphocytes are transplanted into recipients to enhance recipient immune function. Adoptive immunotherapy is divided into two categories, specific and non-specific. One of the tumor immunotherapeutic approaches currently being developed and most promising is Chimeric Antigen Receptor (CAR), an antigen-specific receptor that has been engineered to target specific antigens. This targeting specificity can lead to cytotoxicity against tumor cells, killing tumor cells, and the most rapidly studied tumor immunotherapy currently is CAR-NK and CAR-T therapy.

Cytokine-induced KILLER CELLS (CIK), also known as Cytokine-activated killer cells, is a group of T cell-Natural Killer (NK) -like phenotyped, adaptive immune cell mixtures. Clinically, a doctor can induce the peripheral blood mononuclear cells or umbilical cord blood mononuclear cells to form killer cells by injecting cytokines such as interferon-gamma, anti-CD 3 monoclonal antibodies, recombinant human interleukin 1 groups and human interleukin 2 groups and the like. Typically, immune cells release cytokines by recognizing Major Histocompatibility Complexes (MHC) presented on the surface of infected cells, triggering cell lysis or apoptosis. However, CIK cells have a killing effect that is not restricted by MHC molecules, are able to recognize infected cells or even malignant cells that fail to present antigen or MHC, and produce a rapid and accurate immune response. These abnormal cells that fail to present MHC are not recognized and cleared by T cells, a feature that makes CIK cells one of the potential therapeutic approaches to the treatment of cancer and viral infections.

Currently, the technical problems mainly faced in the art include: although tumor immunotherapy has been advanced to some extent, there are still problems such as low effective rate; chimeric antigen receptor immune cell therapies rely on specific tumor-associated antigens to define tumor types, and if the tumor-associated antigens of the tumors are not defined or identified, single-chain antibody sequences which are specifically recognized in a related manner cannot be prepared based on the tumor-associated antigens, and then specific CARs capable of effectively recognizing tumor cells and CAR-T or CAR-NK cells which specifically recognize and kill the tumor cells cannot be constructed; the preparation period of the antibody is long, and the specific binding efficiency is generally low. In view of this, the present invention aims at combining co-cultured CIK cells and tab-EIC-WTN cells in the treatment of prostate cancer, and it has been demonstrated that the combination of both co-cultured CIK cells and tab-EIC-WTN cells enhances the killing effect on prostate cancer cells.

Disclosure of Invention

In order to solve the technical problems in the prior art, the invention aims to provide the application of the co-cultured CIK cells and the TABP-EIC-WTN cells in the treatment of the prostate cancer, the invention firstly proposes to apply the co-cultured CIK cells and the TABP-EIC-WTN cells in the treatment of the prostate cancer, and the combination can enhance the killing effect on the prostate cancer cells through experiments.

The above object of the present invention is achieved by the following technical solutions:

in a first aspect, the present invention provides a pharmaceutical composition for treating cancer;

preferably, the cancer comprises cervical cancer, seminoma, testicular lymphoma, prostate cancer, ovarian cancer, lung cancer, rectal cancer, breast cancer, cutaneous squamous cell carcinoma, colon cancer, liver cancer, pancreatic cancer, stomach cancer, esophageal cancer, thyroid cancer, transitional epithelium cancer of the bladder, leukemia, brain tumor, stomach cancer, peritoneal cancer, head and neck cancer, endometrial cancer, kidney cancer, female genital tract cancer, carcinoma in situ, neurofibroma, bone cancer, skin cancer, gastrointestinal stromal tumor, mast cell tumor, multiple myeloma, melanoma, glioma; more preferably, the cancer is prostate cancer.

Further, the pharmaceutical composition comprises co-cultured CIK cells and tumor antigen binding peptide-engineered immune cells.

Further, the tumor antigen binding peptide in the tumor antigen binding peptide-engineered immune cell is constituted by WTN polypeptide region-hinge region-transmembrane domain-co-stimulatory domain-primary signaling domain;

Preferably, the WTN polypeptide region comprises a plurality of WTN polypeptides and a linker between the plurality of WTN polypeptides; more preferably, the WTN polypeptide is a polypeptide that specifically binds PSMA; most preferably, the WTN polypeptide is selected from any one of the following groups:

(1) A polypeptide as shown in SEQ ID NO. 1;

(2) A substance having substitution, deletion or addition of one or more amino acids as compared with the polypeptide shown in SEQ ID NO. 1;

(3) A polypeptide having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% identity to the amino acid sequence of the polypeptide as set forth in SEQ ID No. 1;

Most preferably, the WTN polypeptide is a polypeptide as set forth in SEQ ID NO. 1; most preferably, the nucleotide sequence of the WTN polypeptide is shown in SEQ ID NO. 2.

Further, the hinge region of the tumor antigen binding peptide is a CD 8a hinge region; preferably, the amino acid sequence of the CD8 alpha hinge region is shown in SEQ ID NO. 3; more preferably, the nucleotide sequence of the CD8 alpha hinge region is shown in SEQ ID NO. 4; preferably, the transmembrane domain is a 2B4 transmembrane domain; more preferably, the amino acid sequence of the 2B4 transmembrane domain is shown in SEQ ID NO. 5; most preferably, the nucleotide sequence of the 2B4 transmembrane domain is shown in SEQ ID NO. 6; preferably, the co-stimulatory domain is a 2B4 co-stimulatory domain; more preferably, the amino acid sequence of the 2B4 co-stimulatory domain is set forth in SEQ ID NO. 7; most preferably, the nucleotide sequence of the 2B4 co-stimulatory domain is set forth in SEQ ID NO. 8; preferably, the primary signaling domain is a NKG2D primary signaling domain; more preferably, the amino acid sequence of the NKG2D primary-signaling domain is shown as SEQ ID NO. 9; most preferably, the nucleotide sequence of the NKG2D primary-signaling domain is shown as SEQ ID NO. 10; most preferably, the tumor antigen binding peptide consists of WTN polypeptide region-CD 8a hinge region-2B 4 transmembrane domain-2B 4 co-stimulatory domain-NKG 2D primary signaling domain;

Most preferably, the amino acid sequence of the tumor antigen binding peptide is shown as SEQ ID NO. 11; most preferably, the nucleotide sequence of the tumor antigen binding peptide is shown in SEQ ID NO. 12.

Further, the tumor antigen binding peptide-engineered immune cells include tumor antigen binding peptide-engineered NK cells, tumor antigen binding peptide-engineered T cells, tumor antigen binding peptide-engineered B cells, tumor antigen binding peptide-engineered macrophages; preferably, the tumor antigen binding peptide-engineered immune cell is a tumor antigen binding peptide-engineered NK cell.

In a specific embodiment of the present invention, the tumor antigen binding peptide-engineered immune cell is a TABP-EIC-WTN cell, wherein, the TABP-EIC (Tumor Antigen Binding Peptide-ENGINEERING IMMUNE CELL) refers to a tumor antigen binding peptide-engineered immune cell, and the tumor antigen binding peptide-engineered immune cell is one or more of the WTN polypeptides obtained by screening the present invention, which are obtained by linking in series as antigen recognition regions, wherein, the WTN polypeptide is a novel polypeptide obtained by screening a phage-polypeptide library, which can specifically bind to tumor cells (prostate cancer cells) and has high binding efficiency.

Further, the co-cultured CIK cells are DC-CIK cells co-cultured with the prostate cancer cells; preferably, the co-cultured CIK cells comprise cd8+ T cells.

In a specific embodiment of the invention, the DC cells are dendritic cells (DENDRITIC CELLS, DC), the CIK cells are Cytokine-induced KILLER CELLS (CIK), also known as Cytokine-activated killer cells, and are a group of T cell-Natural Killer (NK) -like phenotype adapted immune cell mixtures.

In a specific embodiment of the invention, the DC-CIK cell refers to a dendritic cell-Cytokine induced killer cell (DENDRITIC CELLS-Cytokine-induced KILLER CELLS, DC-CIK), wherein the DC cell is a professional antigen presenting cell with the strongest human body function, which is discovered at present, can effectively recognize, ingest and process antigens, activate an acquired immune system, promote the high expression of organism MHC molecules, costimulatory molecules and adhesion molecules, and play an important role in resisting tumor, infection and transplantation immunity; CIK cells are heterogeneous cell groups, and can play a role in killing cells of high-efficiency tumors through self cytotoxicity and secretion of cytokines.

In a specific embodiment of the present invention, the present invention demonstrates that the cd8+ T cells are mainly used in the co-cultured CIK cells according to the present invention, and therefore, the use of the cd8+ T cells and the tumor antigen binding peptide-engineered immune cells in combination for preparing a pharmaceutical composition for treating prostate cancer, and a pharmaceutical composition comprising the cd8+ T cells and the tumor antigen binding peptide-engineered immune cells are also included in the scope of the present invention, and therefore, the co-cultured CIK cells and the tumor antigen binding peptide-engineered immune cells in combination according to the present invention include the following combinations:

(1) Co-culturing CIK cells, tumor antigen binding peptide-engineered immune cells;

(2) Cd8+ T cells, tumor antigen binding peptide-engineered immune cells.

In a second aspect, the invention provides the use of a co-cultured CIK cell in combination with a tumor antigen binding peptide-engineered immune cell in the manufacture of a medicament for the treatment of cancer; preferably, the cancer is prostate cancer.

Further, the tumor antigen binding peptide-engineered immune cell is the tumor antigen binding peptide-engineered immune cell of the first aspect of the invention, and the co-cultured CIK cell is the co-cultured CIK cell of the first aspect of the invention.

In a third aspect, the invention provides a method of preparing co-cultured CIK cells.

Further, the method comprises the following steps:

(1) Culturing DC cells;

(2) Culturing CIK cells;

(3) Mixing the DC cells obtained by culturing in the step (1) and the CIK cells obtained by culturing in the step (2) in a culture medium, adding the prostate cancer cells for co-culturing, and collecting the suspended DC-CIK mixture to obtain the co-cultured CIK cells.

Further, the step (1) includes the steps of:

(a) On day 0, PBMC cells were cultured in DC cell growth medium;

(b) Day 3, the DC cell growth medium was changed;

(c) On day 6, adding DC cell maturation factors to the DC cell growth medium;

(d) On day 8, cells were collected to obtain DC cells;

preferably, the substance added to the DC cell growth medium in step (a) comprises FBS, DC cell culture factor;

More preferably, the substance added to the DC cell growth medium in step (a) comprises 5% FBS, 2U/mL DC cell culture factor;

preferably, the final concentration of DC maturation factor in step (c) is 2U/mL.

Further, the step (2) includes the steps of:

(a) On day 0, PBL cells were cultured in CIK cell activation medium;

(b) Day 3,4, 6, cell cultures were supplemented with CIK cell proliferation medium;

(c) On day 8, collecting cells to obtain CIK cells;

Preferably, the substances added to the CIK cell activation medium in step (a) comprise KBM551, FBS, anti-CD 3 antibodies, IFN-gamma, IL-1 alpha, IL-2;

more preferably, the substances added to the CIK cell activation medium in step (a) comprise KBM551, 3% FBS, 50ng/mL anti-CD 3 antibody, 1000U/mL IFN- γ, 100U/mL IL-1α, 500U/mL IL-2;

Preferably, the PBL cells in step (a) have a cell density of 1.5X10 ⁶/mL;

preferably, the substances added to the CIK cell proliferation medium in step (b) include KBM551, FBS, IL-2;

More preferably, the substances added to the CIK cell proliferation medium in step (b) include KBM551, 3% FBS and 500U/mL IL-2.

Further, the culture medium in the step (3) is CIK cell proliferation culture medium;

preferably, the DC cells have a cell density of 4X 10 ⁷/mL;

Preferably, the CIK cells have a cell density of 1X 10 ⁸/mL;

preferably, the prostate cancer cells have a cell density of 1X 10 ⁷/mL;

preferably, the conditions of the co-culture are 5% CO ₂, 37 ℃, 24 hours;

preferably, the prostate cancer cells include C4-2, LNCaP, PC-3, DU145;

more preferably, the prostate cancer cell is C4-2.

In a fourth aspect, the present invention provides an application of co-cultured CIK cells prepared by the method according to the third aspect of the present invention in preparing a medicament for treating cancer;

Preferably, the cancer is prostate cancer.

In a specific embodiment of the invention, the PBMC cells are peripheral blood mononuclear cells (PERIPHERAL BLOOD MONONUCLEAR CELL, PBMC), which are cells with a single nucleus in peripheral blood, including lymphocytes and monocytes; the PBL cells are peripheral blood lymphocytes (PERIPHERAL BLOOD LYMPHOCYTE, PBL) and consist of T cells and B cells.

In addition, the present invention provides a method of treating a patient with prostate cancer, the method comprising: administering to a subject in need thereof an effective amount of co-cultured CIK cells and TABP-EIC-WTN cells, and/or a pharmaceutical composition according to the first aspect of the invention.

The invention has the advantages and beneficial effects that:

The invention combines the co-cultured CIK cells and the TABP-EIC-WTN cells for the first time in the treatment of the prostate cancer, and the experiment proves that the combination has better treatment effect on the prostate cancer, in addition, the invention overcomes the technical defects existing in the prior art, and has better application prospect in the clinical treatment of the prostate cancer.

Drawings

Embodiments of the present invention are described in detail below with reference to the attached drawing figures, wherein:

FIG. 1 is a graph showing immunofluorescence results of Lncap cell lines with higher expression levels of polypeptide WTN and PSMA;

FIG. 2 is a graph showing immunofluorescence results of PC3 cell lines with low expression levels of polypeptide WTN and PSMA;

FIG. 3 is a graph showing the results of flow assays performed for C4-2 GFP cells co-cultured with TABP-EIC-WTN cells for 2, 6, 12, and 24 hours;

FIG. 4 is a graph showing the results of ELISA for measuring IFN-gamma secretion levels;

FIG. 5 is a graph showing the measurement results of the expression level of PD-L1 on C4-2 cells at different concentrations of IFN-gamma;

FIG. 6 is a graph showing the measurement of the amount of PD-L1 expression on C4-2 cells co-cultured with TABP-EIC-WTN cells for 24 hours;

FIG. 7 is a graph showing the measurement result of the expression level of PD-L1 in TABP-EIC-WTN cells co-cultured with C4-2 cells;

FIG. 8 is a graph showing the measurement result of the expression level of PD-1 in TABP-EIC-WTN cells co-cultured with C4-2 cells;

FIG. 9 is a graph showing the measurement results of the expression level of PD-L1 in TABP-EIC-WTN cells stimulated with IFN-gamma at different concentrations;

FIG. 10 is a flow cytometry graph showing the expression level of PD-L1 on TABP-EIC-WTN cells cultured using a common medium and supernatants obtained after 12 hours of co-culture from TABP-EIC-WTN+C4-2 cells, showing no significant difference in the expression percentage of PD-L1 in the TABP-EIC-WTN cells cultured in both media, and a graph showing the results of the data;

FIG. 11 is a schematic diagram of a cell co-incubation apparatus in which C4-2 cells are seeded at the bottom, TABP-EIC-WTN cells are seeded at the upper region, and the inner and outer spaces are separated by a filter membrane that allows passage of cytokines but prevents direct contact of the TABP-EIC-WTN cells with the C4-2 cells;

FIG. 12 is a flow cytometry plot and a result plot of summary data;

FIG. 13 is a graph showing the results of transcription difference analysis of co-cultured/separately cultured TABP-EIC-WTN/C4-2 cells, panel A: volcanic map of deregulated genes between co-cultivated TABP-EIC-WTN and singly cultivated TABP-EIC-WTN cells, panel B: volcanic map of deregulated genes between co-cultured C4-2 and C4-2 cells cultured alone;

FIG. 14 is a graph of KEGG pathway enrichment analysis results, panel A: up-regulating genes in Co-cultured TABP-EIC-WTN, panel B: down-regulating genes in co-cultured TABP-EIC-WTN, panel C: upregulated genes in co-cultured C4-2 cells;

Fig. 15 is a flow detection result diagram, a diagram: expression level of NKG2D on TABP-EIC-WTN cells, panel B: the amount of MICA/B expressed on C4-2 cells;

FIG. 16 is a Western blot results of proteins involved in the signal pathway of PD-L1 expression, panel A: graph of detection results without NKG2D blocker, panel B: a graph of the detection results when NKG2D blocker was added;

FIG. 17 is a graph showing the results of statistics of the expression amounts of proteins on signal pathways involved in PD-L1 expression, panel A: PD-L1, B diagram: p-PI3K, panel C: p-AKT, D panel: p-mTOR, E plot: p-JAK1, F panel: p-JAK2, G diagram: p-STAT1;

FIG. 18 is a graph of the results of bioluminescence intensity (BLI) measurements of C4-2 GFP cells co-cultured with TABP-EIC-WTN, panel A: detection result diagram, B diagram: counting a result graph;

FIG. 19 is a graph showing the results of the inhibition of tumor cells by TABP-EIC-WTN when atezolizumab or nivolumab is increased, panel A: e: t=1: 1, b diagram: e: t=5: 1, a step of;

FIG. 20 is a graph showing the results of detection of IFN-. Gamma.secretion by TABP-EIC-WTN cells upon addition of Atezolizumab or nivolumab;

Fig. 21 is a flow cytometry graph and summary data results graph, panel a: flow cytometry map, panel B: a graph of statistical results, wherein the graph shows the expression of CD107a induced by C4-2 cells on tab-EIC-WTN cells (upon addition of atezolizumab or nivolumab), tab-EIC-WTN cells and C4-2 cells at 1:1 ratio incubated for 20 hours at 37℃and then TABP-EIC-WTN cells were collected and treated with atezolizumab (20. Mu.g/mL) or nivolumab (20. Mu.g/mL) and then assayed;

FIG. 22 is a graph showing the results of tumor size detection in mice of each group on days 7, 14, and 21;

FIG. 23 is a graph showing the results of tumor suppression with or without co-cultured CIK, panel A: tumor inhibition without co-cultured CIK, panel B: tumor inhibition when co-cultured CIK was added;

FIG. 24 is a tumor cell immunohistochemical staining chart, panel A: staining results, panel B: counting a result graph;

FIG. 25 is a graph showing the statistical results of the statistics of tumor sizes of CIK-treated mice with or without co-culture, respectively, and A graph: co-cultured CIK, panel B: CIK without co-cultivation;

Fig. 26 is a graph of physical images of resected tumors and statistical results of tumor weights, panel a: physical diagram, B diagram: counting results;

FIG. 27 shows the measurement of the expression levels of CD3, CD8 and CD56 in co-cultured CIK, panel A: control, panel B: CD3, C panels: CD8, D plot: CD56, E plot: CD3 CD56, F panel: counting a result graph;

FIG. 28 is a graph showing the results of tumor growth in mice in the control group, CIK treated group and co-cultured CIK treated group, panel A: mouse tumor growth, panel B: statistical analysis of BLI measurements;

FIG. 29 is a graph showing the statistical results of tumor volumes in mice from the control, CIK-treated and co-cultured CIK-treated groups on days 5, 10, and 20;

fig. 30 is a graph of serum testosterone and PSA levels change after ADT exposure of a prostate cancer patient, panel a: serum testosterone, panel B: a PSA;

fig. 31 is a graph of HE staining (100-fold and 200-fold) of tumor tissue from a prostate cancer patient, a graph: 100 times, panel B: 200. doubling;

Fig. 32 is a flow cytometry plot and summary data histogram, panel a: flow cytometry map, panel B: statistical result diagram, C diagram: statistical results, wherein the figure shows the expression of PD-L1 on primary prostate cancer cells incubated with TABP-EIC-WTN cells for 24 hours, (right) CCK-8 assay, showing that atezolizumab (20. Mu.g/mL) rather than nivolumab (20. Mu.g/mL) significantly enhanced the inhibitory effect on TABP-EIC-WTN, E: t=1: 1.

Detailed Description

The invention is further illustrated below in conjunction with specific examples, which are intended to illustrate the invention and are not to be construed as limiting the invention. One of ordinary skill in the art can appreciate that: many changes, modifications, substitutions and variations may be made to the embodiments without departing from the spirit and principles of the invention, the scope of which is defined by the claims and their equivalents. The experimental procedure, in which no specific conditions are noted in the examples below, is generally carried out according to conventional conditions or according to the conditions recommended by the manufacturer.

Example 1 peptide library screening

1. Purpose of experiment

The invention screens out polypeptide WTN specifically binding to PSMA using a Ph.D. -12 phage display peptide library kit.

2. Ph.D. -12 phage display peptide library kit composition

Random dodecapeptide phage display library: 100. Mu.L, 1.5X10 ¹³ pfu/mL, stored in TBS solution containing 50% glycerol, complexity-2.7X10 ⁹ transformants; -28gIII sequencing primer: 5'-HOGTATGGGATTTTGCTAAACAA C-3',100pmol,1 pmol/. Mu.L; -96gIII sequencing primer: 5'-HOCCCTCATAGTTAGCGTAACG-3', 100 pmol/. Mu.L, 1 pmol/. Mu.L; coli ER2738 host strain F' lacIqΔ (lacZ) M15 proA+B+ zzf:: tn10 (TetR)/fhuA 2 supE thi Δ (lac-proAB) Δ (hsdMS-mcrB) 5 (rk-mk-McrBC-): the strain is provided in the form of a cell culture containing 50% glycerol, and non-competent cells are stored at-70 ℃; streptavidin, freeze-dried powder 1.5mg; biotin: 10mM 100. Mu.L.

3. Experimental method

First day

The number and types of target molecules on which the library panning was performed simultaneously, as required, were varied, panning experiments were performed in a single sterilized polystyrene dish, 12 or 24 well plate, 96 well microtiter plate, each target molecule being coated with at least one plate (or one well), the amounts given in the following method were 60 x 15mm dishes, microplates in brackets, and other medium-sized wells adjusted accordingly, but in each case the number of phages added was the same: 1.5X10 ¹¹ virions;

(1) Preparing 100. Mu.g/mL of a target molecule solution (NaHCO ₃ dissolved in 0.1M pH 8.6), and if it is desired to stabilize the target molecule, other buffers of similar ionic strength (containing metal ions, etc.) may be used;

(2) 1.5mL (150 mu L per well) of the above solution was added to each plate (well), and the plate was repeatedly rotated until the surface was completely wet;

(3) Slightly shaking at 4deg.C in a humidifying container (such as sealable plastic box with wet paper towel), incubating overnight, and storing the flat plate at 4deg.C in the container;

The next day

(4) ER2738 monoclonal (plate paved during phage titer determination) is selected and placed in 10mL of LB liquid medium, if eluted phage is amplified on the same day, ER2738 can also be inoculated in 20mL of LB liquid medium, and the phage is subjected to severe shake culture at 37 ℃ by using a 250mL triangular flask;

(5) Pouring out the coating liquid in each plate, inverting the plates, beating and throwing the plates on clean paper towels with force to remove residual solution, filling the sealing liquid in each plate (or hole), and acting at 4 ℃ for at least 1h;

(6) The plate was washed 6 times, each time rotated so that the bottom and edges of the plate or well were washed, the buffer was decanted, and the plate was inverted and whipped over a clean paper towel to remove residual solution (or using an automatic plate washer);

(7) 4X 10 ¹⁰ phage (i.e.10. Mu.L of original library) were diluted with 1mL (microwell plate and 100. Mu.L) TBST buffer and then added to the coated plate and gently shaken at room temperature for 10-60min;

(8) Pouring to remove unbound phage, and inverting the plate to remove residual solution by beating on a clean paper towel;

(9) Washing the plate 10 times with TBST buffer solution according to the method described in 6, and changing a clean paper towel each time to avoid cross contamination;

(10) According to the intermolecular interactions studied, the bound phage is eluted with 1mL (microwell plate then with 100. Mu.L) of a suitable elution buffer, the known ligand of the target molecule is dissolved in TBS solution at a concentration of 0.1-1mM or the bound phage is competitively eluted from the immobilized target molecule with a free target molecule solution (100. Mu.g/mL in TBS), the room temperature is warmed and shaken for 10-60min, and the eluate is pipetted into another clean microcentrifuge tube; bound molecules can also be isolated with a non-specific buffer such as 0.2M Glycine-HCl (pH 2.2), 1mg/mL BSA: gently shaking for >10min, sucking the eluate into another clean microcentrifuge tube, and neutralizing the eluate with 150 μl (15 μl for microperforations) of 1M Tris-HCl (pH 9.1);

(11) Titer of small amounts (. About.1. Mu.L) of eluate was determined by the procedure described in the conventional M13 method, and plaques obtained from the first or second round of titer determination were sequenced, if necessary, as follows: if necessary, the remaining eluate may be stored overnight at 4deg.C, amplified the next day, at which time ER2738 may be cultured overnight in LB-Tet medium, the next day culture 1:100 is diluted in 20mL LB (in 250mL Erlenmeyer flask), unamplified eluate is added, and cultured with vigorous shaking at 37deg.C for 4.5 h, continuing step 13;

(12) Amplifying the remaining eluate: the eluate was added to 20mL ER2738 culture (the cells were in the log phase), and the culture was vigorously shaken at 37℃for 4.5 hours;

(13) The culture was transferred to a centrifuge tube, and then centrifuged at 10,000rpm at 4℃for 10min. Transferring the supernatant into another centrifugal tube, and centrifuging;

(14) Transferring 80% of the upper part of the supernatant into a fresh tube, adding 1/6 volume of PEG/NaCl, and allowing phage to precipitate at 4deg.C for at least 60min overnight;

Third day

(15) Centrifuging PEG precipitation at 4deg.C at 10,000rpm for 15min, removing supernatant, centrifuging briefly, and sucking off residual supernatant;

(16) The sediment is resuspended in 1mL TBS, the suspension is transferred into a microcentrifuge tube, and the residual cells are sedimented by centrifugation for 5min at 4 ℃;

(17) Transferring the supernatant into another fresh microcentrifuge tube, reprecipitating with 1/6 volume of PEG/NaCl, incubating on ice for 15-60min, centrifuging at 4deg.C for 10min, discarding supernatant, centrifuging briefly, and removing residual supernatant with micropipette;

(18) The precipitate was resuspended in 200 μl TBS,0.02% nan ₃, centrifuged for 1min, any residual insoluble material was precipitated, and the supernatant was transferred to fresh tubes, which were the eluate after amplification;

(19) Titrating the amplified eluate with LB/IPTG/Xgal plates according to the conventional M13 method described above, and storing at 4 ℃;

(20) Coating a plate or well in preparation for a second round of panning;

Fourth and fifth day

(21) The number of blue spots on the plate was counted to determine the titer, and this value was used to calculate the amount of addition corresponding to 1-2X 10 ¹¹ pfu; if the titer is too low, the next round of panning can be tested with phage addition as low as 10 ⁹ pfu;

(22) A second round of panning was performed: repeating steps 4-18 with phage amount of 1-2×10 ¹¹ pfu in the eluate of the first round of panning amplification, increasing concentration of Tween to 0.5% (v/v) in the washing step;

(23) Titer after amplification of the eluate from the second round of panning was determined on LB/IPTG/Xgal plates;

(24) Coating a plate or well in preparation for a third round of panning;

Sixth day

(25) A third round of panning was performed: repeating steps 4-11 with a phage amount of 2X 10 ¹¹ pfu in the eluate of the second panning round, again with 0.5% (v/v) Tween in the washing step;

(26) Titer was determined on LB/IPTG/Xgal plates without amplification of the eluate from the third round of panning, and plaques obtained from the titer determination were sequenced without further amplification of the eluate unless the fourth round of panning was performed: as long as the plate culture time is not longer than 18 hours, the culture time is too long and is easy to be lost, and the rest of the eluate is stored at 4 ℃;

(27) One ER2738 clone was selected and cultured overnight in LB-Tet medium.

4. Experimental results

Experimental results show that the amino acid sequence of the polypeptide WTN which specifically binds to PSMA obtained by screening is WTNHHQHSKVRE (SEQ ID NO: 1).

Example 2 WTN verification of polypeptide specificity

1. Experimental method

Immunofluorescence detection is carried out on WTN polypeptide and Lncap cell line with higher PSMA expression level and PC3 cell line with low PSMA expression level respectively, and the adopted fluorescent marker is FITC (namely the WTN polypeptide marked by FITC).

2. Experimental results

Fluorescence detection of WTN polypeptide and Lncap cell line is shown in fig. 1, and fluorescence detection of WTN polypeptide and PC3 cell line is shown in fig. 2; in fig. 1, the center of the dot is the nucleus, and the light color around the dot is the fluorescence exhibited by WTN binding to the cell surface antigen PSMA; in fig. 2, only the cell nuclei were stained, and the cell surface fluorescence marked by WTN only appears in fig. 1, demonstrating that WTN binds to the cell surface antigen PSMA with high specificity.

Example 3 cell lines according to the present invention, methods of culturing and constructing the same

1. Construction method of TABP-EIC-WTN

(1) Preparation of TABP-EIC-WTN cells

The NK cells used in the experiments are obtained by amplifying Peripheral Blood Mononuclear Cells (PBMC).

(2) Construction of tumor antigen binding peptide expression vectors

The tumor antigen binding peptide structure (complete structure is that WTN polypeptide region-CD 8 alpha hinge region-2B 4 transmembrane domain-2B 4 costimulatory domain-NKG 2D primary signal transduction domain, nucleic acid sequence is shown as SEQ ID NO: 12) is obtained by gene synthesis (general organism), and the expression vector is pLenti-EF1 a-backbond (NN) (addgene # 27961). The tumor antigen binding peptide structure was inserted into the cleavage site BsiWI and EcoRI (i.e., the sequence shown in SEQ ID NO:12 replaces the sequence between cleavage sites BsiWI-EcoRI). After the tumor antigen binding peptide structure is inserted, the vector is called a TABP-EIC-WTN skeleton vector, and the vector can express the tumor antigen binding peptide with the amino acid sequence of SEQ ID NO. 11.

(3) Lentivirus package

The TABP-EIC-WTN backbone vector and helper vector pMD2.G (addgen # 12259), pMDLg/pRRE (addgene #12251), pRSV-Rev (addgene #12253) were mixed in a ratio of 10:7:5:3, 20. Mu.g plasmid per 10mL transfection system, and 293T cells were transfected. The supernatant was collected 48 hours and 72 hours after transfection, and lentiviruses were obtained after purification and concentration.

(4) Lentiviral transduction

The concentrated lentivirus and NK cells were mixed at 200. Mu.L per 100 ten thousand cells after purification, and then cultured in a 37℃incubator at 5% CO ₂ for 24 hours, followed by complete liquid exchange.

(5) Expansion of TABP-EIC-WTN cells: TABP-EIC cells obtained after lentiviral infection were amplified in normal culture.

(6) Detection of TABP-EIC-WTN cell tumor antigen binding peptide expression efficiency: (100% positive for monoclonal).

2. Culture method of other cell lines

(1) C4-2 cells: human CRPC cell line expressing PSMA (prostate cancer cell line), C4-2 cells were cultured in RPMI-1640 medium (Servicebio) containing 10% fetal bovine serum FBS (Biological Industries) and 1% penicillin/streptomycin (Hyclone);

For convenience of observation of tumor suppression, a C4-2 cell line stably expressing GFP was established by a single cell cloning method and is hereinafter abbreviated as C4-2 GFP.

(2) NK92 cells: human malignant non-Hodgkin's lymphoma natural killer cell lines, NK92 and TABP-EIC-WTN cells were cultured in recombinant human IL-2 (SL Pharm) and 1% penicillin-streptomycin alpha MEM medium (Gibco) supplemented with 20% FBS, 0.2mM inositol (Sigma), 0.1mM beta-mercaptoethanol (PAN-Biotech), 0.02mM folic acid (Sigma), 200U/mL.

(3) 293T cells: human embryonic kidney cell lines from American type culture Collection ATCC,293T cells were cultured in DMEM medium (Hyclone) or opti-MEM (Gibco);

(4) PCa cells (prostate cancer cells): prostate tissue from a CRPC patient undergoing radical prostatectomy.

The cell culture of the invention is cultivated in a humid environment with 5% CO ₂ at 37 ℃.

EXAMPLE 4 up-regulation of PD-L1 expression on C4-2 cells co-cultured with TABP-EIC-WTN cells was dependent on IFN-gamma

C4-2 GFP cells were co-cultured with TABP-EIC-WTN cells and subjected to flow assays at 2, 6, 12, 24 hours, as shown in FIG. 3: and the detection of PD-L1 expressed by C4-2 cells shows the results in FIG. 3: the average fluorescence intensity (MFI) of PD-L1 from C4-2 cells and the percentage of C4-2 cells expressing PD-L1 increased significantly over time.

TABP-EIC-WTN cells were cultured, and IFN-gamma secretion levels were measured in the culture supernatant at time points of 2, 6, 12, and 24 hours by ELISA in the presence or absence of C4-2 GFP co-culture, and the results are shown in FIG. 4.

IFN-gamma was added to the C4-2 cells, and the amount of expression of PD-L1 on the C4-2 cells at different concentrations of IFN-gamma was shown in FIG. 5: the Mean Fluorescence Intensity (MFI) of PD-L1 and the percentage of C4-2 cells expressing PD-L1 both increased in a concentration-dependent manner.

In the case of using an IFNgamma blocker (IFNgamma monoclonal antibody), the measurement result of the expression amount of PD-L1 on C4-2 cells co-cultured with TABP-EIC-WTN cells for 24 hours is shown in FIG. 6: IFNgamma blockers completely reverse the up-regulation of PD-L1 of C4-2 co-cultured with TABP-EIC-WTN cells.

The above experimental results indicate that the up-regulation of PD-L1 expression on C4-2 cells co-cultured with TABP-EIC-WTN cells is IFN-gamma dependent.

EXAMPLE 5 Up-regulation of PD-L1 expression on TABP-EIC-WTN cells co-cultured with C4-2 cells depends on direct cell contact

The TABP-EIC-WTN cells and the C4-2 cells were co-cultured, and the expression levels of PD-L1 and PD-1 of TABP-EIC-WTN were measured at 2, 6, 12 and 24 hours, and the results are shown in FIG. 7 and FIG. 8, respectively. The results show that: the percentage of PD-L1 or PD-1 positive TABP-EIC-WTN was significantly up-regulated over time.

A flow chart of the expression level of PD-L1 on TABP-EIC-WTN cells stimulated with IFN-gamma at various concentrations is shown in FIG. 9. After IFN-gamma stimulation, the expression level of PD-L1 in the TABP-EIC-WTN cells was not significantly changed.

EXAMPLE 6 analysis of transcriptional Difference of Co-culture/separate culture of TABP-EIC-WTN/C4-2 cells

Total RNA was extracted from the samples using TRIzol (Invitrogen). DNA digestion was performed after RNA extraction by DNaseI. RNA quality was determined by examining A260/A280 using NanodropTM OneC spectrophotometer (Thermo FISHER SCIENTIFIC INC). RNA integrity was confirmed by 1.5% agarose gel electrophoresis. Qualified RNA was finally quantified by Qubit3.0 and QubitTM RNA Broad RANGE ASSAY KIT (Life Technologies).

Using KC-DIGITAL TM STRANDED MRNA Library Prep Kit for(SEQHEALTH TECHNOLOGY co., ltd.) 2 μg total RNA was used for RNA sequencing library preparation. Library products corresponding to 200-500bps were enriched, quantified and finally sequenced on Illumina Novaseq 6000,6000.

Raw sequencing data was first filtered by Trimmomatic (version 0.36), and CLEAN READS was further processed using internal scripts to eliminate repetitive bias introduced in library preparation and sequencing. Briefly, CLEAN READ first performs clustering according to the UMI sequence, where reads with the same UMI sequence are grouped into the same cluster, resulting in 65,536 clusters. Reads in the same cluster were compared to each other by alignment, and reads with sequence identity over 95% were then extracted into new sub-clusters. After generation of the sub-clusters, multiple sequence alignments are performed to obtain a consensus sequence for each sub-cluster. After these steps, any errors and deviations introduced by PCR amplification or sequencing are eliminated.

They were mapped to Homo reference genome data from homo_sapiens.GRCh38 (ftp:// ftp. Ensembl. Org/pub/release-87/fasta/homo_sapiens/dnas /) using STAR software (version 2.5.3a). The reads mapped to the exon regions of each gene were calculated by feature counts (Subread-1.5.1; bioconductor), followed by calculation of RPKM. The edgeR package (version 3.12.1) was used to identify genes that were differentially expressed between groups. The FDR corrected p-value cutoff was 0.05 and fold change cutoff was 2 for statistical significance of gene expression differences.

Both the Gene Ontology (GO) analysis and the KEGG enrichment analysis of the differentially expressed genes were performed by KOBAS software (version: 2.1.1), correcting the P-cut off to 0.05, to determine statistically significant enrichment. By detecting alternative splicing events using rMATS (version 3.2.5), the FDR value cut-off was 0.05 and the Δψ absolute was 0.05.

The volcanic pattern of deregulated genes between co-cultured TABP-EIC-WTN and separately cultured TABP-EIC-WTN cells is shown in FIG. 13A, and the volcanic pattern of deregulated genes between co-cultured C4-2 and separately cultured C4-2 cells is shown in FIG. 13B. In fig. 13, differentially expressed genes with fold change greater than 2.0 and P <0.05 were color-coded. P-values were calculated using a two-sided non-paired student t-test.

The KEGG pathway enrichment analysis for the up-regulated gene in co-culture in fig. 13A is shown in fig. 14A, and the down-regulated gene is shown in fig. 14B. The KEGG pathway enrichment analysis for the upregulated genes in co-culture in fig. 13B is shown in fig. 14C. In fig. 14, the color of the dots represents a rich factor, and the size represents the number of inputs per KEGG entry. The horizontal axis represents importance of enrichment. The vertical axis represents the enriched KEGG pathway.

The measurement of the amount of NKG2D expressed on the TABP-EIC-WTN cells is shown in FIG. 15A. MICA/B expression levels on C4-2 cells are shown in FIG. 15B. FIG. 15 shows cell surface marker detection (determination of the corresponding marker expression level).

Example 7 TABP Signal pathway involving PD-L1 expression when Co-cultured with EIC-WTN and C4-2 cells

TABP-EIC-WTN was cultured alone or in co-culture with C4-2 cells (E: T=1:1) for 24 hours, and then the protein was extracted for detection.

FIGS. 16-17 are protein level detection assays, and Western blot analysis of PD-L1 (FIGS. 16A, 17A), p-PI3K (FIGS. 16A, 17B), p-AKT (FIGS. 16A, 17C), and p-mTOR (FIGS. 16A, 17D) in co-cultured TABP-EIC-WTN, respectively, is shown as labels in the figures. TABP-EIC-WTN, blocking TABP-EIC-WTN, NK92, co-culturing NK92, blocking NK92 cells.

Before co-culturing with C4-2 cells, NKG 2D-blocker (NKG 2D-mab) was added to TABP-EIC-WTN or NK92 cells and incubated for 1 hour at 37 ℃. The NKG 2D-blocker inhibits the activation of PI3K/AKT/mTOR pathway in NK92 cells but not TABP-EIC-WTN cells.

Western blot analysis of ifnγ mediated JAK/STAT activator members included p-JAK1 (fig. 16B, 17E), p-JAK2 (fig. 16B, 17H) and p-STAT1 (fig. 16B, 17G) in C4-2 cells co-cultured with tab-EIC-WTN cells compared to C4-2 cells without any treatment.

The above experimental results show that TABP-EIC-WTN and C4-2 cells co-culture are involved in the signal pathway of PD-L1 expression.

EXAMPLE 8 detection of cytotoxic Activity of TABP-EIC-WTN cells treated with atezolizumab or nivolumab

The luminescence intensity of TABP-EIC-WTN co-cultured with C4-2 GFP cells was examined and the results are shown in FIG. 18: c4-2 GFP cells co-cultured with TABP-EIC-WTN bioluminescence intensity (BLI) when treated with atezolizumab or nivolumab at concentrations of 10, 20, 40 μg/mL.

CCK-8 assay showed that atezolizumab (20 μg/mL) significantly enhanced the inhibition of TABP-EIC-WTN on prostate cancer cells, while nivolumab (20 μg/mL) slightly enhanced the inhibition of TABP-EIC-WTN on prostate cancer cells. E: t is 1: 1. 5: the results at 1 are shown in fig. 19A and 19B, respectively. The combination of TABP-EIC-WTN and PD-L1 inhibitors has been shown to be effective in treating prostate cancer.

The effect of Atezolizumab or nivolumab on IFN- γ secretion by TABP-EIC-WTN cells was examined at 2 and 6 hours of Atezolizumab or nivolumab addition using ELISA, and the results are shown in FIG. 20: atezolizumab (10, 20, 40 μg/mL) increased IFN- γ secretion by TABP-EIC-WTN cells incubated with C4-2 cells.

TABP-EIC-WTN cells were cultured at 37℃at 1:1 and C4-2 cells, and then collecting the tab-EIC-WTN cells and treating with atezolizumab (20 μg/mL) or nivolumab (20 μg/mL), and then detecting CD107a expression in the tab-EIC-WTN cells induced by C4-2 cells using a flow cytometer in the presence of atezolizumab or nivolumab, the results of which are shown in fig. 21, demonstrate that activated NK cells produce cytotoxic effects primarily through two cell signaling pathways, one involving perforin and granzyme B, the other involving target cell death ligands, including TRAIL and FASL. CD107a expression in TABP-EIC-WTN cells was significantly increased in the presence of atezolizumab in an ADCC-dependent manner. In addition, the results of FIGS. 19-21 demonstrate that atezolizumab is significantly more effective than nivolumab.

EXAMPLE 9 anti-tumor Effect of TABP-EIC-WTN with atezolizumab or nivolumab on C4-2 cells in the Presence or absence of CD8+ T cells in vivo

1. Preparation of DC-CIK co-cultured with C4-2 cells

Peripheral Blood Mononuclear Cells (PBMCs) or lymphocytes (PBLs) were isolated from a donor blood sample of a normal healthy subject by Ficoll-Paque (TBD science), then centrifuged at 460g density gradient for 40 min, washed twice with saline and cultured in DC adherent medium consisting of X-VIVO (Lonza) and 5% fbs (Gibco). After 1 hour incubation, adherent PBMCs (monocytes) were collected for DC culture and suspended PBLs were collected for cytokine-induced killer Cell (CIK) culture (day 0).

Adherent monocytes were cultured in DC growth medium consisting of X-VIVO (Lonza) containing 5% FBS and 2U/mL DC culture factor (Novoprotein), in a CO ₂ incubator at 37℃and then replaced with half of the DC growth medium on day 3, DC maturation factor (Novoprotein) was added on day 6 (final concentration 2U/mL) and finally harvested on day 8.

For CIK culture, the suspended PBLs were adjusted to a density of 1.5X10 ⁶/mL and cultured in CIK activation medium containing KBM551 (Corning), 3% FBS, 50ng/mL anti-CD 3 antibody (Beijing TIANNECTORES), 1000U/mL IFN-gamma (Beijing TIANNECTORES), 100U/mL IL-1α (Beijing TIANNECTONES), and 500U/mL IL-2 (SL Pharm). Cell cultures were supplemented with CIK proliferation medium containing KBM551, 3% FBS and 500U/mL IL-2 on days 3, 4 and 6, during which time the cell density remained above 1.5X10 ⁶ cells/mL.

On day 8, approximately 4X 10 ⁷ DC and 1X 10 ⁸ CIK were harvested, centrifuged, and then mixed in 150mL CIK proliferation medium. The DC-CIK mixture was then added to a T75 flask inoculated with 1X 10 ⁷ C4-2 adherent cells and co-cultured in a humidified environment of 5% CO ₂ at 37 ℃.

After 24 hours of co-cultivation, the suspended DC-CIK mixture was harvested and designated as "co-cultivated CIK (labeled cocultured CIK on the figure)".

2. Construction and culture of model mice

Male NOD/SCID mice of 5 weeks old were purchased from Experimental animal technology, inc. of Peking, and raised to national center for cancer molecular oncology, national laboratory animal facilities without specific pathogens. All experimental procedures were approved by the ethical committee of our hospital and were performed in accordance with the principles of laboratory animal care (NIH publication volume 25, revised 1996, phase 28). Mice were inoculated subcutaneously on their upper abdomen with 2X 10 ⁶ C4-2 cells suspended in 200. Mu.L PBS. Treatment was started on day 7 when tumor volumes reached 100-200mm ³, and C4-2 vaccinated mice were randomized into seven groups:

(i) A Control (Control) group was used,

(Ii) The TABP-EIC-WTN group,

(Iii) TABP-EIC-WTN+nivolumab group,

(Iv) TABP-EIC-WTN+atezolizumab group,

(V) TABP-EIC-WTN+ co-cultured CIK (cocultured CIK) group,

(Vi) TABP-EIC-WTN+nivolumab+co-cultured CIK group,

(Vii) TABP-EIC-WTN+atezolizumab+co-cultured CIK group.

PD-L1 antibody atezolizumab (GlpBio, GC 32704) (20 mg/kg) or PD-1 antibody nivolumab (GlpBio, GC 34218) (10 mg/kg) or control PBS tail intravenous for 5 doses were administered on days 7, 9, 11, 13, 15 post tumor inoculation, while TABP-EIC-WTN treatment was 5X 10 ⁶ TABP-EIC-WTN injected on days 8, 10, 12, 14, 16 post PD-L1/PD-1 antibody treatment for co-intravenous 5 doses.

On day 17 CIK was co-cultured by intravenous injection on the basis of TABP-EIC-WTN treatment, with or without PD-L1/PD-1 antibody.

Tumor volume calculation formula: l X W ²/2, where L and W represent the longest and shortest diameters measured by calipers on days 7, 10, 14, 16, 18, 20. Also by usingSpectral CT detection bioluminescence intensity (BLI) the tumor size before and after treatment was assessed, BLI was measured and expressed as irradiance (p/sec/cm 2/sr) as described at days 7, 14, 21 after tumor cell implantation.

All mice were sacrificed on day 21, tumors were collected, photographed, weighed and collected for histological examination.

3. Experimental results

Tumor sizes (n=3-4) of the C4-2 GFP cell-implanted mice of each group above were measured on days 7, 14, 21, and the results are shown in fig. 22. Tumor sizes of mice treated with or without co-culture were counted, and tumor volumes of groups treated with co-culture were counted as shown in fig. 25A and tumor volumes of groups treated with co-culture were counted as shown in fig. 25B.

A physical plot of resected tumor is shown in fig. 26A, a statistical analysis of tumor weight is shown in fig. 26B, where values are expressed as mean ± SD, representing P <0.05; NS stands for no significant difference.

To analyze the inhibition of tumor by co-cultured CIK, tumor inhibition was measured with or without co-cultured CIK, and quantitative BLI assays were performed on the control, tab-EIC-WTN treatment, tab-EIC-wtn+nivolumab treatment, tab-EIC-wtn+atezolizumab treatment, and on days 7, 14, and 21, the results were shown in fig. 23A. Quantitative BLI assays were performed on the control, TABP-EIC-WTN, TABP-EIC-WTN+ co-cultured CIK, TABP-EIC-WTN+ nivolumab+ co-cultured CIK, and TABP-EIC-WTN+ atezolizumab+ co-cultured CIK, as shown in FIG. 23B.

Immunohistochemical staining was performed on tumor cells, necrotic tissue was fixed with 10% neutral buffered formalin, paraffin embedded, cut into 4 μm thick sections, and Hematoxylin Eosin (HE) stained for light microscopy. The dead zone was stained red under an optical microscope without an intact cell structure. Ndp. view2 viewing software (Hamamatsu Photonics, shizuoka, japan) was used to quantify the percentage of red necrotic area relative to the entire area, with large vessels excluded from the image analysis described above. The results are shown in FIG. 24A, in which significant tumor necrosis was observed in the TABP-EIC-WTN treated group, and the addition of atezolizumab significantly increased the severity of the tumor necrosis in the TABP-EIC-WTN treated group, and the statistical results are shown in FIG. 24B.

The experimental results show that the combination of the TABP-EIC-WTN and/or the atezolizumab and/or the co-cultured CIK can effectively treat tumors, namely the combination of the TABP-EIC-WTN and the atezolizumab can effectively treat tumors; the combination of TABP-EIC-WTN and co-cultured CIK can effectively treat tumors; the combination of TABP-EIC-WTN, atezolizumab and co-cultured CIK can effectively treat tumor.

EXAMPLE 10 constitution and functional identification of Co-cultured CIK

CD3, CD8 and CD56 expression in co-cultured CIK were detected using flow cytometry, cells being stained with the following antibodies: CD3-APC, CD8-FITC, CD56-PerCP from BD Bioscience; the result of statistical analysis of the detection results is shown in fig. 27.

Fluorescence imaging measurements of control, CIK-treated and co-cultured CIK-treated mice on days 5 and 10, BLI measurements and statistical analysis of C4-2 GFP implanted tumor activity (n=3) are shown in fig. 28. Measurements were made on days 5, 10, 20 and tumor volumes were calculated and the results are shown in fig. 29.

The experimental results show that the CIK and the co-cultured CIK have certain treatment effects on tumors, and the treatment effect of the co-cultured CIK prepared by the invention is better and is obviously superior to that of a control group and a CIK group.

Example 11 Atezolizumab enhanced in vitro cytotoxicity of TABP-EIC-WTN on CRPC cells from a prostate cancer patient

A prostate cancer patient was randomly selected and serum testosterone and PSA levels were recorded after ADT and the results are shown in figures 30A and 30B, respectively, with PSA levels rising continuously beyond nadir starting from month 2021 at testosterone castration levels after ADT.

On day 5 and 26 of 2021, patients successfully received Robotic Assisted Radical Prostatectomy (RARP) and bilateral pelvic lymph node dissection under general anesthesia. Part of the fresh specimen was sent to a laboratory for primary culture of PCa cells (prostate cancer cells) within 2 hours after removal from the body. The procedure was as follows: CRPC tissue was rinsed several times with sterile physiological saline and cut into 3mm thick pieces. These tissue pieces were then digested with 0.1% collagenase I (Sigma) in alpha-MEM (Corning) at 37℃for 2 hours in a shaking incubator. These tissue pieces were washed 3 times with PBS and centrifuged at 300g for 5 minutes at low speed to remove collagenase I. 10cm cell culture dishes were pre-coated with FBS (Gibco).

Tissues were seeded on FBS-free dishes and cultured at 37 ℃ in a humidified incubator with 5% co ₂ for 24 hours, then 10mL of α -MEM was added and 10% FBS was added to the dishes for further cell culture.

The tumor sections were HE stained (x 100), and the staining results are shown in FIG. 31A, and FIG. 31B is an optical micrograph of primary prostate cancer cells (x 200) on day 14.

PCa (prostate cancer cells) was incubated with TABP-EIC-WTN cells for 24 hours, and the expression of PD-L1 on PCa was examined by flow assay, and as shown in FIGS. 32A and 32B, atezolizumab was demonstrated to enhance the cytotoxicity of TABP-EIC-WTN on CRPC cells.

CCK-8 assay the inhibition effect of TABP-EIC-WTN cells on tumors when atezolizumab/nivolumab is added (E: T=1:1), and the statistics are shown in FIG. 32C, which shows that atezolizumab (20 μg/mL) significantly enhances the inhibition rate of TABP-EIC-WTN (E: T=1:1), further indicating that PD-L1 inhibitor and TABP-EIC-WTN in combination are effective in treating prostate cancer.

The above description of the embodiments is only for the understanding of the method of the present invention and its core ideas. It should be noted that it will be apparent to those skilled in the art that several improvements and modifications can be made to the present invention without departing from the principle of the invention, and these improvements and modifications will fall within the scope of the claims of the invention.

Sequence listing

<110> Noval regeneration medical science and technology (Zhuhai Hengqin New district) Limited

<120> Use of Co-cultured CIK cells and TABP-EIC-WTN cells in combination for the treatment of prostate cancer

<141> 2022-02-17

<150> 2021107975479

<151> 2021-07-14

<160> 12

<170> SIPOSequenceListing 1.0

<210> 1

<211> 12

<212> PRT

<213> Artificial sequence (ARTIFICIAL SEQUENCE)

<400> 1

Trp Thr Asn His His Gln His Ser Lys Val Arg Glu

1 5 10

<210> 2

<211> 36

<212> DNA

<213> Artificial sequence (ARTIFICIAL SEQUENCE)

<400> 2

tggaccaacc accaccagca cagcaaggtg agagag 36

<210> 3

<211> 45

<212> PRT

<213> Artificial sequence (ARTIFICIAL SEQUENCE)

<400> 3

Thr Thr Thr Pro Ala Pro Arg Pro Pro Thr Pro Ala Pro Thr Ile Ala

1 5 10 15

Ser Gln Pro Leu Ser Leu Arg Pro Glu Ala Cys Arg Pro Ala Ala Gly

20 25 30

Gly Ala Val His Thr Arg Gly Leu Asp Phe Ala Cys Asp

35 40 45

<210> 4

<211> 135

<212> DNA

<213> Artificial sequence (ARTIFICIAL SEQUENCE)

<400> 4

accactaccc cagcaccgag gccacccacc ccggctccta ccatcgcctc ccagcctctg 60

tccctgcgtc cggaggcatg tagacccgca gctggtgggg ccgtgcatac ccggggtctt 120

gacttcgcct gcgat 135

<210> 5

<211> 35

<212> PRT

<213> Artificial sequence (ARTIFICIAL SEQUENCE)

<400> 5

Gln Asp Cys Gln Asn Ala His Gln Glu Phe Arg Phe Trp Pro Phe Leu

1 5 10 15

Val Ile Ile Val Ile Leu Ser Ala Leu Phe Leu Gly Thr Leu Ala Cys

20 25 30

Phe Cys Val

35

<210> 6

<211> 105

<212> DNA

<213> Artificial sequence (ARTIFICIAL SEQUENCE)

<400> 6

caggactgtc agaatgccca tcaggaattc agattttggc cgtttttggt gatcatcgtg 60

attctaagcg cactgttcct tggcaccctt gcctgcttct gtgtg 105

<210> 7

<211> 120

<212> PRT

<213> Artificial sequence (ARTIFICIAL SEQUENCE)

<400> 7

Trp Arg Arg Lys Arg Lys Glu Lys Gln Ser Glu Thr Ser Pro Lys Glu

1 5 10 15

Phe Leu Thr Ile Tyr Glu Asp Val Lys Asp Leu Lys Thr Arg Arg Asn

20 25 30

His Glu Gln Glu Gln Thr Phe Pro Gly Gly Gly Ser Thr Ile Tyr Ser

35 40 45

Met Ile Gln Ser Gln Ser Ser Ala Pro Thr Ser Gln Glu Pro Ala Tyr

50 55 60

Thr Leu Tyr Ser Leu Ile Gln Pro Ser Arg Lys Ser Gly Ser Arg Lys

65 70 75 80

Arg Asn His Ser Pro Ser Phe Asn Ser Thr Ile Tyr Glu Val Ile Gly

85 90 95

Lys Ser Gln Pro Lys Ala Gln Asn Pro Ala Arg Leu Ser Arg Lys Glu

100 105 110

Leu Glu Asn Phe Asp Val Tyr Ser

115 120

<210> 8

<211> 360

<212> DNA

<213> Artificial sequence (ARTIFICIAL SEQUENCE)

<400> 8

tggaggagaa agaggaagga gaagcagtca gagaccagtc ccaaggaatt tttgacaatt 60

tacgaagatg tcaaggatct gaaaaccagg agaaatcacg agcaggagca gacttttcct 120

ggagggggga gcaccatcta ctctatgatc cagtcccagt cttctgctcc cacgtcacaa 180

gaaccagcat atacattata ttcattaatt cagccttcca ggaagtctgg ttccaggaag 240

aggaaccaca gcccttcctt caatagcact atctatgaag tgattggaaa gagtcaacct 300

aaagcccaga accctgctcg attgagccgc aaagagctgg agaactttga tgtttattcc 360

<210> 9

<211> 51

<212> PRT

<213> Artificial sequence (ARTIFICIAL SEQUENCE)

<400> 9

Met Gly Trp Ile Arg Gly Arg Arg Ser Arg His Ser Trp Glu Met Ser

1 5 10 15

Glu Phe His Asn Tyr Asn Leu Asp Leu Lys Lys Ser Asp Phe Ser Thr

20 25 30

Arg Trp Gln Lys Gln Arg Cys Pro Val Val Lys Ser Lys Cys Arg Glu

35 40 45

Asn Ala Ser

50

<210> 10

<211> 153

<212> DNA

<213> Artificial sequence (ARTIFICIAL SEQUENCE)

<400> 10

atggggtgga ttcgtggtcg gaggtctcga cacagctggg agatgagtga atttcataat 60

tataacttgg atctgaagaa gagtgatttt tcaacacgat ggcaaaagca aagatgtcca 120

gtagtcaaaa gcaaatgtag agaaaatgca tct 153

<210> 11

<211> 316

<212> PRT

<213> Artificial sequence (ARTIFICIAL SEQUENCE)

<400> 11

Met Ala Leu Pro Val Thr Ala Leu Leu Leu Pro Leu Ala Leu Leu Leu

1 5 10 15

His Ala Ala Arg Pro Trp Thr Asn His His Gln His Ser Lys Val Arg

20 25 30

Glu Gly Gly Gly Ser Trp Thr Asn His His Gln His Ser Lys Val Arg

35 40 45

Glu Gly Gly Gly Ser Trp Thr Asn His His Gln His Ser Lys Val Arg

50 55 60

Glu Thr Thr Thr Pro Ala Pro Arg Pro Pro Thr Pro Ala Pro Thr Ile

65 70 75 80

Ala Ser Gln Pro Leu Ser Leu Arg Pro Glu Ala Cys Arg Pro Ala Ala

85 90 95

Gly Gly Ala Val His Thr Arg Gly Leu Asp Phe Ala Cys Asp Gln Asp

100 105 110

Cys Gln Asn Ala His Gln Glu Phe Arg Phe Trp Pro Phe Leu Val Ile

115 120 125

Ile Val Ile Leu Ser Ala Leu Phe Leu Gly Thr Leu Ala Cys Phe Cys

130 135 140

Val Trp Arg Arg Lys Arg Lys Glu Lys Gln Ser Glu Thr Ser Pro Lys

145 150 155 160

Glu Phe Leu Thr Ile Tyr Glu Asp Val Lys Asp Leu Lys Thr Arg Arg

165 170 175

Asn His Glu Gln Glu Gln Thr Phe Pro Gly Gly Gly Ser Thr Ile Tyr

180 185 190

Ser Met Ile Gln Ser Gln Ser Ser Ala Pro Thr Ser Gln Glu Pro Ala

195 200 205

Tyr Thr Leu Tyr Ser Leu Ile Gln Pro Ser Arg Lys Ser Gly Ser Arg

210 215 220

Lys Arg Asn His Ser Pro Ser Phe Asn Ser Thr Ile Tyr Glu Val Ile

225 230 235 240

Gly Lys Ser Gln Pro Lys Ala Gln Asn Pro Ala Arg Leu Ser Arg Lys

245 250 255

Glu Leu Glu Asn Phe Asp Val Tyr Ser Met Gly Trp Ile Arg Gly Arg

260 265 270

Arg Ser Arg His Ser Trp Glu Met Ser Glu Phe His Asn Tyr Asn Leu

275 280 285

Asp Leu Lys Lys Ser Asp Phe Ser Thr Arg Trp Gln Lys Gln Arg Cys

290 295 300

Pro Val Val Lys Ser Lys Cys Arg Glu Asn Ala Ser

305 310 315

<210> 12

<211> 951

<212> DNA

<213> Artificial sequence (ARTIFICIAL SEQUENCE)

<400> 12

atggccttac cagtgaccgc cttgctcctg ccgctggcct tgctgctcca cgccgccagg 60

ccgtggacca accaccacca gcacagcaag gtgagagagg gcggcggcag ctggaccaac 120

caccaccagc acagcaaggt gagagagggc ggcggcagct ggaccaacca ccaccagcac 180

agcaaggtga gagagaccac taccccagca ccgaggccac ccaccccggc tcctaccatc 240

gcctcccagc ctctgtccct gcgtccggag gcatgtagac ccgcagctgg tggggccgtg 300

catacccggg gtcttgactt cgcctgcgat caggactgtc agaatgccca tcaggaattc 360

agattttggc cgtttttggt gatcatcgtg attctaagcg cactgttcct tggcaccctt 420

gcctgcttct gtgtgtggag gagaaagagg aaggagaagc agtcagagac cagtcccaag 480

gaatttttga caatttacga agatgtcaag gatctgaaaa ccaggagaaa tcacgagcag 540

gagcagactt ttcctggagg ggggagcacc atctactcta tgatccagtc ccagtcttct 600

gctcccacgt cacaagaacc agcatataca ttatattcat taattcagcc ttccaggaag 660

tctggttcca ggaagaggaa ccacagccct tccttcaata gcactatcta tgaagtgatt 720

ggaaagagtc aacctaaagc ccagaaccct gctcgattga gccgcaaaga gctggagaac 780

tttgatgttt attccatggg gtggattcgt ggtcggaggt ctcgacacag ctgggagatg 840

agtgaatttc ataattataa cttggatctg aagaagagtg atttttcaac acgatggcaa 900

aagcaaagat gtccagtagt caaaagcaaa tgtagagaaa atgcatctta a 951

Claims (24)

1. A pharmaceutical composition for treating prostate cancer, comprising co-culturing CIK cells and tumor antigen binding peptide-engineered immune cells;

The tumor antigen binding peptide in the tumor antigen binding peptide-engineered immune cell is composed of a WTN polypeptide region-CD 8 alpha hinge region-2B 4 transmembrane domain-2B 4 costimulatory domain-NKG 2D primary signal transduction domain;

The WTN polypeptide region includes a plurality of WTN polypeptide repeats and a linker between the plurality of WTN polypeptide repeats;

The WTN polypeptide is a polypeptide that specifically binds PSMA;

the WTN polypeptide is shown as SEQ ID NO. 1;

the amino acid sequence of the CD8 alpha hinge region is shown as SEQ ID NO. 3;

the amino acid sequence of the 2B4 transmembrane domain is shown as SEQ ID NO. 5;

The amino acid sequence of the 2B4 co-stimulatory domain is shown in SEQ ID NO. 7;

the amino acid sequence of the NKG2D primary signal transduction domain is shown as SEQ ID NO. 9;

the co-cultured CIK cells are DC-CIK cells co-cultured with the prostate cancer cells;

the tumor antigen binding peptide-engineered immune cells are tumor antigen binding peptide-engineered NK cells.

2. The pharmaceutical composition of claim 1, wherein the WTN polypeptide has a nucleotide sequence as shown in SEQ ID No. 2;

The nucleotide sequence of the CD8 alpha hinge region is shown as SEQ ID NO. 4;

the nucleotide sequence of the 2B4 transmembrane domain is shown as SEQ ID NO. 6;

The nucleotide sequence of the 2B4 co-stimulatory domain is shown in SEQ ID NO. 8;

the nucleotide sequence of the NKG2D primary signal transduction domain is shown as SEQ ID NO. 10.

3. The pharmaceutical composition of claim 1, wherein the amino acid sequence of the tumor antigen binding peptide is shown in SEQ ID No. 11.

4. The pharmaceutical composition of claim 3, wherein the nucleotide sequence of the tumor antigen binding peptide is set forth in SEQ ID No. 12.

5. The pharmaceutical composition of claim 1, wherein the co-cultured CIK cells comprise cd8+ T cells.

6. The pharmaceutical composition of claim 5, wherein the method of preparing co-cultured CIK cells comprises the steps of:

(1) Culturing DC cells;

(2) Culturing CIK cells;

(3) Mixing the DC cells obtained by culturing in the step (1) and the CIK cells obtained by culturing in the step (2) in a culture medium, adding the prostate cancer cells for co-culturing, and collecting the suspended DC-CIK mixture to obtain the co-cultured CIK cells.

7. The pharmaceutical composition according to claim 6, wherein the step (1) comprises the steps of:

(a) On day 0, PBMC cells were cultured in DC cell growth medium;

(b) Day 3, the DC cell growth medium was changed;

(c) On day 6, adding DC cell maturation factors to the DC cell growth medium;

(d) On day 8, cells were collected to obtain DC cells.

8. The pharmaceutical composition of claim 7, wherein the substance added to the DC cell growth medium in step (a) comprises FBS, DC cell culture factor.

9. The pharmaceutical composition of claim 8, wherein the substance added to the DC cell growth medium in step (a) comprises 5% FBS, 2U/mL DC cell culture factor.

10. The pharmaceutical composition of claim 7, wherein the final concentration of DC maturation factor in step (c) is 2U/mL.

11. The pharmaceutical composition of claim 6, wherein step (2) comprises the steps of:

(a) On day 0, PBL cells were cultured in CIK cell activation medium;

(b) Day 3, 4, 6, cell cultures were supplemented with CIK cell proliferation medium;

(c) On day 8, cells were collected to obtain CIK cells.

12. The pharmaceutical composition of claim 11, wherein the substances added to the CIK cell activating medium in step (a) comprise KBM551, FBS, anti-CD 3 antibodies, IFN- γ, IL-1 a, IL-2.

13. The pharmaceutical composition of claim 12, wherein the substances added to the CIK cell activating medium in step (a) comprise KBM551, 3% FBS, 50 ng/mL anti-CD 3 antibody, 1000U/mL IFN- γ, 100U/mL IL-1 a, 500U/mL IL-2.

14. The pharmaceutical composition of claim 11, wherein the PBL cells in step (a) have a cell density of 1.5 x 10 ⁶/mL.

15. The pharmaceutical composition of claim 11, wherein the substances added to the CIK cell proliferation medium in step (b) comprise KBM551, FBS, IL-2.

16. The pharmaceutical composition of claim 15, wherein the substances added to the CIK cell proliferation medium in step (b) comprise KBM551, 3% FBS and 500U/mL IL-2.

17. The pharmaceutical composition of claim 6, wherein the medium in step (3) is a CIK cell proliferation medium.

18. The pharmaceutical composition of claim 6, wherein the DC cells have a cell density of 4 x 10 ⁷/mL.

19. The pharmaceutical composition of claim 6, wherein the CIK cells have a cell density of 1 x 10 ⁸/mL.

20. The pharmaceutical composition of claim 6, wherein the prostate cancer cells have a cell density of 1 x 10 ⁷/mL.

21. The pharmaceutical composition of claim 6, wherein the CO-culture conditions are 5% CO ₂, 37 ℃,24, h.

22. The pharmaceutical composition of claim 6, wherein the prostate cancer cells comprise C4-2, LNCaP, PC-3, DU145.

23. The pharmaceutical composition of claim 6, wherein the prostate cancer cell is C4-2.

24. Use of a co-cultured CIK cell as claimed in any one of claims 1-23 in combination with said tumor antigen binding peptide-engineered immune cell in the manufacture of a medicament for the treatment of prostate cancer.