CN114874940B - Composite microbial agent, fermented product thereof and application thereof - Google Patents
Composite microbial agent, fermented product thereof and application thereof Download PDFInfo
- Publication number
- CN114874940B CN114874940B CN202210504056.5A CN202210504056A CN114874940B CN 114874940 B CN114874940 B CN 114874940B CN 202210504056 A CN202210504056 A CN 202210504056A CN 114874940 B CN114874940 B CN 114874940B
- Authority
- CN
- China
- Prior art keywords
- bacillus
- fermentation
- rhodotorula mucilaginosa
- bacillus subtilis
- composite microbial
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/20—Bacteria; Culture media therefor
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01N—PRESERVATION OF BODIES OF HUMANS OR ANIMALS OR PLANTS OR PARTS THEREOF; BIOCIDES, e.g. AS DISINFECTANTS, AS PESTICIDES OR AS HERBICIDES; PEST REPELLANTS OR ATTRACTANTS; PLANT GROWTH REGULATORS
- A01N63/00—Biocides, pest repellants or attractants, or plant growth regulators containing microorganisms, viruses, microbial fungi, animals or substances produced by, or obtained from, microorganisms, viruses, microbial fungi or animals, e.g. enzymes or fermentates
- A01N63/20—Bacteria; Substances produced thereby or obtained therefrom
- A01N63/22—Bacillus
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01N—PRESERVATION OF BODIES OF HUMANS OR ANIMALS OR PLANTS OR PARTS THEREOF; BIOCIDES, e.g. AS DISINFECTANTS, AS PESTICIDES OR AS HERBICIDES; PEST REPELLANTS OR ATTRACTANTS; PLANT GROWTH REGULATORS
- A01N63/00—Biocides, pest repellants or attractants, or plant growth regulators containing microorganisms, viruses, microbial fungi, animals or substances produced by, or obtained from, microorganisms, viruses, microbial fungi or animals, e.g. enzymes or fermentates
- A01N63/30—Microbial fungi; Substances produced thereby or obtained therefrom
- A01N63/32—Yeast
-
- A—HUMAN NECESSITIES
- A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
- A23K—FODDER
- A23K10/00—Animal feeding-stuffs
- A23K10/10—Animal feeding-stuffs obtained by microbiological or biochemical processes
- A23K10/12—Animal feeding-stuffs obtained by microbiological or biochemical processes by fermentation of natural products, e.g. of vegetable material, animal waste material or biomass
-
- A—HUMAN NECESSITIES
- A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
- A23K—FODDER
- A23K10/00—Animal feeding-stuffs
- A23K10/30—Animal feeding-stuffs from material of plant origin, e.g. roots, seeds or hay; from material of fungal origin, e.g. mushrooms
-
- A—HUMAN NECESSITIES
- A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
- A23K—FODDER
- A23K10/00—Animal feeding-stuffs
- A23K10/30—Animal feeding-stuffs from material of plant origin, e.g. roots, seeds or hay; from material of fungal origin, e.g. mushrooms
- A23K10/37—Animal feeding-stuffs from material of plant origin, e.g. roots, seeds or hay; from material of fungal origin, e.g. mushrooms from waste material
-
- A—HUMAN NECESSITIES
- A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
- A23K—FODDER
- A23K20/00—Accessory food factors for animal feeding-stuffs
- A23K20/10—Organic substances
- A23K20/163—Sugars; Polysaccharides
-
- A—HUMAN NECESSITIES
- A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
- A23K—FODDER
- A23K20/00—Accessory food factors for animal feeding-stuffs
- A23K20/20—Inorganic substances, e.g. oligoelements
-
- A—HUMAN NECESSITIES
- A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
- A23K—FODDER
- A23K20/00—Accessory food factors for animal feeding-stuffs
- A23K20/20—Inorganic substances, e.g. oligoelements
- A23K20/24—Compounds of alkaline earth metals, e.g. magnesium
-
- A—HUMAN NECESSITIES
- A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
- A23K—FODDER
- A23K50/00—Feeding-stuffs specially adapted for particular animals
- A23K50/10—Feeding-stuffs specially adapted for particular animals for ruminants
-
- A—HUMAN NECESSITIES
- A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
- A23K—FODDER
- A23K50/00—Feeding-stuffs specially adapted for particular animals
- A23K50/60—Feeding-stuffs specially adapted for particular animals for weanlings
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/14—Fungi; Culture media therefor
- C12N1/16—Yeasts; Culture media therefor
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02P—CLIMATE CHANGE MITIGATION TECHNOLOGIES IN THE PRODUCTION OR PROCESSING OF GOODS
- Y02P60/00—Technologies relating to agriculture, livestock or agroalimentary industries
- Y02P60/80—Food processing, e.g. use of renewable energies or variable speed drives in handling, conveying or stacking
- Y02P60/87—Re-use of by-products of food processing for fodder production
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02W—CLIMATE CHANGE MITIGATION TECHNOLOGIES RELATED TO WASTEWATER TREATMENT OR WASTE MANAGEMENT
- Y02W30/00—Technologies for solid waste management
- Y02W30/40—Bio-organic fraction processing; Production of fertilisers from the organic fraction of waste or refuse
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Polymers & Plastics (AREA)
- Zoology (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Food Science & Technology (AREA)
- Animal Husbandry (AREA)
- Microbiology (AREA)
- Mycology (AREA)
- General Health & Medical Sciences (AREA)
- Wood Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Genetics & Genomics (AREA)
- Organic Chemistry (AREA)
- Virology (AREA)
- Molecular Biology (AREA)
- Biochemistry (AREA)
- Biomedical Technology (AREA)
- Botany (AREA)
- Physiology (AREA)
- Pest Control & Pesticides (AREA)
- Medicinal Chemistry (AREA)
- Tropical Medicine & Parasitology (AREA)
- Birds (AREA)
- Inorganic Chemistry (AREA)
- Agronomy & Crop Science (AREA)
- General Engineering & Computer Science (AREA)
- Plant Pathology (AREA)
- Dentistry (AREA)
- Environmental Sciences (AREA)
- Sustainable Development (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention belongs to the technical field of microbial engineering, and particularly relates to a composite microbial agent, a fermentation product and application thereof. The invention provides a composite microbial inoculum, which comprises bacillus subtilis, rhodotorula mucilaginosa and bacillus siamensis. The bacillus subtilis can inhibit escherichia coli, staphylococcus aureus, salmonella typhimurium and shigella, the rhodotorula mucilaginosa can inhibit escherichia coli, staphylococcus aureus and shigella, and the bacillus siamensis can inhibit escherichia coli, staphylococcus aureus, salmonella typhimurium and listeria monocytogenes. The bacillus subtilis, the rhodotorula mucilaginosa and the Siamese bacillus are mixed, so that various pathogenic bacteria can be inhibited, the inhibition effect on various pathogenic bacteria is increased, the diarrhea of livestock is well inhibited, and the collective immunity and digestion and absorption capacity of the livestock are improved. The composite microbial inoculum is used for producing the fermented feed by fermentation, so that the number of the viable bacteria in the product and the yield of the corresponding beneficial metabolites can be improved.
Description
Technical Field
The invention belongs to the technical field of microbial engineering, and particularly relates to a composite microbial agent, a fermentation product and application thereof.
Background
The key problems in the development of the farming industry are the health level and productivity of animals, and livestock and poultry animals have become a stable source of human meat and egg food. Therefore, how to accelerate the growth of livestock and poultry animals, improve the egg laying capability and reduce the disease rate is a hot spot of long-term attention in the field of poultry raising. Antibiotics are used in large quantities in the middle of the 20 th century in the farming industry for the purpose of preventing animal diseases, improving the intestinal environment of animals, increasing the yield of animal products. However, the wide use of antibiotics causes problems of drug resistance of animal organisms, dysbacteriosis in intestinal environments, drug body residues, environmental pollution in feeding and the like. The probiotics become a good substitute for antibiotics by virtue of the advantages of no drug resistance, no toxic or side effect, no residue and the like.
The invention patent application 201710258656.7 discloses a solid fermentation straw chicken feed and a preparation method thereof, and the application carries out medium-temperature biological fermentation on corn straw and saccharomycetes compound zymophyte, so that the utilization of crude protein, short-chain cellulose and sugar in the corn straw is realized. The invention patent ZL201510414300.9 discloses a process for converting crop straws into pig and chicken feed resources, and the patent achieves the aim of releasing sugar in crude fibers from polymers and adding carbohydrate serving as feed by pretreating the straws and then adding cellulase for hydrolysis. The invention patent application 201710767486.5 discloses a biological straw granular chicken feed subjected to blasting-enzymolysis treatment, which is prepared by performing alkaline method and blasting pretreatment on corn straw, then performing cellulose enzymolysis, and then mixing with basic chicken feed. However, the treatment method still has poor economic benefit, can not effectively improve the growth performance and the production performance of livestock and poultry animals, and has poor prospect of practical application in industry.
Disclosure of Invention
The invention aims to make up the defects of the prior art, and provides a composite microbial inoculum, a ferment and application thereof, which antagonize pathogenic bacteria, promote the growth of livestock and poultry animals, improve the immunity of the livestock and poultry animals and reduce diarrhea rate.
The invention provides a composite microbial inoculant, which comprises the following components: bacillus subtilis, rhodotorula mucilaginosa and bacillus siamensis.
Preferably, the viable count of the bacillus subtilis is more than or equal to 10 9 cfu/mL; the viable count of the rhodotorula mucilaginosa is more than or equal to 10 9 cfu/mL; the viable count of the Siamese bacillus is more than or equal to 10 9 cfu/mL。
Preferably, the volume ratio of the bacillus subtilis, the rhodotorula mucilaginosa to the Siamese bacillus is 1-2: 1-2: 1 to 2.
Preferably, the bacillus subtilis comprises bacillus subtilis JLCC513, and the preservation number is CGMCC No.20625; the rhodotorula mucilaginosa comprises rhodotorula mucilaginosa JAASRY1, and the preservation number is CGMCC No.22900; the Siamese bacillus comprises Siamese bacillus JAASHD with a preservation number of CGMCC No.12903.
The invention also provides a composite microbial inoculant fermented product, which is obtained by fermenting the composite microbial inoculant according to the technical scheme.
The invention also provides a preparation method of the composite microbial inoculant ferment, which comprises the following steps:
inoculating the bacillus subtilis, rhodotorula mucilaginosa and the Siamese bacillus into a fermentation medium for fermentation culture to obtain bacillus subtilis bacterial liquid, rhodotorula mucilaginosa bacterial liquid and Siamese bacillus bacterial liquid;
mixing the bacillus subtilis bacterial liquid, the rhodotorula mucilaginosa bacterial liquid and the bacillus siamensis bacterial liquid, and performing solid fermentation to obtain a solid fermentation product;
the solid state fermentation product contains the composite microbial agent fermentation product.
Preferably, the fermentation medium of the bacillus subtilis comprises an LB medium; the fermentation medium of the rhodotorula mucilaginosa comprises YPD medium; the fermentation medium of the Siamese bacillus comprises an MRS medium;
the solid state fermentation medium comprises: 45-70 wt.% of bran, 10-25 wt.% of corn meal, 15-20 wt.% of soybean meal, 1-5 wt.% of brown sugar, 1-5 wt.% of ammonium sulfate and 0-1-0 8wt.% of calcium carbonate. The solid state fermentation time is 18-35 h, and the temperature is 30-36 ℃.
The invention also provides application of the composite microbial inoculum or the composite microbial inoculum ferment in any one or more of the following A1-A3:
a1, preparing livestock animal feed;
a2, preparing a bacteriostat;
a3, preparing carotenoid.
The invention also provides application of the composite microbial inoculum or the composite microbial inoculum ferment in promoting the growth of livestock and/or improving the immunity of the livestock and the poultry.
The invention also provides a feed additive or a bacteriostatic agent, and the active ingredients comprise the composite microbial inoculum or the composite microbial inoculum ferment according to the technical scheme.
The invention provides a composite microbial inoculum, which comprises bacillus subtilis, rhodotorula mucilaginosa and bacillus siamensis. The bacillus subtilis can inhibit escherichia coli, staphylococcus aureus, salmonella typhimurium and shigella, rhodotorula mucilaginosa can inhibit escherichia coli, staphylococcus aureus and shigella, and bacillus siamensis can inhibit escherichia coli, staphylococcus aureus, salmonella typhimurium and listeria monocytogenes. According to the invention, the bacillus subtilis, the rhodotorula mucilaginosa and the Siamese bacillus are mixed, so that various pathogenic bacteria can be inhibited, the inhibition effect on various pathogenic bacteria is increased, the diarrhea of livestock is well inhibited, and the immunity and digestion and absorption capacity of the livestock are improved. The composite microbial inoculum is used for producing the fermented feed by fermentation, so that the number of the viable bacteria in the product and the yield of the corresponding beneficial metabolites can be improved.
In addition, when the composite microbial inoculum is prepared, a solid-liquid two-phase fermentation method is adopted, the initial strain is fermented and cultured in a liquid state, and the feeding fermentation product adopts a solid state fermentation mode, so that the final total viable count and the metabolite content can be improved, and the nutrition is rich.
Biological preservation information
Bacillus subtilis (Bacillus subtilis) JLCC513 was deposited at the chinese microbiological bacterial culture collection center, address: the collection number of the microbiological institute of China academy of sciences is CGMCC No.20625;
rhodotorula mucilaginosa (Rhodotorula muciladinosa) JAASRY1, deposited at China general microbiological culture Collection center, address: beijing, chaoyang area, north Chenxi way No.1, no. 3, post code: 100080 with preservation number of CGMCC No.22900;
siamese bacillus (Bacillus siamensis) JAASHD was deposited at the China general microbiological culture Collection center, address: the collection number of the microbiological institute of China academy of sciences is CGMCC No.12903.
Drawings
In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings that are required to be used in the embodiments will be briefly described below.
FIG. 1 is a phylogenetic tree of Rhodotorula mucilaginosa JAASRY 1;
FIGS. 2 to 3 show colony morphology of Rhodotorula mucilaginosa JAASRY 1.
Detailed Description
The invention provides a composite microbial inoculant, which comprises the following components: bacillus subtilis, rhodotorula mucilaginosa and bacillus siamensis.
In the invention, the viable count of the bacillus subtilis is preferably more than or equal to 10 9 cfu/mL, further preferably 10 9 cfu/mL; the viable count of the rhodotorula mucilaginosa is preferably more than or equal to 10 9 cfu/mL, further preferably 10 9 cfu/mL; the viable count of the Siamese bacillus is preferably more than or equal to 10 9 cfu/mL, further preferably 10 9 cfu/mL. The volume ratio of the bacillus subtilis, the rhodotorula mucilaginosa to the Siamese bacillus is preferably 1-2: 1-2: 1 to 2. In the specific implementation process, the invention can be implemented in the following steps of 1-2: 1-2: 1 to 2, preferably 1:2:1 or 1:1:2 or 2:1:1. the bacillus subtilis comprises bacillus subtilis JLCC513, and the preservation number is CGMCC No.20625; the rhodotorula mucilaginosa comprises rhodotorula mucilaginosa JAASRY1, and the preservation number is CGMCC No.22900; the Siamese bacillus comprises Siamese bacillus JAASHD with a preservation number of CGMCC No.12903. The bacillus subtilis JLCC513 of the present invention is disclosed in patent CN113684157 a; the Siamese bacillus JAASHD is disclosed in patent CN 108208316A; the rhodotorula mucilaginosa JAASRY1 is obtained by collecting and separating soil polluted by edible oil at the Siemens of the academy of agricultural sciences of Jilin, jilin province princess, and the strain morphology shows that,the rhodotorula mucilaginosa JAASRY1 can form a colony (shown in figure 2) with the diameter of about (1.9+/-0.1) cm, the color of the colony is gradually changed from white to orange red, the surface is bright, and the texture is soft and sticky. The color of the culture medium is not changed obviously before and after the culture, and no exudates are formed. Culturing in wort culture medium at 30deg.C for 3-5 d, wherein the cells are short oval, single or paired (shown in figure 3), and have cell size of 3-6 μm, and can form precipitate, and the thallus presents pink color; physiological and biochemical verification shows that the strain can utilize 16 kinds of sugar such as glucose, fructose, galactose, sucrose, mannose and the like, can not utilize lactose and soluble starch, can utilize glycerol, mannitol, succinic acid, citric acid, malic acid and glycine, can not utilize p-aminobenzoic acid, erythritol, ribitol, inositol, sorbitol and sorbic acid, and has an optimal temperature of 28-32 ℃ and a maximum temperature of 50 ℃; molecular biological verification shows that the 26SrDNAD1/D2 gene sequence is preferably shown as SEQ ID NO.1, and by using Blast for comparison, a phylogenetic tree (shown as figure 1) shown in figure 1 is constructed according to the highest similarity sequence provided by GenBank, and the closest relationship with Rhodotorulamucilaginosa CBS 316 is found. The rhodotorula mucilaginosa JAASRY1 has been subjected to biological preservation, and is preserved in China general microbiological culture Collection center (CGMCC) No.22900. The rhodotorula mucilaginosa JAASRY1 has the function of resisting pathogenic bacteria, can inhibit escherichia coli, staphylococcus aureus and shigella, has high yield of carotenoid, has no toxic or side effect as proved by a mouse pathogenicity and toxicity test, can be used as a feed additive for livestock and poultry animals, enhances immunity, reduces diarrhea rate and death rate of poultry, improves egg laying rate of poultry, deepens yolk color of poultry, effectively improves product quality of poultry animals, and has wide market application prospect.
According to the invention, bacillus subtilis, rhodotorula mucilaginosa and bacillus siamensis are compounded, the bacillus subtilis can inhibit escherichia coli, staphylococcus aureus, salmonella typhimurium and shigella, rhodotorula mucilaginosa can inhibit escherichia coli, staphylococcus aureus and shigella, and bacillus siamensis can inhibit escherichia coli, staphylococcus aureus, salmonella typhimurium and listeria monocytogenes. According to the invention, the bacillus subtilis, the rhodotorula mucilaginosa and the Siamese bacillus are mixed, so that various pathogenic bacteria can be inhibited, the inhibition effect on various pathogenic bacteria is increased, the diarrhea of livestock is well inhibited, and the immunity and digestion and absorption capacity of the livestock are improved. The composite microbial inoculum is used for producing the fermented feed by fermentation, so that the number of the viable bacteria in the product and the yield of the corresponding beneficial metabolites can be improved.
According to the characteristics of the composite microbial inoculum disclosed by the invention, the following contents are all within the protection scope of the invention: the application of the composite microbial inoculum in one or more of preparation of livestock and poultry animal feed, preparation of bacteriostat and preparation of carotenoid; the application of the composite microbial inoculum in promoting the growth of livestock and/or improving the immunity of the livestock and the poultry. When the composite microbial agent is used for preparing the bacteriostatic agent, the bacteriostatic agent preferably comprises a bacteriostatic agent for inhibiting one or more bacteria of escherichia coli, staphylococcus aureus, salmonella typhimurium, shigella and listeria monocytogenes, and more preferably comprises a bacteriostatic agent for simultaneously inhibiting escherichia coli, staphylococcus aureus, salmonella typhimurium, shigella and listeria monocytogenes.
The invention also provides a composite microbial inoculant fermented product, which is obtained by fermenting the composite microbial inoculant according to the technical scheme.
The preparation method of the composite microbial inoculum fermented product preferably comprises the following steps:
inoculating the bacillus subtilis, rhodotorula mucilaginosa and the Siamese bacillus into a fermentation medium respectively, and fermenting and culturing to obtain bacillus subtilis liquid, rhodotorula mucilaginosa liquid and Siamese bacillus liquid;
mixing the bacillus subtilis bacterial liquid, the rhodotorula mucilaginosa bacterial liquid and the bacillus siamensis bacterial liquid, and performing solid fermentation to obtain a solid fermentation product;
the solid state fermentation product contains the composite microbial agent fermentation product.
Before the bacillus subtilis is inoculated to a fermentation medium, the bacillus subtilis is preferably inoculated to a seed medium, and the bacillus subtilis seed fermentation broth is obtained by culture. The temperature for culturing the bacillus subtilis is preferably 30-37 ℃, and more preferably 35-36 ℃; the time for culturing the bacillus subtilis is preferably 10 to 20 hours, more preferably 12 to 18 hours, and even more preferably 15 to 16 hours; the rotation speed of the culture of the Bacillus subtilis is preferably 160 to 240rpm/min, more preferably 180 to 220rpm/min, and still more preferably 200rpm/min. The seed culture medium of bacillus subtilis according to the present invention preferably comprises an LB culture medium, and the LB culture medium according to the present invention preferably comprises 2wt.% peptone, 1wt.% yeast powder, 0.5wt.% NaCl and the balance water. The LB medium of the present invention is preferably autoclaved at 121℃for 20min before use. The invention has no strict requirement on the inoculation amount of the seed culture, and the inoculating loop is used for picking the exocarpium and placing the exocarpium into the seed culture solution for conventional operation. According to the invention, the bacillus subtilis is inoculated into a seed culture medium, so that the bacillus subtilis can be activated.
After the bacillus subtilis seed fermentation broth is obtained, the bacillus subtilis seed fermentation broth is inoculated into a fermentation medium for fermentation culture, and the bacillus subtilis bacterial broth is obtained. The seed fermentation liquid of the bacillus subtilis is preferably inoculated in an amount of 2-8% (v/v), and more preferably 5-6% (v/v). The temperature of the bacillus subtilis fermentation culture is preferably 30-37 ℃, and more preferably 35-36 ℃; the fermentation culture time is preferably 10 to 20 hours, more preferably 12 to 18 hours, and even more preferably 15 to 16 hours; the rotation speed of the fermentation culture is preferably 160 to 240rpm/min, more preferably 180 to 220rpm/min, and still more preferably 200rpm/min. The fermentation medium of the bacillus subtilis according to the present invention preferably comprises an LB medium, and the LB medium according to the present invention preferably comprises 2wt.% peptone, 1wt.% yeast powder, 0.5wt.% NaCl and the balance water. The LB medium of the present invention is preferably autoclaved at 121℃for 20min before use. The number of viable bacteria in the bacillus subtilis bacterial liquid is preferably more than or equal to 10 9 cfu/mL, further preferably 10 9 cfu/mL。
Before the rhodotorula mucilaginosa is inoculated to a fermentation culture medium, the rhodotorula mucilaginosa is preferably inoculated to a seed culture medium, and the rhodotorula mucilaginosa seed fermentation broth is obtained by culture. The temperature for culturing the rhodotorula mucilaginosa is preferably 25-35 ℃, and more preferably 28-30 ℃; the time for culturing the rhodotorula mucilaginosa is preferably 45-52 hours, more preferably 48-50 hours; the rotation speed of the rhodotorula mucilaginosa culture is preferably 170 to 240rpm/min, more preferably 180 to 210rpm/min, and still more preferably 200rpm/min. The seed medium of rhodotorula mucilaginosa according to the present invention preferably comprises YPD medium, and the YPD medium according to the present invention preferably comprises peptone 2wt.%, yeast powder 1wt.%, glucose 2wt.% and the balance water. The YPD medium of the invention is preferably autoclaved for 20min at 121℃before use. The invention has no strict requirement on the inoculation amount of the seed culture, and the inoculating loop is used for picking the exocarpium and placing the exocarpium into the seed culture solution for conventional culture. According to the invention, the rhodotorula mucilaginosa is inoculated into a seed culture medium, so that the activation of the rhodotorula mucilaginosa can be realized.
After rhodotorula mucilaginosa seed fermentation broth is obtained, the rhodotorula mucilaginosa seed fermentation broth is inoculated into a fermentation medium, and fermentation culture is carried out to obtain rhodotorula mucilaginosa broth. The seed fermentation liquid of rhodotorula mucilaginosa is preferably inoculated in an amount of 3 to 6% (v/v), and more preferably 4 to 5% (v/v). The temperature of the rhodotorula mucilaginosa fermentation culture is preferably 25-35 ℃, and more preferably 28-30 ℃; the time of the culture is preferably 45 to 52 hours, more preferably 48 to 50 hours; the rotation speed of the culture is preferably 170 to 240rpm/min, more preferably 180 to 210rpm/min, and still more preferably 200rpm/min. The seed medium of rhodotorula mucilaginosa according to the present invention preferably comprises YPD medium, and the YPD medium according to the present invention preferably comprises peptone 2wt.%, yeast powder 1wt.%, glucose 2wt.% and the balance water. The YPD medium of the invention is preferably autoclaved for 20min at 121℃before use. The viable count in the rhodotorula mucilaginosa liquid is preferably more than or equal to 10 9 cfu/mL, further preferably 10 9 cfu/mL。
Before the Siamese bacillus is inoculated to a fermentation culture medium, the Siamese bacillus is preferably inoculated to a seed culture medium, and the Siamese bacillus seed fermentation broth is obtained by culture. The temperature for culturing the Siamese bacillus is preferably 35-48 ℃, and more preferably 40-45 ℃; the time for culturing the Siamese bacillus is preferably 10 to 20 hours, more preferably 12 to 18 hours, and even more preferably 15 to 16 hours; the method for culturing the Siamese bacillus is preferably stationary culture. The seed culture medium of the Siamese bacillus preferably comprises an MRS culture medium, wherein the MRS culture medium comprises 2.5wt.% of peptone, 0.8wt.% of yeast powder, 0.4wt.% of NaCl and the balance of water. The MRS medium of the present invention is preferably autoclaved at 121℃for 20min before use. The invention has no strict requirement on the inoculation amount of the seed culture, and the inoculating loop is used for picking the exocarpium and placing the exocarpium into the seed culture solution for conventional culture. According to the invention, the Siamese bacillus is inoculated into a seed culture medium, so that the activation of the Siamese bacillus can be realized.
After the Siamese bacillus seed fermentation broth is obtained, the Siamese bacillus seed fermentation broth is inoculated into a fermentation medium for fermentation culture, and the Siamese bacillus broth is obtained. The seed fermentation broth of the Siamese bacillus is preferably 0.5-2% (v/v), and more preferably 1-1.5% (v/v). The temperature of the fermentation culture of the Siamese bacillus is preferably 35-48 ℃, and more preferably 40-45 ℃; the time of the culture is preferably 10 to 20 hours, more preferably 12 to 18 hours, still more preferably 15 to 16 hours; the culture mode is preferably stationary culture. The seed culture medium of the Siamese bacillus preferably comprises an MRS culture medium, wherein the MRS culture medium comprises 2.5wt.% of peptone, 0.8wt.% of yeast powder, 0.4wt.% of NaCl and the balance of water. The MRS medium of the present invention is preferably autoclaved at 121℃for 20min before use. The number of viable bacteria in the Siamese bacillus bacterial liquid is preferably more than or equal to 10 9 cfu/mL, further preferably 10 9 cfu/mL。
After the bacillus subtilis liquid, the rhodotorula mucilaginosa liquid and the bacillus siamensis liquid are obtained, the bacillus subtilis liquid, the rhodotorula mucilaginosa liquid and the bacillus siamensis liquid are mixed to obtain the composite bacterial liquid. The volume ratio of the bacillus subtilis bacterial liquid to the rhodotorula mucilaginosa bacterial liquid to the Siamese bacillus bacterial liquid is preferably 1-2: 1-2: 1 to 2. In the specific implementation process, the invention can be implemented in the following steps of 1-2: 1-2: 1 to 2, preferably 1:2:1 or 1:1:2 or 2:1:1.
the invention carries out solid state fermentation on the composite bacterial liquid to obtain a solid state fermentation product. The solid state fermentation temperature is preferably 30-36 ℃, and more preferably 32-35 ℃; the solid state fermentation time is preferably 18 to 35 hours, more preferably 20 to 30 hours, and even more preferably 25 to 28 hours. The inoculation amount of the composite bacterial liquid is preferably 20wt.% to 50wt.%, more preferably 25wt.% to 45wt.%, even more preferably 30wt.% to 40wt.%, and most preferably 35wt.%. In the solid state fermentation according to the present invention, the moisture content of the fermentation material is preferably maintained at 60wt.% to 80wt.%, more preferably at 65wt.% to 75wt.%, and still more preferably at 68wt.% to 70wt.%. The solid state fermentation culture medium preferably comprises 45-70 wt.% of bran, 10-25 wt.% of corn meal, 15-20 wt.% of soybean meal, 1-5 wt.% of brown sugar, 1-5 wt.% of ammonium sulfate and 0.1-0.8 wt.% of calcium carbonate; the bran content is further preferably 50wt.% to 65wt.%, more preferably 55wt.% to 60wt.%, most preferably 60wt.%; the corn flour is further preferably present in an amount of 12wt.% to 23wt.%, more preferably 15wt.% to 20wt.%, most preferably 20wt.%; the content of the soybean meal is further preferably 16wt.% to 18wt.%, more preferably 15.7wt.%; the content of brown sugar is further preferably 2wt.% to 4wt.%, more preferably 2wt.%; the content of ammonium sulfate is further preferably 1wt.% to 3wt.%, more preferably 2wt.%; the content of the calcium carbonate is further preferably 0.1wt.% to 0.8wt.%, more preferably 0.2wt.% to 0.6wt.%, and most preferably 0.3wt.%. The solid state fermentation medium according to the invention is preferably autoclaved for 20min at 121℃before use.
After the solid fermentation product is obtained, the invention preferably carries out drying treatment and crushing treatment to obtain the composite microbial agent fermentation product. The drying treatment temperature of the present invention is preferably 40 to 55℃and more preferably 45 to 50 ℃. The time of the drying treatment is not strictly required, and the water content of the solid state fermentation product is reduced to 15-18 wt%. The drying treatment mode is not strictly required, the particle size of the solid state fermentation product is reduced to 40-60 meshes, and a pulverizer is preferably used for pulverizing.
According to the invention, seed culture is carried out on bacillus subtilis, rhodotorula mucilaginosa and bacillus siamensis respectively, fermentation culture is carried out, and the obtained bacillus subtilis fermentation liquor, rhodotorula mucilaginosa fermentation liquor and bacillus siamensis fermentation liquor are mixed for solid fermentation, so that a process for producing the feed fermented feed by multi-strain mixed bacteria solid fermentation is created, and the number of viable bacteria in fermentation and the corresponding yield of beneficial metabolites in the product can be improved. The brown sugar amount is an important parameter affecting the yield of the corresponding beneficial metabolite (such as carotenoid) and antagonistic pathogenic bacteria metabolite when solid state fermentation is carried out. The invention adopts a solid-liquid two-phase fermentation method, the fermentation initial strain adopts liquid fermentation culture, and the feed fermentation product adopts a solid fermentation mode to prepare the composite microbial inoculum, the final total viable count and the metabolite content of the fermentation product are high, and the total viable count and the carotenoid yield of the fermentation are up to (2.4+/-0.11) multiplied by 10 10 cfu/g, carotenoid yield is up to 728.84 + -3.21 μg/g. The fermentation process is convenient to operate, the components of the culture medium are simple, and the solid culture cost is low.
According to the characteristics of the composite microbial agent fermented product after fermentation, the following contents are all within the protection scope of the invention: application of the composite microbial agent ferment in preparing one or more of livestock and poultry feed, bacteriostat and carotenoid; the application of the composite microbial inoculum ferment in promoting the growth and/or improving the immunity of livestock and poultry animals. The bacteriostatic agent of the present invention preferably includes a bacteriostatic agent that inhibits one or more of escherichia coli, staphylococcus aureus, salmonella typhimurium, shigella and listeria monocytogenes, and more preferably a bacteriostatic agent that simultaneously inhibits escherichia coli, staphylococcus aureus, salmonella typhimurium, shigella and listeria monocytogenes.
The invention also provides a feed additive, and the active ingredients comprise the composite microbial inoculum or the composite microbial inoculum ferment according to the technical scheme. The mass percentage of the composite microbial inoculum ferment in the feed additive is preferably 1-7%, and more preferably 3-5%. The feed additive disclosed by the invention is rich in carotenoid, can enhance immunity, reduce diarrhea rate and death rate of poultry, improve laying rate of poultry, deepen yolk color of poultry and effectively improve quality of poultry animal products.
The invention also provides a bacteriostatic agent, and the active ingredients comprise the composite microbial agent or the composite microbial agent fermentation product according to the technical scheme. The antibacterial agent has an inhibition effect on inhibiting escherichia coli, staphylococcus aureus, salmonella typhimurium, shigella and listeria monocytogenes.
The technical solutions provided by the present invention are described in detail below with reference to the drawings and examples for further illustrating the present invention, but they should not be construed as limiting the scope of the present invention.
Example 1
1.1 isolation and identification of Rhodotorula mucilaginosa JAASRY1 Strain
(1) Physiological and biochemical analysis
10g of soil polluted by edible oil from Simen of Jilin national institute of agricultural science, jilin province, princess, jilin City, is collected, put into a sterilized kraft paper bag, the mouth of the bag is sealed, and records are made. Directly placing the potato into a triangular flask filled with 90mL of sterile water without flushing, oscillating for 10min at room temperature in an oscillating incubator, taking supernatant, inoculating the supernatant into a potato glucose culture solution tube, placing the potato glucose culture solution tube into a constant temperature incubator, culturing for 1-2 d at the temperature of 28-30 ℃, and observing that the culture solution becomes turbid. And (3) taking bacterial liquid for gradient dilution, sucking 0.lmL of the diluted culture liquid by a pipetting gun, coating the culture liquid on a potato glucose culture medium plate, and culturing for 1-2 d at 28-30 ℃. A typical single colony (colony is round or oval, sticky, pink in color, large and thick, easy to pick, and low in gloss) was selected according to colony morphology, JAASRY1 was named, and its physiological and biochemical characteristics were analyzed by carbon source assimilation experiments (see (Kong Weibao, yang Yang, chen Dong, wangyang, up to Wen Yan, niu Shi, all.1 strain carotenoid-producing bacteria identification and optimization of fermentation medium [ J ]. Food science, 2018,39 (24): 108-115; buttney A, paenRW, asid. Characteristics and identification handbook [ M ] Hu Ruiqing, qingdao: qingdao ocean university publication, 1991)), and the results are shown in Table 1.
TABLE 1 physiological and biochemical test of Rhodotorula mucilaginosa JAASRY1
As is clear from Table 1, this strain can use 16 kinds of sugars such as glucose, fructose, galactose, sucrose, and mannose, cannot use lactose and soluble starch, can use glycerol, mannitol, succinic acid, citric acid, malic acid, and glycine, and cannot use p-aminobenzoic acid, erythritol, ribitol, inositol, sorbitol, and sorbic acid.
(2) 26SrDNAD1/D2 region sequence analysis
The 26S rDNA D1/D2 region sequence of the strain JAASRY1 is analyzed, the 26S rDNA D1/D2 gene sequence is preferably shown as SEQ ID NO.1, specifically 5'-GGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAGCGGCGAGCGAAGCGGGAAGAGCTCAAATTTATAATCTGGCACCTTCGGTGTCCGAGTTGTAATCTCTAGAAATGTTTTCCGCGTTGGACCGCACACAAGTCTGTTGGAATACAGCGGCATAGTGGTGAGACCCCCGTATATGGTGCGGACGCCCAGCGCTTTGTGATACATTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAATTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAACAGTACGTGAAATTGTTGGAAGGGAAACGCTTGAAGTCAGACTTGCTTGCCGAGCAATCGGTTTGCAGGCCAGCATCAGTTTTCCGGGATGGATAATGGTAGAGAGAAGGTAGCAGTTTCGGCTGTGTTATAGCTCTCTGCTGGATACATCTTGGGGGACTGAGGAACGCAGTGTGCCTTTGGCGGGGGTTTCGACCTCTTCACACTTAGGA-3', a phylogenetic tree shown in the figure 1 is constructed according to the highest similarity sequence provided by GenBank by using Blast, the closest relationship with Rhodotorulamucilaginosa CBS is found, the colony characteristics and the physiological and biochemical characteristics on a plate are combined, the isolated strain JAASRY1 is identified as rhodotorula mucilaginosa and named as Rhodotorula mucilaginosa JAASRY1, and the rhodotorula mucilaginosa is preserved in China center for type culture collection (CGMCC) for 7 months 14 in 2021, and the preservation number is CGMCC No.22900.
Example 2
Bacterial strain antibacterial capacity detection
(1) Culturing the bacillus subtilis JLCC513 for 16-20 hours at the constant temperature of 37 ℃, centrifuging for 10min at 8000r/min, taking supernatant to obtain bacillus subtilis JLCC513 supernatant, respectively soaking filter paper sheets with the diameter of 0.8cm in 5mL of the separated bacillus subtilis JLCC513 supernatant for 15min;
(2) Culturing rhodotorula mucilaginosa JAASRY1 at constant temperature of 30 ℃ for 36-48 hours, centrifuging at 8000r/min for 10min, collecting supernatant to obtain rhodotorula mucilaginosa JAASRY1 supernatant, respectively soaking filter paper sheets with diameter of 0.8cm in 5mL of separated rhodotorula mucilaginosa JAASRY1 supernatant for 15min;
(3) Culturing Siamese bacillus JAASHD for 18-22 hours at the constant temperature of 37 ℃, centrifuging for 10min at 8000r/min, taking supernatant to obtain Siamese bacillus JAASHD supernatant, respectively soaking filter paper sheets with the diameter of 0.8cm in 5mL of separated Siamese bacillus JAASHD supernatant for 15min;
(4) The supernatant of bacillus subtilis JLCC513, rhodotorula mucilaginosa JAASRY1 and the supernatant of bacillus siamensis JAASHD were mixed according to a ratio of 1:2:1, respectively soaking filter paper sheets with the diameter of 0.8cm in 5mL of separated composite microbial inoculum supernatant for 15min;
(5) The same procedure as in step (4) is followed except that the supernatant of Bacillus subtilis JLCC513, the supernatant of Rhodotorula mucilaginosa JAASRY1 and the supernatant of Bacillus siamensis JAASHD are prepared according to a procedure of 2:1:1, respectively soaking filter paper sheets with the diameter of 0.8cm in 5mL of separated composite microbial inoculum supernatant for 15min;
(6) The same procedure as in step (4) is followed except that the supernatant of Bacillus subtilis JLCC513, the supernatant of Rhodotorula mucilaginosa JAASRY1 and the supernatant of Bacillus siamensis JAASHD are mixed according to a ratio of 1:1:2, respectively soaking filter paper sheets with the diameter of 0.8cm in 5mL of separated composite microbial inoculum supernatant for 15min.
After the filter paper is soaked for 15min in each step, the following treatment is carried out: coli (escherichia coli) CMCC44825, staphylococcus aureus (Staphylococcus aureus) CMCC26071, salmonella typhimurium (Salmonella typhimurium) CMCC50, shigella flexneri (shigella flexneri) CMCC51061 and listeria monocytogenes (Listeria monocytogenes) ATCC19115 are taken as indicator bacteria, 50 μl of each indicator bacteria are respectively and uniformly coated on a nutrient agar plate, and the plates are kept stand for 20min, and then are put on prepared filter paper sheets, and are cultured for 20 hours at the constant temperature of 37 ℃, so that the antibacterial condition is observed. The diameter of the inhibition zone is measured by a vernier caliper, and the inhibition activity is represented by the diameter of the inhibition zone. Coli, staphylococcus aureus, salmonella typhimurium, shigella are purchased from the cantonese microorganism germplasm resource library, and listeria monocytogenes is purchased from Shanghai micro technology limited.
The pathogenic bacteria-repressing ability is shown in Table 1:
TABLE 1 test of pathogenic bacteria inhibitory ability of strains
As can be seen from Table 1, bacillus subtilis JLCC513 has no inhibitory effect on Listeria monocytogenes, rhodotorula mucilaginosa JAASRY1 has no inhibitory effect on Salmonella typhimurium and Listeria monocytogenes, bacillus siamensis JAASHD has no inhibitory effect on Shigella, and all three strains have a certain inhibitory effect on other pathogenic bacteria. After the three strains are mixed, the inhibition effect on all the 5 pathogenic bacteria is achieved, the inhibition capability is enhanced compared with that of a single strain, and when the fermentation supernatant of bacillus subtilis JLCC513, the fermentation supernatant of rhodotorula mucilaginosa JAASRY1 and the fermentation supernatant of bacillus siamensis JAASHD are mixed at a ratio of 1:2:1, the synergistic effect on the inhibition capability of all pathogenic bacteria is optimal.
Example 3
Preparation of composite microbial agent fermentation product
1. Preparation of composite microbial inoculum fermentation liquor
(1) The dried plants to be stored on the inclined planeScraping a loop of bacillus JLCC513 strain, inoculating into a shake flask filled with 50mL of LB culture medium (peptone 20g, yeast powder 10g, naCl 5g, adding water to a constant volume of 1L, sterilizing at 121 ℃ for 20 min), and culturing in a shaking incubator at 37 ℃ for 12h at 200rpm to obtain bacillus JLCC513 seed fermentation broth; inoculating 3% of seed fermentation broth into 1000mL LB culture broth according to volume percentage (v/v), placing into a shake incubator at 37deg.C, and culturing at 200rpm for 18h to obtain Bacillus subtilis JLCC513 fermentation broth with viable count of 1.18X10 9 cfu/mL。
(2) Scraping a ring of Rhodotorula glabra JAASRY1 strain stored on an inclined plane, inoculating into a shake flask containing 50mLYPD culture medium (peptone 20g, yeast powder 10g, glucose 20g, adding water to constant volume to 1L, sterilizing at 115 deg.C for 20 min), and culturing in a shake incubator at 30deg.C at 200rpm for 48 hr to obtain Rhodotorula glabra JAASRY1 seed fermentation broth; inoculating 5% of seed fermentation liquor into 1000mL YPD culture solution according to volume percentage (v/v), placing into 30 ℃ shake incubator, culturing at 200rpm for 36h to obtain rhodotorula mucilaginosa JAASRY1 seed fermentation liquor, and the viable count of fermentation liquor is 1.02X10% 9 cfu/mL。
(3) Scraping a ring of Siamese bacillus JAASHD stored on an inclined plane, inoculating the ring to a test tube of 10mL MRS culture medium (25 g of peptone, 8g of yeast powder and 4g of NaCl, adding water to a constant volume to 1L, sterilizing at 121 ℃ for 20 min), and placing the test tube into a constant temperature incubator at 37 ℃ for static culture for 12h to obtain Siamese bacillus JAASHD seed fermentation broth; inoculating 1% of seed fermentation liquor into 1000mL of LB culture solution according to volume percentage (v/v), placing into a constant temperature incubator at 37 ℃ for static culture for 18h to obtain Siamese bacillus JAASHD fermentation liquor, wherein the viable count of the fermentation liquor is 1.15X10% 9 cfu/mL。
(4) The three fermentation broths are mixed according to volume 1:2:1 to obtain a composite microbial inoculum fermentation broth, and can be put into a refrigerator at 4 ℃ for standby.
2. Inoculating the composite microbial inoculum fermentation liquor prepared in the step 1 into a solid fermentation medium (the solid fermentation medium comprises (w/w) 60% of bran, 20% of corn meal, 15.7% of bean pulp, 2% of brown sugar, 2% of ammonium sulfate and 0.3% of calcium carbonate) according to the mass percentage content of 25%, placing the solid fermentation medium into a fermentation warehouse, maintaining the temperature at 35 ℃, maintaining the moisture of fermentation materials at 63% through ventilation, and culturing for 28 hours to terminate fermentation. And taking out the fermented material, putting the fermented material into a drying chamber, carrying out ventilation drying, and keeping the indoor temperature at 46 ℃ until the moisture of the material is reduced to 12%, and terminating drying. Crushing the dried fermentation material by a crusher, and sieving the crushed material by a 50-mesh sieve to obtain the composite microbial agent fermentation product.
Examples 4 to 6 and comparative examples 4 to 6
A complex microbial inoculant fermentate was prepared in the same manner as in example 3, wherein examples 4-6 and comparative examples 4-6 differ from example 3 in the different amounts of brown sugar in the solid state fermentation medium (Table 4 below), and the total viable count of the fermentation and the carotenoid yield are shown in Table 4.
Table 4 brown sugar content of the solid state fermentation media of examples 3 to 6 and comparative examples 4 to 6.
As can be seen from Table 4, when the amount of brown sugar added is less than 1wt.% or more than 3wt.%, the total viable count of the fermentation is reduced, and the carotenoid yield is lowered.
Example 6
Application effect of solid-state fermentation feed in beef cattle cultivation
The beef cattle feeding test is carried out on 80 healthy bull with the age of 4-5 months, the weight range is 185+/-12.4 kg, and the test is carried out on a princess mountain beef cattle farm. The animals were randomly divided into four groups, namely, a control group 1 and a test group 3, each group having 20 heads, according to the principle that the basic differences in body weight were not significant. The control group was fed with a normal basic ration, the test group 1 was fed with a basic ration + the complex microbial agent ferment obtained in example 3 (wherein the mass percentage of the complex microbial agent ferment was 3%, denoted as 3% test group), the test group 2 was fed with a basic ration + the complex microbial agent ferment obtained in example 3 (wherein the mass percentage of the complex microbial agent ferment was 5%, denoted as 5% test group), and the test group 3 was fed with a basic ration + the complex microbial agent ferment obtained in example 3 (wherein the mass percentage of the complex microbial agent ferment was 7%, denoted as 7% test group). The test period is 60 days, the early adaptation period is 10 days, and the formal period is 50 days. The growth performance, diarrhea rate and immunological competence change of beef cattle were measured, and specific results are shown in tables 5 to 6 below.
TABLE 5 Effect of Compound inoculant ferments on beef cattle growth performance and diarrhea Rate
TABLE 6 influence of solid state fermented feeds on beef cattle serum immune index
As can be seen from tables 5-6, at the end of the feeding test, the average daily gain of the beef cattle in the different groups did not change significantly, but the average weight gain of the beef cattle fed with the solid-state fermented feed with different additive amounts of the complex microbial agent fermented product was slightly increased compared with the results of the control group, and the average weight gain of the beef cattle fed with the solid-state fermented feed with different additive amounts of the complex microbial agent fermented product was respectively increased by 8.1%, 9.79% and 12.4% compared with the results of the control group. The diarrhea rate of the beef cattle in the group added with the solid-state fermentation feed is far lower than that of the beef cattle in the control group, and the diarrhea rate of the beef cattle in the test group is respectively reduced by 16.8 percent, 37.2 percent and 37.9 percent compared with that of the control group during the whole feeding test period, which shows that the diarrhea rate of the beef cattle can be obviously reduced by adding the composite microbial inoculum ferment of the embodiment 3 on the basis of common basic ration; at the end of the feeding test, the results of the test groups with different addition amounts are compared with those of the control groups, the immune indexes of the beef serum of the solid-state fermentation feed fed with the composite microbial inoculum fermented products with different addition amounts are improved, but the addition amount of 7% is not obviously improved compared with that of 5%. From the viewpoint of production economic benefit, the 5% addition amount is the preferential addition amount, and the IgG, igA, igM content in the mutton sheep serum is respectively improved by 17.85%, 23.73% and 28.4% compared with the control group. The solid state fermented feed can improve the immune factor level in beef calf serum. From the viewpoint of the balance between the production investment and the practical feeding effect, the maximum economic benefit is considered, and the 5% addition amount is the preferred addition amount.
Example 7
Application effect of solid-state fermentation feed in mutton sheep cultivation
The feeding test of the mutton sheep is carried out on 120 weaned healthy small-tailed han lambs with the weight range of 20.48+/-4.3 kg in a princess ridge mutton sheep farm. The animals were randomly divided into four groups, namely, a 1-group control group and 3-group test group, each group having 30 heads, according to the principle that the basic differences in body weight were not significant. The control group was fed with a general basic ration, 1 was fed with a basic ration + the complex microbial agent fermentate obtained in example 3 (wherein the mass percentage of the complex microbial agent fermentate was 1%, denoted as 1% test group), the test group 2 was fed with a basic ration + the complex microbial agent fermentate obtained in example 3 (wherein the mass percentage of the complex microbial agent fermentate was 3%, denoted as 3% test group), and the test group 3 was fed with a basic ration + the complex microbial agent fermentate obtained in example 3 (wherein the mass percentage of the complex microbial agent fermentate was 5%, denoted as 5% test group). The test period is 97 days, the early adaptation period is 7 days, and the formal period is 90 days. The growth performance, diarrhea rate and immunocompetence changes are shown in tables 7-8 below.
TABLE 7 Effect of solid state fermented feeds on mutton sheep growth Performance and diarrhea Rate
TABLE 8 influence of solid state fermented feeds on serum immune index of mutton sheep
As can be seen from tables 7 to 8, at the end of the feeding test, the average daily gain of the meat sheep in different groups is obviously changed, and compared with the results of the control group, the weight gain of the meat cattle fed with the solid fermentation feed in different addition amounts is respectively improved by 5%, 26.67% and 20.0% compared with the results of the control group. The diarrhea rate of beef cattle in the group added with the composite microbial agent ferment is far lower than that in the control group, and the diarrhea rate of beef cattle in the group added with different composite microbial agent ferment in the whole feeding test period is reduced by 11.17%, 28.96% and 32.27% compared with that in the control group, so that the diarrhea rate of beef cattle can be obviously reduced by adding the composite microbial agent ferment. Under the addition of different composite microbial inoculum fermented products, the serum immune index of the mutton sheep is improved, but the addition of 5 percent is not obviously improved compared with the addition of 3 percent, and the content of IgG, igA, igM of the serum immune index of the mutton sheep is respectively improved by 24.93 percent, 20.61 percent and 5.76 percent compared with the control group. From the viewpoint of the balance between the production investment and the practical feeding effect, the maximum economic benefit is considered, and the 3% addition amount is the preferred addition amount.
Although the foregoing embodiments have been described in some, but not all, embodiments of the invention, it should be understood that other embodiments may be devised in accordance with the present embodiments without departing from the spirit and scope of the invention.
Sequence listing
<110> Jilin province academy of agricultural sciences
<120> a composite microbial agent, fermented product thereof and use thereof
<160> 1
<170> SIPOSequenceListing 1.0
<210> 1
<211> 555
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 1
ggaggaaaag aaactaacaa ggattcccct agtagcggcg agcgaagcgg gaagagctca 60
aatttataat ctggcacctt cggtgtccga gttgtaatct ctagaaatgt tttccgcgtt 120
ggaccgcaca caagtctgtt ggaatacagc ggcatagtgg tgagaccccc gtatatggtg 180
cggacgccca gcgctttgtg atacattttc gaagagtcga gttgtttggg aatgcagctc 240
aaattgggtg gtaaattcca tctaaagcta aatattggcg agagaccgat agcgaacaag 300
taccgtgagg gaaagatgaa aagcactttg gaaagagagt taacagtacg tgaaattgtt 360
ggaagggaaa cgcttgaagt cagacttgct tgccgagcaa tcggtttgca ggccagcatc 420
agttttccgg gatggataat ggtagagaga aggtagcagt ttcggctgtg ttatagctct 480
ctgctggata catcttgggg gactgaggaa cgcagtgtgc ctttggcggg ggtttcgacc 540
tcttcacact tagga 555
Claims (5)
1. The composite microbial inoculum is characterized by comprising the following components: bacillus subtilis (Bacillus subtilis), rhodotorula mucilaginosa (rhodotorula mucilaginosa) and bacillus siamensis (Bacillus siamensis);
the viable count of the bacillus subtilis is more than or equal to 10 9 cfu/mL; the viable count of the rhodotorula mucilaginosa is more than or equal to 10 9 cfu/mL; the viable count of the Siamese bacillus is more than or equal to 10 9 cfu/mL；
The volume ratio of the bacillus subtilis to the rhodotorula mucilaginosa to the bacillus siamensis is 1-2: 1-2: 1 to 2;
the bacillus subtilis is bacillus subtilis JLCC513, and the preservation number is CGMCC No.20625; the rhodotorula mucilaginosa is rhodotorula mucilaginosa JAASRY1, and the preservation number is CGMCC No.22900; the Siamese bacillus is Siamese bacillus JAASHD, and the preservation number is CGMCC No.12903.
2. A composite microbial agent fermented product, characterized in that the composite microbial agent is obtained by fermentation according to claim 1;
the preparation method of the composite microbial inoculant ferment comprises the following steps:
inoculating the bacillus subtilis, rhodotorula mucilaginosa and the Siamese bacillus into a fermentation medium for fermentation culture to obtain bacillus subtilis bacterial liquid, rhodotorula mucilaginosa bacterial liquid and Siamese bacillus bacterial liquid;
mixing the bacillus subtilis bacterial liquid, the rhodotorula mucilaginosa bacterial liquid and the bacillus siamensis bacterial liquid, and performing solid fermentation to obtain a solid fermentation product;
the solid state fermentation product contains the composite microbial agent fermentation product;
the fermentation medium of the bacillus subtilis comprises an LB medium; the fermentation medium of the rhodotorula mucilaginosa comprises YPD medium; the fermentation medium of the Siamese bacillus comprises an MRS medium;
the solid state fermentation medium comprises: 45-70 wt.% of bran, 10-25 wt.% of corn meal, 15-20 wt.% of soybean meal, 1-5 wt.% of brown sugar, 1-5 wt.% of ammonium sulfate and 0-1-0 8wt.% of calcium carbonate. The solid state fermentation time is 18-35 h, and the temperature is 30-36 ℃.
3. Use of the complex inoculant of claim 1 or the complex inoculant ferment of claim 2 in any one or more of the following A1-A3:
a1, preparing livestock animal feed;
a2, preparing a bacteriostat;
a3, preparing carotenoid.
4. Use of the complex microbial inoculant of claim 1 or the complex microbial inoculant ferment of claim 2 for promoting growth and/or enhancing immunity of a livestock animal.
5. A feed additive or bacteriostatic agent, characterized in that the active ingredient comprises the composite microbial agent of claim 1 or the composite microbial agent ferment of claim 2.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210504056.5A CN114874940B (en) | 2022-05-10 | 2022-05-10 | Composite microbial agent, fermented product thereof and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210504056.5A CN114874940B (en) | 2022-05-10 | 2022-05-10 | Composite microbial agent, fermented product thereof and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN114874940A CN114874940A (en) | 2022-08-09 |
| CN114874940B true CN114874940B (en) | 2023-07-14 |
Family
ID=82674853
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202210504056.5A Active CN114874940B (en) | 2022-05-10 | 2022-05-10 | Composite microbial agent, fermented product thereof and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN114874940B (en) |
Family Cites Families (12)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101779733B (en) * | 2010-03-29 | 2012-12-26 | 济南环亿生物科技有限公司 | Feed additive for improving collagen in livestock and poultry muscle and production method thereof and application thereof |
| CN102599335B (en) * | 2012-03-07 | 2013-10-30 | 哈尔滨市海澳斯生物科技开发有限公司 | Method for preparing compound microorganism fermented forage feed |
| CN103614327B (en) * | 2013-11-27 | 2016-03-30 | 北京昕大洋科技发展有限公司 | A kind of subtilis and uses thereof |
| CN103981118B (en) * | 2013-12-24 | 2017-11-03 | 北京大伟嘉生物技术股份有限公司 | A kind of bacillus subtilis feed addictive and its preparation method and application |
| CN104130952B (en) * | 2014-04-03 | 2016-06-08 | 河南师范大学 | One strain rhodotorula mucilaginosa and the application in fermentative production carotenoid and grease thereof |
| CN104099276B (en) * | 2014-07-16 | 2016-08-24 | 湖南省微生物研究院 | One bacillus subtilis AP139 and fermenting agent thereof and their application process |
| CN104846049A (en) * | 2015-05-13 | 2015-08-19 | 威海利达生物科技有限公司 | Method for improving fermentation productivity of carotenoid |
| CN106010990B (en) * | 2016-05-13 | 2019-08-30 | 西南大学 | A kind of rhodotorula mucilaginosa and its fermentation culture medium and application |
| CN108208316B (en) * | 2018-01-24 | 2021-02-02 | 吉林省农业科学院 | Siamese bacillus-containing feed |
| CN114097937A (en) * | 2020-08-26 | 2022-03-01 | 河北科星药业有限公司 | Feed additive for preventing diarrhea and improving immunity and preparation method and application thereof |
| CN112293591B (en) * | 2020-11-03 | 2023-04-11 | 贵州省畜牧兽医研究所 | Green functional feed for improving growth performance and immunity of calves and preparation method thereof |
| CN112501062A (en) * | 2020-11-27 | 2021-03-16 | 吉林省农业科学院 | Bacillus subtilis for producing levansucrase and application thereof |
-
2022
- 2022-05-10 CN CN202210504056.5A patent/CN114874940B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN114874940A (en) | 2022-08-09 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107603924B (en) | Compound microbial preparation and preparation method and application thereof | |
| CN101690545B (en) | Method for producing complex micro-ecological preparation with microbial agents and enzyme | |
| CN101869184B (en) | Microbial feed additive and preparation method thereof | |
| CN105385616B (en) | The bacillus subtilis of efficient degradation zearalenone and its application | |
| CN106260540B (en) | Biological feed for creep feed and creep feed | |
| CN106260504B (en) | Method for producing microbial fermentation wet feed by using beer yeast paste | |
| CN102715339A (en) | Microorganism fodder production method based on pleurotus eryngii mushroom cultivating residues | |
| CN112457999B (en) | Selenium-enriched saccharomyces cerevisiae strain and application thereof | |
| CN111363684B (en) | Composite microbial inoculum for efficiently degrading wood fibers and application thereof in composting | |
| CN105002116A (en) | Microorganism straw feed microbial agent and preparation method thereof | |
| CN109022333A (en) | A kind of preparation method and applications of composite microbial fermentation bacteria agent | |
| CN111642622A (en) | Preparation and application of fermentation composite bacteria and myrtle fermentation extract | |
| CN101088362B (en) | Fish and shrimp phagostimulant of fermented product adhesion protein and its preparation process | |
| CN103184174A (en) | Production method of bacillus subtilis biological agent used for sodium humate-containing feed in medium | |
| CN111593010B (en) | Lactobacillus plantarum and method for producing fermented feed by using same | |
| CN110269146A (en) | A kind of probiotics applied on feed | |
| CN112961806B (en) | Bacillus coagulans for high-yield lactic acid, biological fermentation feed and preparation method and application thereof | |
| CN114532460A (en) | Application of mixed bacteria in microbial fermented feed of kelp and gulfweed and preparation method thereof | |
| CN103074228B (en) | Composite fermentation inoculant for processing animal wastes, and preparation method and application thereof | |
| CN117070427B (en) | Lactobacillus buchneri and silage starter thereof | |
| CN110819555B (en) | High-temperature-resistant Brevibacillus reuteri NJAU-N20 for efficiently degrading wood fibers and application thereof | |
| CN114874940B (en) | Composite microbial agent, fermented product thereof and application thereof | |
| CN110897053B (en) | Fly-expelling traditional Chinese medicine fermented feed for improving egg quality of laying hens and preparation method and application thereof | |
| CN106834164A (en) | For the Chinese yew solid medium and its application method of feed | |
| CN113598270A (en) | Preparation method of chrysanthemum leaf microbial fermentation feed |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |