CN114831023A - Efficient genetic transformation method for cauliflower by taking flower stalks as explants - Google Patents

Abstract

The invention discloses a high-efficiency genetic transformation method of cauliflower by taking flower stalks as explants, which comprises the following steps: (1) selecting a pedicel explant: taking loose cauliflower as a donor plant, and selecting a pedicel with the transverse diameter of 0.3-0.8 cm as an explant; (2) sterilizing the explant; (3) pre-culturing explants; (4) carrying out dip dyeing on the explants; (5) co-culturing the explant and the bacterial liquid; (6) delayed culture of explants; (7) screening and culturing explants; (8) rooting culture of the resistant bud; (9) and (4) positive detection of the regenerated plant. The method of the invention establishes the high-efficiency genetic transformation with the cauliflower pedicel as the explant for the first time, combines the PCR detection and GUS dyeing results, the positive rate of the genetic transformation plant reaches 10-15%, and can directly regenerate and bud without the induction of callus in the regeneration process of the pedicel bud, thereby greatly shortening the time required by bud regeneration.

Description

Efficient genetic transformation method for cauliflower by taking flower stalks as explants

Technical Field

The invention relates to a high-efficiency genetic transformation method for cauliflowers, in particular to a high-efficiency genetic transformation method for cauliflowers by taking flower stalks as explants.

Background

Cauliflower (Brassica oleracea l.var. botrytis, 2n ═ 2x ═ 18) is an important characteristic vegetable of Brassica species in Brassica of brassicaceae, with the cauliflower as a product, and is widely cultivated and eaten worldwide. However, since the cauliflower originates from the coast of the mediterranean sea, the collected and identified cauliflower germplasm resources are very limited, so that the domestic self-bred cauliflower variety has defects in the aspects of curd commodity, pest resistance, high-temperature or severe cold climate tolerance and the like. Therefore, how to rapidly and directionally genetically improve the existing germplasm by using genetic engineering means becomes one of the most important issues in the field of breeding research.

The agrobacterium-mediated genetic transformation technology can realize the rapid transfer and integration of exogenous excellent genes and the site-directed mutation of target endogenous genes, and provides a rapid and efficient solution for the directional creation of excellent germplasm. On the other hand, with the completion of genome sequencing work of cabbage, broccoli, cauliflower and other cabbage vegetable crops, massive genome data requires a reliable genetic transformation system for functional verification of target genes. Therefore, a simple and efficient cauliflower genetic transformation method is established, has important significance for molecular breeding and gene function research of cauliflowers, and provides reference for molecular function research of other cabbage vegetables.

To date, researches on genetic transformation of cabbage vegetables including cauliflower mainly focus on establishment of a bud regeneration system and optimization of genetic transformation conditions, and genetic transformation success reports are few, and the problems of low transformation efficiency, poor test repeatability and the like exist.

Disclosure of Invention

The invention aims to provide a method for efficient genetic transformation of cauliflowers by taking pedicels as explants, which solves the problem of genetic transformation of cauliflowers, and the method takes the pedicels as the explants, does not need induction of callus, can directly regenerate and bud, greatly shortens the time required by bud regeneration, and can achieve the positive rate of genetically transformed plants of 10-15%.

In order to achieve the above object, the present invention provides a method for efficient genetic transformation of cauliflower using pedicel as explant, comprising:

(1) selecting a pedicel explant: taking loose cauliflower as a donor plant, carrying out ball-stem drawing for 10-15 cm after a ball-flower matures for 10-20 days, selecting tender flower branches, removing small ball-flower at the top end, and selecting a pedicel with the transverse diameter of 0.3-0.8 cm as an explant; for the explant, if the transverse diameter of the explant is less than 0.3cm, the explant is too tender and weak in tolerance to agrobacterium, and the contact area of the incision and the staining solution is too small, so that the genetic transformation positive rate is remarkably reduced; the cross diameter of the explant is larger than 0.8cm, the incision area is too large, a large amount of quinone substances can be generated in the culture process, incision browning is accelerated, and the bud regeneration efficiency is obviously reduced. Therefore, the pedicel explant with the transverse diameter of 0.3-0.8 cm has higher bud regeneration capacity and stronger tolerance to agrobacterium simultaneously (when the agrobacterium is impregnated for 20-30 min, the browning degree of the explant is very low), and is most suitable for agrobacterium-mediated genetic transformation;

(2) and (3) sterilizing the explants: washing and sterilizing the pedicel;

(3) pre-culturing explants: sucking surface moisture of the sterilized pedicel, cutting wounds at two ends of the pedicel, cutting the explant into small sections with the length of 0.5-0.8cm, contacting the morphological upper end of the pedicel with a culture medium in a pre-culture medium of the explant, and pre-culturing at 23-25 ℃ for 5-7 days with illumination time of 16 h/d; wherein the explant pre-culture medium comprises: MS culture medium, 30g/L sucrose, 9g/L agar, 2.0 mg/L6-BA, 0.02mg/L NAA, 0.4-0.5 mg/L Trans-ZT, and pH is 5.6-6.0;

(4) and (3) carrying out dip dyeing on explants: placing the pre-cultured explant in an explant staining solution for staining; wherein, the preparation of the explant staining solution comprises the following steps: the agrobacterium strain GV3101 for constructing the target gene vector pCambia1301 is shake-cultured at 28 ℃ overnight to the bacterial liquid OD ₆₀₀ The bacterial liquid is centrifuged to 0.6-0.8, the supernatant is discarded, and the same volume of the supernatant is usedSuspending a sterile MS-sucrose solution, and adding acetosyringone with the final concentration of 20mg/L to obtain an explant staining solution; wherein the sterile MS-sucrose solution comprises: MS liquid culture medium and 20g/L sucrose; the nucleotide sequence of the target gene is shown as SEQ ID NO. 4;

(5) co-culturing explants and bacterial liquid: sucking up liquid on the surface of the impregnated explant, adding a piece of sterile filter paper on the surface layer of the explant co-culture medium, vertically placing the explant on the filter paper after the filter paper is wetted, enabling the morphological upper end of the pedicel to contact with the culture medium, and co-culturing for 3d under the dark condition; wherein the explant co-culture medium comprises: MS culture medium, 30g/L sucrose, 8g/L agar, 2.0 mg/L6-BA, 0.02mg/L NAA, 0.4-0.5 mg/L Trans-ZT, and pH is 5.6-6.0; sterile filter paper is paved on the surface layer of a co-culture medium, so that the pollution rate of the explant can be effectively reduced, the co-culture stage is an important stage of agrobacterium infection of incision cells of the explant, the activity of the agrobacterium in a dry environment can be greatly reduced and even die, the high humidity is favorable for maintaining the activity of the agrobacterium, and the infection positive rate is improved, so that the concentration of agar in the co-culture medium is smaller than that of other types of culture media, and the water content in the culture media is larger; the invention can carry out agrobacterium infection for a longer time (3d), but does not damage explants, and can improve the positive rate of regeneration plants;

(6) explant delayed culture: transferring the explants subjected to co-culture to an explant delay culture medium, contacting the morphological upper end of pedicel with the culture medium, and performing delay culture at 23-25 ℃ for 8 days with illumination time of 16 h/d; wherein the explant delay medium comprises: MS culture medium, 30g/L sucrose, 9g/L agar, 2.0 mg/L6-BA, 0.02mg/L NAA, 0.4-0.5 mg/L Trans-ZT and 300mg/L timentin, wherein the pH value is 5.6-6.0;

(7) screening and culturing explants: transferring the explants subjected to delayed culture to an explant screening culture medium, contacting the morphological lower end of the pedicel with the culture medium, screening and culturing at 23-25 ℃, wherein the illumination time is 16h/d, and screening and culturing for 13-15 d until resistant buds grow; wherein the explant screening medium comprises: MS culture medium, 30g/L sucrose, 9g/L agar, 2.0 mg/L6-BA, 0.02mg/L NAA, 0.4-0.5 mg/LTrans-ZT, 300mg/L timentin and 5mg/L hygromycin, wherein the pH value is 5.6-6.0;

due to polar transport of auxin, only the morphological upper section of the pedicel explant can directly bud, and the morphological lower end of the pedicel explant does not directly bud, so that during the process of genetic transformation, during pre-culture, co-culture and delayed culture, the morphological upper end of the pedicel explant contacts with a culture medium, absorbs nutrition and maintains certain humidity, and the rapid start of the bud regeneration process is promoted. During screening culture, the morphological lower end of the pedicel is contacted with the culture medium, and the morphological upper section is exposed in the air, so that the obstruction of agar to the regeneration bud is avoided, the generation of glass buds induced by the contact of the agar in a high-humidity environment is reduced, and the regeneration of normal resistant buds is greatly promoted;

(8) rooting culture of the resistant buds: cutting the regenerated resistant bud from the lower part of the growing point, transferring the cut resistant bud into a bud rooting culture medium, and culturing for 5-7 days to grow fibrous roots; wherein the shoot rooting medium comprises: MS culture medium, 0.05-0.1 mg/L NAA, 30g/L sucrose, 9g/L agar, 300mg/L timentin and 5mg/L hygromycin, and the pH value is 5.8-6.0;

(9) positive detection of regenerated plants: performing double detection through PCR and GUS staining to obtain positive plants, which are cauliflower genetic transformation positive seedlings; the PCR takes genome DNA of resistant seedling leaves after rooting as a template, nucleotide sequences of adopted primers are shown as SEQ ID NO.1 and SEQ ID NO.2, and the result is positive if a strip of a PCR product is 568 bp; and (4) the GUS staining shows that a blue dot on a white background of the leaf is positive.

Preferably, the pedicel sterilization uses a sterilization solution comprising: 70% ethanol and 4% sodium hypochlorite.

Preferably, the pedicel is sterilized: cutting the pedicel to 3-4 cm, sterilizing with a sterile solution, and then cleaning with sterile water.

Preferably, the soaking time of the explants is 20-30 min, and the shaking speed of a shaking table is 50-60 rpm.

Preferably, the PCR procedure is: 94 ℃ for 4 min; 30s at 94 ℃, 20s at 56 ℃, 30s at 72 ℃ and 32 cycles; extension at 72 ℃ for 10min and holding at 10 ℃.

Preferably, the GUS staining is: taking leaves of PCR detection positive plants, adding GUS staining working solution to enable the leaves to be completely immersed, and preserving heat for 10-24 hours at 25-35 ℃; transferring the leaves into 70% ethanol for decolorization for 3-4 times until a negative control is white, wherein the negative control is the leaves of plants which do not contain 568bp bands and are detected by PCR; the positive plants are observed by naked eyes with blue dots on the white background of the leaves.

The efficient cauliflower genetic transformation method taking the pedicel as the explant solves the problem of cauliflower genetic transformation, and has the following advantages:

the invention establishes an efficient genetic transformation method taking cauliflower pedicel as an explant for the first time, combines PCR detection and GUS dyeing results, and has the advantages that the positive rate of genetically transformed plants can reach 10-15%, the positive rate is obviously higher than that of the conventional method, and the time required by transformation is shorter. In the regeneration process of the pedicel buds, callus induction is not needed, the buds can be directly regenerated and germinated, and the regeneration and germination time is shorter, so that the regeneration time of the buds is greatly shortened. The method can realize regeneration of transgenic positive seedlings within 35 days, has short transformation time, stable transformation result, average transformation efficiency of 12.1 percent, higher test repeatability than the reported time and transformation efficiency required by cauliflower genetic transformation, and important significance for molecular breeding and gene function research of cauliflower.

Drawings

FIG. 1 is a photograph of regenerated shoots cultivated from cauliflower pedicels selected in the present invention.

FIG. 2 shows the PCR and GUS staining detection of the target gene of the cauliflower flower stalk resistant bud regeneration and regeneration plant of the invention.

FIG. 3 is a schematic structural diagram of plasmid pCambia1301-KY used in the present invention.

Detailed Description

The technical solutions in the embodiments of the present invention will be clearly and completely described below, and it is obvious that the described embodiments are only a part of the embodiments of the present invention, and not all embodiments. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.

Example 1

1. Preparation of culture medium

Comprises culture media of each stage of genetic transformation, and the components and the contents of the culture media are as follows:

(1) explant pre-culture medium: MS culture medium + sucrose 30g/L + agar 9g/L +6-BA 2mg/L + NAA 0.02mg/L + Trans-ZT 0.5mg/L (Trans-zeatin, CAS No.: 1637-39-4, purchased from Michelin), pH 5.8, and autoclaving at 121 ℃ for 20 min;

(2) explant co-culture medium: MS culture medium, sucrose 30g/L, agar 8g/L, 6-BA 2mg/L, NAA 0.02mg/L, Trans-ZT 0.5mg/L, pH 5.8, and autoclaving at 121 deg.C for 20 min;

(3) explant delay medium: MS culture medium, 30g/L of cane sugar, 9g/L of agar, 6-BA 2mg/L, NAA 0.02mg/L, Trans-ZT 0.5mg/L and 300mg/L of timentin, wherein the pH value is 5.8, and the culture medium is autoclaved for 20min at 121 ℃ (wherein the antibiotic timentin is added after being sterilized at high temperature and cooled to 60 ℃);

(4) explant screening medium: MS culture medium, 30g/L of cane sugar, 9g/L of agar, 6-BA 2mg/L, NAA 0.02mg/L, Trans-ZT 0.5mg/L, 300mg/L of timentin and 5mg/L of hygromycin, wherein the pH value is 5.8, and the culture medium is autoclaved for 20min at 121 ℃ (wherein the antibiotics timentin and hygromycin are added when the culture medium is cooled to 60 ℃ after being sterilized at high temperature);

(5) bud rooting culture medium: MS culture medium + NAA 0.1mg/L + sucrose 30g/L + agar 9g/L + timentin 300mg/L + hygromycin 5mg/L, pH 5.8, 121 ℃ autoclaving for 20 min.

2. Construction of cauliflower gene expression vector

(1) Cloning of genes

Primers were designed based on the sequence of the gene of interest Bol15337 (SEQ ID No.4) and the sequences were as follows:

CZ-15337-KpnI-F(SEQ ID NO.5)：

GCGGGTCGACGGTACCATGGGAGAAAGAGTGATAGAG；

CZ-15337-KpnI-R(SEQ ID NO.6)：

TAGACATATGGGTACCTTAACGTCTTCGAGCTGCAG。

RNA was extracted from a plant sample (i.e., a loose cauliflower ball), and the RNA was reverse-transcribed into cDNA (using the Vazyme HiScript 1st Strand cDNA Synthesis Kit), as follows:

(1.1) denaturation of RNA template

A mixture as shown in Table 1 below was prepared in RNase-free centrifuge tubes, heated at 65 ℃ for 5min, rapidly chilled on ice, and allowed to stand on ice for 2 min.

TABLE 1 shows the components of the mixture for denaturation of RNA template

(1.2) first Strand cDNA Synthesis

And (3) mixing the mixed solution obtained in the step (1.1) with 2 XRT Mix and HiScript II Enzyme Mix, specifically shown in Table 2, gently blowing and stirring the mixture by using a pipette, reacting at 50 ℃ for 45min, and reacting at 85 ℃ for 5 min.

Table 2 shows the composition of the mixture for cDNA Synthesis

(1.3) PCR amplification

PCR was performed using the above primers CZ-15337-KpnI-F and CZ-15337-KpnI-R (phanzyme corporation phanta max super-fidelity DNA Polymerase) using cDNA as a template.

The PCR reaction system (total volume 50. mu.L) is shown in Table 3 below:

the PCR reaction program is: 30s at 95 ℃; (95 ℃ for 15s, annealing temperature of 45-55 ℃ for 15s, extension of 72 ℃ for 1min) x 39 cycles; finally, the extension is carried out at 72 ℃ for 5 min.

The PCR product was subjected to gel electrophoresis, and the result showed that a single band (525bp) was amplified and the size was correct.

(2) Vector construction

The vector pCambia1301(VT1842, from Youbao, the structure of which is shown in FIG. 3) was linearized by a single cleavage with KpnI (using the corresponding restriction enzyme products from Thermo or Takara), and the cleavage reaction systems are shown in Table 4 below.

Table 4 shows the digestion reaction system

The digested products were purified and then subjected to recombination reaction with the PCR products (recombination reaction Kit: Clonexpress-II One Step Cloning Kit from Vazyme), and the recombination ligation reaction system (total volume 10. mu.l) was as shown in Table 5 below.

Table 5 shows the recombination ligation reaction system

And (3) lightly sucking and uniformly mixing the reaction liquid by using a pipette, centrifuging for a short time to collect the reaction liquid to the bottom of the tube, placing the tube at 37 ℃ for reaction for 30min, and immediately placing the tube on ice for cooling.

(3) Recombinant product transformed Escherichia coli DH5 alpha cell

The specific transformation procedure for transforming E.coli DH5 alpha cells with the recombinant product is as follows:

(3.1) adding 10. mu.L of the product of the above recombinant ligation reaction to 100. mu.L of E.coli competent cells;

(3.2) carrying out ice bath for 30 min;

(3.3) carrying out heat shock at 42 ℃ for 60-90 s;

(3.4) carrying out ice bath for 2 min;

(3.5) adding 800. mu.L of LB liquid medium;

(3.6) shaking-culturing at 37 ℃ for 30 min;

(3.7) centrifuging at 6000rpm for 3min, discarding the supernatant, and spreading Kana (50mg/L) resistant culture medium plates;

(3.8) carrying out inverted culture at 37 ℃ for 12-16h, and then picking resistant colonies;

(3.9) adding 100. mu.L of LB (containing Kana) liquid medium to each well of a 96-well plate;

(3.10) taking 4-8 colonies from each plate, and carrying out amplification culture at 37 ℃ and 180rpm for 2 h;

(3.11) taking 1 mu L of bacterial liquid to carry out PCR positive detection;

(3.12) selecting PCR positive transformant shake bacteria, culturing and extracting plasmids, sequencing the amplified product, wherein primers for amplification and sequencing are vector sequences inserted into two sides of a target gene and comprise:

35S-F：5’-GACGCACAATCCCACTATCC-3’(SEQ ID NO.1)；

2301-F：5’-GCTTCCGGCTCGTATGTTG-3’(SEQ ID NO.7)。

(4) positive plasmid transformed Agrobacterium competent cell (GV3101)

After sequencing the PCR amplification product, positive plasmids containing target genes are transformed into agrobacterium GV3101 competent cells, and the specific transformation steps are as follows:

(4.1) thawing 100. mu.L of Agrobacterium GV3101 competent cells on ice;

(4.2) adding 3. mu.L of pCambia1301 plasmid DNA with the target fragment, standing on ice for 30min, freezing in liquid nitrogen for 1min, and then water-bathing at 37 ℃ for 3 min;

(4.3) adding 900 mu L of YEP culture medium without antibiotics, carrying out shake culture at 28 ℃ and 200rpm/min for 3 h;

(4.4) centrifuging at 10000rpm for 1min to concentrate the bacterial liquid, and redissolving the bacterial cells with 100 mu LYEP;

(4.5) the cells after the redissolution were applied to a solid YEP medium supplemented with 50mg/L kanamycin and cultured at 28 ℃ for 12 to 16 hours.

(4.6) PCR identifies positive colonies, and the PCR primers are as follows: 35S-F and 2301-F.

3. Agrobacterium-mediated acquisition of cauliflower genetic transformation regeneration plant

(1) Selection of pedicel explants

Selecting loose cauliflower with healthy growing plant and curd as donor plant, taking curd shoots about 10cm after the curd is mature, selecting tender flowering branches, removing small curd balls at the top ends, and selecting pedicels with the transverse diameter of 0.3-0.5 cm as explants.

(2) Sterilization of explants

The selected flower stalks are cut to be 3-4 cm in length, cleaned for 3 times by purified water, then soaked in 70% ethanol for 2min, finally placed in 4% sodium hypochlorite solution, subjected to surface disinfection for 15min by slight shaking (60rpm) of a shaking table, and cleaned for 4 times by sterile water on an ultra-clean bench for later use.

(3) Pre-culture of explants

Placing the sterilized pedicel on sterile filter paper on a super clean bench, and sucking to remove surface water. Then, the explants were transferred to sterile newspaper and the wounds soaked with the sterile solution were excised from both ends of the pedicel. Finally, the explants were cut into small pieces of about 0.5cm long, placed vertically on the explant pre-culture medium, the morphological upper ends of the pedicles were exposed to the medium, and pre-cultured for 5 days (25 ℃, 16h/d light).

(4) Preparation of explant staining solution

The Agrobacterium strain GV3101 constructing the vector pCambia1301 of the target gene (Bol15337 gene) was shaken overnight to the bacterial liquid OD ₆₀₀ 0.75. Centrifuging the bacterium solution at 5000rmp for 10min, suspending with sterile MS-sucrose solution (MS liquid culture medium +20g/L sucrose, high temperature sterilizing) with the same volume, adding acetosyringone with final concentration of 20mg/L, and standing at room temperature for 1 h.

(5) Dip staining of explants

The non-contaminated explants after the pre-culture for 5 days were gently placed in the explant staining solution using sterile long-handled tweezers, and the table was gently shaken (60rpm) for 20 min.

(6) Co-culturing explant with bacterial liquid

And lightly placing the impregnated explant on sterile filter paper by using a sterile long-handle forceps, and sucking the surface bacterial liquid. Adding a piece of sterile filter paper with the same size on the surface layer of the explant co-culture medium, vertically placing the explant on the filter paper after the filter paper is wetted, contacting the filter paper with the morphological upper end of the pedicel, co-culturing for 3d under a dark condition, wherein the placed sterile filter paper can absorb residual agrobacterium after the explant is infected, and the pollution rate of the explant is reduced.

(7) Delayed explant culture

Transferring the explants after 3d of co-culture to an explant delay medium, contacting the morphological upper end of the pedicel with the medium, and performing delay culture for 8d (25 ℃, and illuminating for 16 h/d).

(8) Explant screening culture

After the delayed culture is finished, the explant is transferred to an explant screening culture medium, and the morphological lower end of the pedicel is contacted with the culture medium. After 15 days of selection, resistant shoots were obtained (25 ℃ C., 16h/d light). Finally, a total of 209 explants were uncontaminated, and 82 of these regenerated resistant shoots.

(9) Rooting culture of resistant buds

And cutting the regenerated resistant bud from the lower part of the growing point, transferring the bud into a bud rooting culture medium, and culturing for 5-7 days to grow a small amount of fibrous roots.

As shown in figure 1, the photo of the regenerated bud cultivated by the cauliflower pedicel selected by the invention is shown, wherein A is the pedicel with the diameter of 10-15 cm of the ball-shaped stem of the cauliflower; b is a peduncle explant with the transverse diameter of 0.2-1.7 cm; c, selecting explants with the transverse diameter of 0.3-0.8 cm for subsequent experiments; d, culturing the pedicel explant on a differentiation culture medium for 15-20 days to obtain a bud point; and E is the regeneration bud of the pedicel explant after being cultured on a differentiation culture medium for 25-35 days.

4. Positive detection of regenerated plants

(1) PCR detection of resistant regenerated plants

After the target gene (Bol15337) was constructed into the vector pCambia1301, PCR primers were designed based on the target gene and vector sequences, and the primer sequences were as follows:

upstream primer Bol15337-F (SEQ ID NO.1, 35S-F described previously):

GACGCACAATCCCACTATCC；

downstream primer Bol15337-R (SEQ ID NO. 2):

GCGACAGGAAGACCAAGATC。

the genome DNA of the resistant seedling leaves after rooting is used as a template, the equal volume of sterile water and the genome DNA of the leaves of the untransformed plants are used as negative controls, and the recombinant plasmid pCambia1301 (a vector containing the target gene Bol15337) is used as a positive control.

The PCR procedure was: 94 ℃ for 4 min; 30s at 94 ℃, 20s at 56 ℃, 30s at 72 ℃ and 32 cycles; extension at 72 ℃ for 10min and holding at 10 ℃.

The PCR system is as follows: template 1. mu. L, mix 6. mu.L (3G Tag MasterMix, from Novowed, cat # P115-02), forward primer 0.75. mu.L, reverse primer 0.75. mu.L and water 1.5. mu.L.

And after the PCR reaction is finished, performing 1% agarose gel electrophoresis on the 5 mu LPCR product, wherein a negative control has no target band, a positive control has a bright target band (568bp, the sequence is shown as SEQ ID NO. 3), the transformed resistant seedling leaf genome DNA has a 568bp band which is a positive plant, and the transformed resistant seedling leaf genome DNA has no band which is an untransformed successful plant.

As shown in FIG. 2, for the target gene PCR and GUS staining detection of cauliflower pedicel resistant bud regeneration and regeneration plant of the invention, A is a resistance plant regenerated from a pedicel explant; b is that the regeneration resistant plant has good rooting; c is PCR detection (upper) and GUS staining detection (lower) of regeneration plants, and 568bp bands exist in the genome DNA of the transformed resistant seedling leaves.

The results showed that the total number of the resistant plants with good rooting obtained was 86, and 51 plants with 568bp bands were detected by PCR.

(2) GUS staining for PCR detection of positive plant leaves

GUS staining working solution was prepared according to the GUS staining solution kit (purchased from Leagene, Beijing, CAS number 18656-96-7) and the instructions.

Cutting 51 young leaves of the positive plants detected by PCR, adding a proper amount of GUS staining working solution to completely immerse the leaves, and preserving heat at 23 ℃ for 12 hours; the leaves were decolorized 4 times in 70% ethanol until the negative control (untransformed plant leaves) appeared white; visually, there were 21 leaves with different sizes of blue blocks/spots (GUS expression sites) on a white background.

21 cauliflower genetic transformation positive seedlings (PCR and GUS staining double positive is positive seedlings with successful genetic transformation) are obtained in 56d by using the method, 209 uncontaminated explants are used for experiments in total, and the genetic transformation efficiency is 21/209-10.05%.

Example 2

1. Preparation of culture medium

Comprises culture media of each stage of genetic transformation, and the components and the contents of the culture media are as follows:

(1) explant pre-culture medium: MS culture medium, sucrose 30g/L, agar 9g/L, 6-BA 2mg/L, NAA 0.02mg/L, Trans-ZT 0.4mg/L, pH 5.9, and autoclaving at 121 deg.C for 20 min;

(2) explant co-culture medium: MS culture medium, sucrose 30g/L, agar 8g/L, 6-BA 2mg/L, NAA 0.02mg/L, Trans-ZT 0.4mg/L, pH 5.9, and autoclaving at 121 deg.C for 20 min;

(3) explant delay medium: MS culture medium, 30g/L of cane sugar, 9g/L of agar, 1.5 mg/L of 6-BA, 0.02mg/L of NAA, 0.4mg/L of Trans-ZT and 300mg/L of timentin, wherein the pH value is 5.9, and the culture medium is autoclaved for 20min at 121 ℃ (wherein the antibiotic timentin is added when the culture medium is cooled to 60 ℃ after being sterilized at high temperature);

(4) explant screening medium: MS culture medium, 30g/L of cane sugar, 9g/L of agar, 6-BA 2mg/L, NAA 0.02mg/L, Trans-ZT 0.4mg/L, 300mg/L of timentin and 5mg/L of hygromycin, wherein the pH value is 5.9, and the culture medium is autoclaved for 20min at 121 ℃ (wherein the antibiotics timentin and hygromycin are added when the culture medium is cooled to 60 ℃ after being sterilized at high temperature);

(6) bud rooting culture medium: MS culture medium + NAA 0.05mg/L + sucrose 30g/L + agar 9g/L + timentin 300mg/L + hygromycin 5mg/L, pH 5.9, autoclaving at 121 deg.C for 20 min;

2. agrobacterium mediated acquisition of cauliflower genetic transformation regenerated plant

The procedure was essentially the same as in example 1, except that:

selecting loose cauliflowers with healthy growing plants and flower bulbs as donor plants, carrying out flower bulb branching about 14cm after the flower bulbs are mature for about 15 days, selecting tender flower branches, removing small flower bulbs at the top ends, and selecting flower stalks with the transverse diameter of 0.4-0.6 cm as explants;

when the explant staining solution is prepared, the concentration of the agrobacterium is OD ₆₀₀ The exhaust time was 25min at 0.68.

In this example, a total of 102 non-contaminated explants were obtained, of which 47 regenerated resistant shoots. The PCR and GUS staining double positive plants total 14 plants, and the genetic transformation efficiency is 14/102-13.73%.

Example 3

1. Preparation of culture medium

The culture medium comprises culture media of each stage of genetic transformation, and the components and the content of the culture media are as follows:

(1) explant pre-culture medium: MS culture medium, sucrose 30g/L, agar 9g/L, 6-BA 2mg/L, NAA 0.02mg/L, Trans-ZT 0.4mg/L, pH 5.9, and autoclaving at 121 deg.C for 20 min;

(2) explant co-culture medium: MS culture medium, sucrose 30g/L, agar 8g/L, 6-BA 2mg/L, NAA 0.02mg/L, Trans-ZT 0.4mg/L, pH 5.9, and autoclaving at 121 deg.C for 20 min;

(3) explant delay medium: MS culture medium, 30g/L of cane sugar, 9g/L of agar, 6-BA 2mg/L, NAA 0.02mg/L, Trans-ZT 0.4mg/L and 300mg/L of timentin, wherein the pH value is 5.9, and the culture medium is autoclaved for 20min at 121 ℃ (wherein the antibiotic timentin is added after being sterilized at high temperature and cooled to 60 ℃);

(4) explant screening medium: MS culture medium, sucrose 30g/L, agar 9g/L, 6-BA 2mg/L, NAA 0.02mg/L, Trans-ZT 0.4mg/L, trimebutine 300mg/L and hygromycin 5mg/L, wherein the pH is 5.9, and the culture medium is sterilized at the high temperature and then cooled to 60 ℃ for 20min (wherein the antibiotics trimebutine and hygromycin are added after the culture medium is sterilized at the high temperature);

(5) bud rooting culture medium: MS culture medium + NAA 0.1mg/L + sucrose 30g/L + agar 9g/L + timentin 300mg/L + hygromycin 5mg/L, pH 5.9, autoclaving at 121 ℃ for 20 min;

2. agrobacterium-mediated acquisition of cauliflower genetic transformation regeneration plant

The procedure was essentially the same as in example 1, except that:

selecting loose cauliflower with healthy growth of plants and flower bulbs as donor plants, carrying out flower bulb branching about 15cm after the flower bulbs are mature for about 18 days, selecting tender flower branches, removing small flower bulbs at the top ends, and selecting pedicels with the transverse diameter of 0.5-0.8cm as explants;

when the explant staining solution is prepared, the concentration of the agrobacterium is OD ₆₀₀ The exhaust time was 28min at 0.74.

In this example, a total of 83 uncontaminated explants were obtained, and 28 of these explants regenerated resistant shoots. The PCR and GUS staining double positive plants total 9 plants, and the genetic transformation efficiency is 9/83-10.84%.

Comparative example 1

The procedure for the genetic transformation of regenerated plants with cauliflower as in example 1 was followed, except that the concentrations of 6-BA, NAA and Trans-ZT in the medium were varied.

Table 6 shows the effect of different concentrations of 6-BA and NAA combinations on the regeneration efficiency of cauliflower pedicel explant buds

Table 7 shows the effect of different concentrations of Trans-ZT on the regeneration efficiency and regeneration time of cauliflower flower stalk buds

6-BA is an artificial chemically synthesized cytokinin to promote bud regeneration, while NAA is an auxin to promote root growth. The invention researches the combination of cytokinin and auxin with different concentrations, and the germination rates of cauliflower pedicel explants are completely different under different concentration ratios. In addition, by adding Trans-ZT (Trans-zeatin, natural cytokinin) with a certain concentration, the regeneration of the bud of the cauliflower pedicel explant can be induced more quickly, the bud regeneration time is shortened remarkably, and the high-frequency bud regeneration effect is maintained.

While the present invention has been described in detail with reference to the preferred embodiments, it should be understood that the above description should not be taken as limiting the invention. Various modifications and alterations to this invention will become apparent to those skilled in the art upon reading the foregoing description. Accordingly, the scope of the invention should be determined from the following claims.

Sequence listing

<110> Zhejiang province academy of agricultural sciences

<120> efficient genetic transformation method for cauliflower by using pedicel as explant

<160> 7

<170> SIPOSequenceListing 1.0

<210> 1

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 1

gacgcacaat cccactatcc 20

<210> 2

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 2

gcgacaggaa gaccaagatc 20

<210> 3

<211> 568

<212> DNA

<213> Artificial Sequence

<400> 3

gacgcacaat cccactatcc ttcgcaagac ccttcctcta tataaggaag ttcatttcat 60

ttggagagga gctcccgcgg gtcgacggta ccatgggaga aagagtgata gagccattga 120

taatgggaag agtggtagga gatgttctcg atttcttcac tccaacaatt aaaatgaatg 180

tgagctacaa catgaagcaa gtctccaaca gccatgagct ttttccttcc tctgtctcct 240

ccaagcctag ggttgagatc catggtggtg atctcagatc cttcttcacc ttggtgatga 300

tagaccctga tgttccaggt cctagtgacc cctttctaaa agagcacctg cattggatag 360

taacaaacat ccccggtaca accgatgcta catttggaaa agaggtggtg agctatgagt 420

tgccaaggcc tagcataggg atacacaggt tcgtgtttgt tctgttcaag cagaagcaaa 480

gacgtgttat cttcccaaac attccttcga gagataactt caacactcga aaatttgcga 540

tcgagtatga tcttggtctt cctgtcgc 568

<210> 4

<211> 525

<212> DNA

<213> Artificial Sequence

<400> 4

atgggagaaa gagtgataga gccattgata atgggaagag tggtaggaga tgttctcgat 60

ttcttcactc caacaattaa aatgaatgtg agctacaaca tgaagcaagt ctccaacagc 120

catgagcttt ttccttcctc tgtctcctcc aagcctaggg ttgagatcca tggtggtgat 180

ctcagatcct tcttcacctt ggtgatgata gaccctgatg ttccaggtcc tagtgacccc 240

tttctaaaag agcacctgca ttggatagta acaaacatcc ccggtacaac cgatgctaca 300

tttggaaaag aggtggtgag ctatgagttg ccaaggccta gcatagggat acacaggttc 360

gtgtttgttc tgttcaagca gaagcaaaga cgtgttatct tcccaaacat tccttcgaga 420

gataacttca acactcgaaa atttgcgatc gagtatgatc ttggtcttcc tgtcgctgct 480

gtcttcttta acgcccagag agaaactgca gctcgaagac gttaa 525

<210> 5

<211> 37

<212> DNA

<213> Artificial Sequence

<400> 5

gcgggtcgac ggtaccatgg gagaaagagt gatagag 37

<210> 6

<211> 36

<212> DNA

<213> Artificial Sequence

<400> 6

tagacatatg ggtaccttaa cgtcttcgag ctgcag 36

<210> 7

<211> 19

<212> DNA

<213> Artificial Sequence

<400> 7

gcttccggct cgtatgttg 19

Claims (6)

1. A high-efficiency genetic transformation method for cauliflowers by taking pedicels of cauliflowers as explants is characterized by comprising the following steps:

(1) selecting a pedicel explant: taking loose cauliflower as a donor plant, carrying out ball-stem drawing for 10-15 cm after a ball-flower matures for 10-20 days, selecting tender flower branches, removing small ball-flower at the top end, and selecting a pedicel with the transverse diameter of 0.3-0.8 cm as an explant;

(2) and (3) sterilizing the explants: washing and sterilizing the pedicel;

(3) pre-culturing explants: sucking surface moisture of the sterilized pedicel, cutting wounds at two ends of the pedicel, cutting the explant into small sections with the length of 0.5-0.8cm, contacting the morphological upper end of the pedicel with a culture medium in a pre-culture medium of the explant, and pre-culturing at 23-25 ℃ for 5-7 days with illumination time of 16 h/d; wherein the explant pre-culture medium comprises: MS culture medium, 30g/L sucrose, 9g/L agar, 2.0 mg/L6-BA, 0.02mg/LNAA, 0.4-0.5 mg/LTrans-ZT, and the pH value is 5.6-6.0;

(4) and (3) carrying out dip dyeing on explants: placing the pre-cultured explant in an explant dip-dyeing solution for dip-dyeing; wherein, the preparation of the explant staining solution comprises the following steps: the agrobacterium strain GV3101 for constructing the target gene vector pCambia1301 is shake-cultured at 28 ℃ overnight to the bacterial liquid OD ₆₀₀ Centrifuging the bacterial liquid, discarding the supernatant, suspending the bacterial liquid by using sterile MS-sucrose solution with the same volume, and adding acetosyringone with the final concentration of 20mg/L to obtain an explant staining solution; wherein the sterile MS-sucrose solution comprises: MS liquid culture medium and 20g/L sucrose; the nucleotide sequence of the target gene is shown as SEQ ID NO. 4;

(5) co-culturing explants and bacterial liquid: sucking up liquid on the surface of the impregnated explant, adding a piece of sterile filter paper on the surface layer of the explant co-culture medium, vertically placing the explant on the filter paper after the filter paper is wetted, enabling the morphological upper end of the pedicel to contact with the culture medium, and co-culturing for 3d under the dark condition; wherein the explant co-culture medium comprises: MS culture medium, 30g/L sucrose, 8g/L agar, 2.0 mg/L6-BA, 0.02mg/LNAA, 0.4-0.5 mg/L Trans-ZT, and pH is 5.6-6.0;

(6) and (3) delayed culture of explants: transferring the explants subjected to co-culture to an explant delay culture medium, contacting the morphological upper end of pedicel with the culture medium, and performing delay culture at 23-25 ℃ for 8 days with illumination time of 16 h/d; wherein the explant delay medium comprises: MS culture medium, 30g/L sucrose, 9g/L agar, 2.0 mg/L6-BA, 0.02mg/LNAA, 0.4-0.5 mg/LTrans-ZT and 300mg/L timentin, wherein the pH value is 5.6-6.0;

(7) screening and culturing explants: transferring the explants subjected to delayed culture to an explant screening culture medium, contacting the morphological lower end of the pedicel with the culture medium, screening and culturing at 23-25 ℃, wherein the illumination time is 16h/d, and screening and culturing for 13-15 d until resistant buds grow; wherein the explant screening medium comprises: MS culture medium, 30g/L sucrose, 9g/L agar, 2.0 mg/L6-BA, 0.02mg/LNAA, 0.4-0.5 mg/LTrans-ZT, 300mg/L timentin and 5mg/L hygromycin, and the pH value is 5.6-6.0

(8) Rooting culture of the resistant buds: cutting the regenerated resistant bud from the lower part of the growing point, transferring the cut resistant bud into a bud rooting culture medium, and culturing for 5-7 days to grow fibrous roots; wherein the shoot rooting medium comprises: MS culture medium, 0.05-0.1 mg/LNAA, 30g/L sucrose, 9g/L agar, 300mg/L timentin and 5mg/L hygromycin, and the pH value is 5.8-6.0;

(9) positive detection of regenerated plants: performing double detection through PCR and GUS staining to obtain positive plants, which are cauliflower genetic transformation positive seedlings; the PCR takes genome DNA of resistant seedling leaves after rooting as a template, nucleotide sequences of adopted primers are shown as SEQ ID NO.1 and SEQ ID NO.2, and the result is positive if a strip of a PCR product is 568 bp; the GUS staining shows that the white background of the leaf has blue dots which are positive.

2. The efficient genetic transformation method for cauliflowers by taking pedicels as explants according to claim 1, wherein the sterile solution adopted for sterilizing the pedicels comprises: 70% ethanol and 4% sodium hypochlorite.

3. The efficient genetic transformation method for cauliflowers by using pedicels as explants according to claim 2, wherein the pedicels are sterilized: cutting the pedicel to 3-4 cm, sterilizing with a sterile solution, and then cleaning with sterile water.

4. The efficient genetic transformation method for cauliflowers by taking pedicels as explants according to claim 1, wherein the dip-dyeing time of the explants is 20-30 min, and the shaking speed of a shaking table is 50-60 rpm.

5. The efficient genetic transformation method for cauliflowers by using pedicels as explants according to claim 1, wherein the PCR program is as follows: 94 ℃ for 4 min; 30s at 94 ℃, 20s at 56 ℃, 30s at 72 ℃ and 32 cycles; extension at 72 ℃ for 10min and holding at 10 ℃.

6. The efficient genetic transformation method for cauliflowers by taking pedicels as explants according to claim 1, wherein GUS staining is as follows: taking leaves of PCR detection positive plants, adding GUS staining working solution to enable the leaves to be completely immersed, and preserving heat for 10-24 hours at 25-35 ℃; transferring the leaves into 70% ethanol for decolorization for 3-4 times until a negative control is white, wherein the negative control is the leaves of plants without 568bp bands detected by PCR; the positive plants are observed by naked eyes with blue dots on the white background of the leaves.

Images