CN116732090A - Application of rice lipoxygenase OsLOX10 gene in regulation of activity of rice seeds - Google Patents

Application of rice lipoxygenase OsLOX10 gene in regulation of activity of rice seeds Download PDF

Info

Publication number
CN116732090A
CN116732090A CN202211712411.4A CN202211712411A CN116732090A CN 116732090 A CN116732090 A CN 116732090A CN 202211712411 A CN202211712411 A CN 202211712411A CN 116732090 A CN116732090 A CN 116732090A
Authority
CN
China
Prior art keywords
oslox10
rice
gene
seeds
germination
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202211712411.4A
Other languages
Chinese (zh)
Inventor
张建福
王福祥
张玲
蔡秋华
何炜
谢鸿光
魏毅东
吴方喜
蒋家焕
罗曦
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Rice Research Institute Fujian Academy Of Agricultural Sciences
Original Assignee
Rice Research Institute Fujian Academy Of Agricultural Sciences
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Rice Research Institute Fujian Academy Of Agricultural Sciences filed Critical Rice Research Institute Fujian Academy Of Agricultural Sciences
Priority to CN202211712411.4A priority Critical patent/CN116732090A/en
Publication of CN116732090A publication Critical patent/CN116732090A/en
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C12N15/8262—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield involving plant development
    • C12N15/8267—Seed dormancy, germination or sprouting
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8201—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
    • C12N15/8202—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation by biological means, e.g. cell mediated or natural vector
    • C12N15/8205—Agrobacterium mediated transformation
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8216—Methods for controlling, regulating or enhancing expression of transgenes in plant cells
    • C12N15/8218—Antisense, co-suppression, viral induced gene silencing [VIGS], post-transcriptional induced gene silencing [PTGS]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004—Oxidoreductases (1.)
    • C12N9/0069—Oxidoreductases (1.) acting on single donors with incorporation of molecular oxygen, i.e. oxygenases (1.13)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y113/00—Oxidoreductases acting on single donors with incorporation of molecular oxygen (oxygenases) (1.13)
    • C12Y113/11—Oxidoreductases acting on single donors with incorporation of molecular oxygen (oxygenases) (1.13) with incorporation of two atoms of oxygen (1.13.11)
    • C12Y113/11012—Linoleate 13S-lipoxygenase (1.13.11.12)
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A40/00—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production
    • Y02A40/10—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production in agriculture
    • Y02A40/146—Genetically Modified [GMO] plants, e.g. transgenic plants

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Biomedical Technology (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Biophysics (AREA)
  • Cell Biology (AREA)
  • Physiology (AREA)
  • Virology (AREA)
  • Medicinal Chemistry (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)

Abstract

The invention prepares and screens corresponding homozygous plants through knocking out and over-expressing the OsLOX10 genes, and further examines the germination rate, the germination potential and the seed storage property based on the seeds obtained from the corresponding plants. Experiments show that for newly picked seeds, the germination rate of the seeds is enhanced by over-expression of the OsLOX10 gene, wherein the germination rate, the germination vigor, the seedling vigor index and the like are included; the germination rate of the seed gene knockout seedling after artificial aging is stronger than that of a wild type strain and an over-expression strain, and the OsLOX10 gene knockout seedling is proved to have the performance of improving the aging resistance of the seed. Therefore, the invention provides a new technical scheme for prolonging the storage property of rice seeds.

Description

Application of rice lipoxygenase OsLOX10 gene in regulation of activity of rice seeds
Technical Field
The invention belongs to the fields of botanic and biotechnology, and particularly relates to application of a rice lipoxygenase OsLOX10 gene in activity of rice seeds.
Background
Lipoxygenase (LOX; EC 1.13.11.12) is also known as Lipoxygenase or Lipoxygenase, which is a dioxygenase containing non-heme iron or manganese and specifically catalyzes the oxygenation of polyunsaturated fatty acids (PUFAs) having cis, cis-1, 4-pentadiene structures in an organism. In higher plants, linolenic acid (LeA) and Linoleic Acid (LA) in unsaturated fatty acids are mainly used as reaction substrates. Currently, the LOXs gene family has been found in many species (soybean, corn, arabidopsis, rice, barley, tomato, potato, and tea tree) and the like, which are widely present in different organs and tissues of plants, such as roots, stems, leaves, flowers, fruits, seeds, and the like of plants, and have different expression abundances.
Rice is favored by many researchers as model plants and main grain crops in the world, and the rice has the problems of nutrient decomposition, staling and deterioration, losing vitality of seeds and the like in the storage process. How to store and extend the life of rice seeds for a long period of time is a long-standing concern in the breeding field.
Technical proposal
In order to solve the problems, the invention provides an application method of a rice OsLOX10 gene (LOX 10 for short) in regulating activity of rice seeds, wherein a CDS region of the OsLOX10 gene has a gene with a sequence shown as SEQ NO. 1 or a complementary sequence thereof; the protein coded by the OsLOX10 gene has an amino acid sequence shown as SEQ NO. 2.
The invention firstly provides a method for knocking out an OsLOX10 gene, which comprises the following steps: and selecting an OsLOX10 knockout target, introducing the target by PCR amplification, and finally constructing a CRISPR/Cas9 knockout vector of the gene by utilizing a Golden Gate cloning method. Wherein the OsLOX10 knockout target OsLox10-Cas9-T1 is shown in SEQ NO. 3; osLox10-Cas9-T2 is shown as SEQ NO. 4.
The invention further comprises a gene knockout vector prepared based on the method, and a vector DNA fragment carrying an OsLox10-CRISPR-Cas9 knockout target spot is integrated into a rice callus cell through agrobacterium and induced to differentiate into seedlings.
The invention further provides a method for overexpressing an OsLOX10 gene comprising: carrying out PCR amplification by taking a plasmid containing a target gene as a template, then carrying out connection transformation to construct an OsLOX10 over-expression vector, integrating the over-expression vector into rice callus cells through agrobacterium and inducing differentiation into seedlings; wherein in the PCR amplification, the primers are as follows: osLox10-OE-F is shown as SEQ NO. 5, and OsLox10-OE-R is shown as SEQ NO. 6.
The invention carries out the purity and screening of the gene knockout seedling and the gene over-expression seedling obtained by the method, further cultures the homozygous plant seedling obtained by screening, and harvests the seeds.
The invention further provides an application of the rice OsLOX10 gene in regulating the activity of rice seeds, wherein the regulation of the activity of the rice seeds is to regulate the germination vigor, the germination percentage and/or the seed storage property of the rice seeds, especially the newly harvested rice seeds.
In the invention, seeds are placed in a 28 ℃ illumination incubator to be taken as the 0 th day, the germination numbers of the 3 rd day and the 7 th day are counted, the ratio of the germination number of the seeds on the 3 rd day to the total number of the seeds is defined as the germination vigor, and the ratio of the germination number of the seeds on the 7 th day to the total number of the seeds is defined as the germination rate.
The invention takes the newly harvested seeds to soak the seeds for accelerating germination, places the seeds in an illumination incubator for culture, counts and calculates indexes such as germination rate, germination vigor and the like, and analyzes and discovers that under normal conditions, the germination rate, the germination vigor index and the like of the seeds are enhanced by over-expression of the OsLOX10 gene. In the invention, the new harvested seeds are seeds which are stored for not longer than 6 months under the conventional storage condition after the seeds are ripely picked, particularly the seeds which are stored for not longer than 3 months under the conventional storage condition; or mature seeds which are picked and not subjected to an accelerated aging test.
The invention breaks dormancy of newly harvested seeds and performs manual aging. Immersing the aged seeds to accelerate germination, culturing in an illumination incubator, and counting and calculating indexes such as germination rate, germination vigor and the like. The invention finds that after aging for 18 days, the germination rate of the gene knockout seedling after 7 days and 14 days of culture is stronger than that of a wild type and over-expressed strain.
In a specific embodiment of the invention, the rice is Kitaake.
The invention prepares OsLOX10 gene knockout or over-expression seedlings based on japonica rice Kitaake varieties, cultures homozygous screened gene editing rice and harvests seeds thereof. The invention further researches the influence of the OsLOX10 gene on the seed activity through specific examples, discovers that the OsLOX10 gene can play a role in regulating the seed activity and the seed storage property, and provides a novel scheme for prolonging the rice seed storage property.
Drawings
Fig. 1 is: agarose gel electrophoresis analysis result of the OsLOX10 CDS amplification product is shown in a schematic diagram;
wherein m=dl 5000 markers; 2: LOX10.
Fig. 2 is: schematic construction of OsLOX10 knockout and overexpression vectors.
Fig. 3 is: agrobacterium-mediated rice genetic transformation flow chart.
Fig. 4 is: schematic of OsLOX10 mutation type.
Fig. 5 is: results of detection of relative expression level of OsLOX 10.
Fig. 6 is: schematic of the effect of OsLOX10 on seed germination activity;
wherein, A is an OsLOX10 germination phenotype diagram, B is germination potential, C is germination rate, and D is seedling vitality index.
Fig. 7 is: schematic diagram of OsLOX10 versus seed storage test;
wherein, A is a germination chart of seeds after artificial aging for 18 days, B is a germination rate of the seeds after 7 days of culture, and C is a germination rate of the seeds after 14 days of culture.
Detailed Description
The following specific examples are provided to further illustrate the technical scheme of the present invention.
The embodiment first provides a cloning method of rice OsLOX10 gene.
After NCBI website inquiry, corresponding primers are designed, and rice Kitaake cDNA is used as a template, and the OsLOX10 gene is cloned. The amplification primers are as follows: LOX10-CDS-F is shown as SEQ NO. 7, and LOX10-CDS-R is shown as SEQ NO. 8.
LOX10-CDS-F：AGGTAGCTAGTAGTACGATGCAG
LOX10-CDS-R：ACACGAGAAGAGAAATGTTGCT
Amplification was performed using PCR amplification enzyme KOD FX DNA Polymerase supplied by TOYOBO company, PCR amplification system: primer Star 10. Mu.L, ddH 2 O7. Mu.L, primer-F1.5. Mu.L, primer-R1.5. Mu.L, template DNA 1. Mu.L. After the sample is added, the mixture is evenly mixed and centrifuged, and the PCR amplification procedure is as follows: pre-denaturation at 98℃for 2min; denaturation at 98℃for 10s, annealing at 65℃for 30s, elongation at 72℃for 90s, total 34 cycles; extending at 72 ℃ for 10min; constant temperature at 4 ℃. Namely, the OsLOX10 gene CDS was obtained from Kitaake. After amplification, the PCR product is detected by agarose gel electrophoresis, and the amplified product is recovered by gel and sent to a company for sequencing, namely the OsLOX10 gene CDS is obtained from Kitaake. The CDS region of the OsLOX10 gene has a gene with a sequence shown as SEQ NO. 1 or a complementary sequence thereof after sequencing; the protein coded by the OsLOX10 gene has an amino acid sequence shown as SEQ NO. 2.
A second aspect of this embodiment provides a method for constructing an OsLOX10 gene knockout vector.
The login number LOC_Os11g36719 of the OsLOX10 gene is logged in a CRISPR-PLANT (https:// www.genome.arizona.edu/CRISPR/CRISPRsearch. Html) website to predict a CRISPR/Cas9 knockout target, meanwhile, proper target sequences are selected from different sections of a coding region or protein active sites to serve as gRNA targets (the target is red as follows), and then the target sequences are logged in a CRISPR RGEN Tools (http:// www.rgenome.net/Cas-offinder /) website to perform off-target analysis. Then selecting a target point, wherein the OsLox10 knockout target point OsLox10-Cas9-T1 is shown as SEQ NO. 3; osLox10-Cas9-T2 is shown as SEQ NO. 4.
OsLox10-Cas9-T1:ATAATGGTCTCTGGCGGGATCATCGACACCATCACGTTTTAGAGCTAG
OsLox10-Cas9-T2:ATTATTGGTCTCTAAACCCATGCCCTTGAGCCGCGACGCTTCTTGGTGCC
And then amplified by PCR to introduce the target. Finally, constructing a CRISPR/Cas9 knockout vector of the pHUE411 gene by utilizing a Golden Gate cloning method.
Transformation of DH5 alpha granulocyte competent cells by recombinant plasmid
1. mu.L of competent cells of DH5 alpha separated by the ligation product transfer device are taken, gently mixed and then placed on ice for about 30min.
2. Heat-shock at 42 ℃ for 90s and then placing on ice for 3min.
3. After 500. Mu.L of LB liquid medium was added, the mixture was shake-resuscitated at 220rpm and 37℃for 1 hour.
4. After removal, the mixture was centrifuged at 3000rpm for 3min. The precipitate was collected and approximately 100. Mu.L was uniformly spread on a Kan plate. The cells were incubated overnight at 37 ℃.
5. Single colonies were picked and sent to the company order and LOX10-Cas9 vector was successfully constructed. Specific sequencing primers provided by the carrier are selected: osU3-FD 3 The sequence shown in SEQ NO 9 and the sequence shown in SEQ NO 10 of TaU 3-RD.
OsU3-FD 3 ：5'-GACAGGCGTCTTCTACTGGTGCTAC-3'
TaU3-RD：5'-CTCACAAATTATCAGCACGCTAGTC-3'
Extraction of recombinant plasmid
The positive strain with correct sequence is transferred to LB liquid medium containing Kan for expansion culture (about 50 mL) and plasmid extraction is carried out. The plasmid extraction adopts SanPrep column type plasmid DNA small extraction kit provided by Shanghai Biotechnology Co., ltd, and specific steps are shown in the specification.
Recombinant plasmid transformed Agrobacterium (EHA 105) competent cells
(1)Preparation of Agrobacterium competent cells (EHA 105)The method comprises the following specific steps:
1. the EHA105 glycerol bacteria preserved at the ultralow temperature are slowly thawed on ice, streaked in solid culture medium containing Rif resistance after sterilization by an ultra-clean bench, and cultured in a dark incubator at 28 ℃ for 2-3 days.
2. Single colonies with good growth state are selected and transferred to liquid LB medium containing Rif resistance for dark culture at 180rpm and 28 ℃.
3. Waiting for OD 600 After the value reaches 0.4-0.6, the mixture is placed in an ice bath for 30min.
Centrifugation was performed at 5000rpm at 4.4℃for 10min, 10mL of 0.15mol/L ice NaCl was added to the cell pellet after removal of the supernatant, and centrifugation was performed at 5000rpm at 4℃for 10min after cell mass suspension.
5. The bacterial precipitate was collected and 1mL of 0.02mol/L ice CaCl was added 2 And then blowing and evenly mixing to suspend the cells.
6. Adding 30% glycerol with equal volume of precooling, wherein EHA105 competent cells are prepared, and packaging (50 μl per tube) for recombinant plasmid transformation, or quick freezing with liquid nitrogen and storing at-80deg.C.
(2)Transformation of competent cells (EHA 105)The method comprises the following specific steps:
1. taking 1ug of recombinant plasmid, transferring into split EHA105 competent cells, mixing, and placing on ice for 30min.
2. Quick freezing with liquid nitrogen for 3min, then warm-bathing at 37deg.C for 3min, and ice-bathing for 3min.
3. After 500. Mu.L of LB liquid medium was added, the mixture was shake-resuscitated at 180rpm at 28℃for about 5 hours.
4. After removal, the mixture was centrifuged at 3000rpm for 3min. About 100. Mu.L of the collected bacterial liquid was blown and mixed uniformly and then applied to a plate containing Kan and Rif. Culturing in a dark incubator at 28 ℃ for 2-3 days.
5. The monoclonal colony is selected and transferred into LB liquid culture medium containing Kan and Rif resistance, and placed in shaking table culture at 28 ℃ at 180rpm for about 36 hours, PCR detection is carried out after the bacterial liquid is turbid, positive bacterial liquid can be directly streaked on solid culture medium containing Kan and Rif resistance to infect callus, or glycerol with the same volume of 30% can be added for quick freezing, and then the callus is preserved in a refrigerator at-80 ℃.
A third aspect of this embodiment is to provide a method for constructing an OsLOX10 gene overexpression vector.
The experiment constructs an over-expression fusion vector of the gene based on a pCAMBIA-1302 vector driven by CaMV 35S in a bidirectional way, and after analyzing a vector sequence and a CDS sequence of the gene, an over-expression amplification primer with a homologous tail end of a vector enzyme digestion site is designed by taking NcoI and BstEII as enzyme digestion sites, wherein in the PCR amplification, the primer is as follows: osLox10-OE-F is shown as SEQ NO. 5, osLox10-OE-R is shown as SEQ NO. 6, as follows:
OsLox10-OE-F：GGACTCTTGACCATGGCAGCAGCCGCAGGCGAG
OsLox10-OE-R：GGAAATTCGAGCTGGTCACCTCAGATGGAGGCGCTG
the plasmid containing the target gene is used as a template, high-fidelity enzyme provided by Vazyme company is adopted for PCR amplification, then connection transformation is carried out, the plasmid is sent to company for sequencing, agrobacterium transformation is carried out after plasmid is extracted from bacterial liquid with correct sequencing, and an OsLOX10 over-expression vector is successfully constructed.
A fourth aspect of this embodiment is Agrobacterium-mediated genetic transformation of rice and transgenic shoot detection.
1. Material preparation
Selecting new full rice seeds in the same year, selecting Kitaake rice seeds, peeling off the hulls, and keeping the integrity of the embryo when taking care of peeling off the hulls so as to ensure the germination rate, wherein each variety is about 30-50 grains.
2. Seed washing
The shelled rice seeds are washed 3 to 5 times by sterile water in a sterilizing triangular flask to remove impurities, and if the impurities are more, the rice seeds can be washed several times by the sterile water. Surface-sterilizing with 75% ethanol solution for 3min. Then disinfecting for about 10min by using 2.5% NaClO solution, and placing the mixture on a shaking table to gently shake the mixture to achieve a better disinfecting effect. Finally, cleaning the product for 3 to 5 times by using sterilized water, and drying the product on an ultra clean bench.
3. Callus induction and subculture
The washed rice seeds were transferred to NB induction medium, taking care to allow the embryos to come into contact with the medium, followed by a dark culture at 28℃for about 12 days, followed by shoot removal and subsequent culture.
4. Agrobacterium transformation of rice callus
(1) Activation of bacterial cells
Streaking positive Agrobacterium solution stored at-80deg.C on a medium containing Kan (50 mg/L) -1 ) And Rif (50 mg/L) -1 ) The resistant plates were inverted and incubated in an incubator at 28℃for about 2 days in the dark.
(2) Screening of callus
And selecting callus with good growth state, compact structure, bright yellow color and moderate size, and pre-culturing at 28 ℃ for 2-3 days.
(3) Infection of callus
1. Sucking a proper amount of AAM (containing 100 mu M AS) liquid by a gun head, lightly blowing on a streaking plate to suspend and mix the bacterial liquid uniformly, transferring the suspended bacterial liquid into a sterilized culture dish, adjusting the OD of the suspended bacterial liquid to be 0.2-0.3, sealing, and resuscitating for 1h in a 28 ℃ dark incubator.
2. Transferring proper amount of pre-cultured rice callus to activated agrobacterium infection liquid and slightly shaking to infect for 3-5 min.
3. After infection, transferring the callus onto sterile filter paper, and placing the sterile filter paper on an ultra-clean bench for blowing for about 10min. Then transferred to a co-culture medium containing 100UmdAS and incubated at 28℃for 1-2 days.
4. Finally transferred to a screening medium (screen 1) containing 500mg/LCar and 50mg/LHyg for screening culture of the calli.
(4) Screening of resistant callus
In the screening process, the non-resistant callus can be blackened, browned and the activity is reduced, and the resistant callus can grow new callus after being cultured for a period of time. These new-born calli were then subjected to successive generation 2 and generation 3 selection cultures.
(5) Pre-differentiation and differentiation culture
The callus with good growth state obtained by screening can be transferred into a pre-differentiation culture medium, cultured under 28 ℃ illumination condition, and transferred into the differentiation culture medium for culture when green spots appear or green buds grow on part of the callus.
(6) Rooting culture
And transferring the seedlings formed by differentiation into a rooting culture medium for continuous culture for a period of time.
(7) Hardening off seedlings
After the young seedling grows in the rooting culture medium for a period of time, the young seedling can be transferred into nutrient solution or nutrient soil for culture, so that the young seedling adapts to the environment of the outside or a field, and the corresponding transgenic plant is obtained.
6. Detection of knockdown and over-expressed plants
Two homozygous knockout plants were obtained using specific primer detection, with the following mutation types:
oslox10 mutant type
Meanwhile, a corresponding fluorescent quantitative primer is designed to detect the expression quantity of the over-expression plant, and the primer is as follows: LOX10-qPCR-F is shown as SEQ NO. 11, and LOX10-qPCR-R is shown as SEQ NO. 12.
LOX10-qPCR-F：TTCCTTCTCACCATCACTAA
LOX10-qPCR-R：GTTCTTCTCCACCTCCAA
The fifth aspect of this example is a seed obtained based on an OsLOX10 gene knockout plant and an OsLOX10 gene overexpressing plant, respectively, and the use of an OsLOX10 gene in regulating rice seed activity.
The pure plant seedlings obtained by the method are further cultivated, and seeds thereof are harvested. Drying the newly harvested seeds at 37 ℃ for 2 days, soaking 50 plump seeds overnight for accelerating germination, placing the seeds in a 9CM culture dish paved with a layer of filter paper, placing the culture dish in a 28 ℃ illumination incubator, and counting and calculating indexes such as germination rate, germination vigor and the like. In the invention, seeds are placed in a 28 ℃ illumination incubator to be taken as the 0 th day, the germination numbers of the 3 rd day and the 7 th day are counted, the ratio of the germination number of the seeds on the 3 rd day to the total number of the seeds is defined as the germination vigor, and the ratio of the germination number of the seeds on the 7 th day to the total number of the seeds is defined as the germination rate.
The effect of the OsLOX10 gene on germination vigor and germination rate of freshly harvested seeds is shown in table 1 and fig. 6. In the experiment, 50 seeds of each group are selected in the experiment process, and four groups of the raw germination data of the newly harvested seeds are obtained by repeating each experiment, wherein table 1 is the number of the seeds germinated on the 3 rd day, and table 2 is the number of the seeds germinated on the 7 th day.
Table 1: 3-day germination condition data table for new harvested seeds of OsLOX10 gene
Rice species WT lox10-1 lox10-2 LOX10-OE1 LOX10-OE2
First group of 15 13 10 23 20
Second group of 16 17 12 24 19
Third group of 14 12 12 19 25
Fourth group 17 15 9 20 22
Table 2: 7-day germination condition data table for new harvested seeds of OsLOX10 gene
Rice species WT lox10-1 lox10-2 LOX10-OE1 LOX10-OE2
First group of 41 33 34 42 42
Second group of 40 34 34 42 39
Third group of 38 33 30 43 41
Fourth group 40 31 29 39 45
Analysis shows that under normal conditions, the over-expression of the OsLOX10 enhances the germination rate of seeds, including germination rate, germination vigor, seedling vigor index and the like.
Drying newly-harvested seeds at 42 ℃ for 2 days to break dormancy, taking 50 full seeds, placing the seeds in an artificial aging incubator (42, 80% humidity) for culturing for 18 days, taking the 50 full seeds, soaking the seeds overnight for accelerating germination, placing the seeds in a 9CM culture dish paved with a layer of filter paper, placing the seeds in a 28 ℃ illumination incubator, and counting and calculating indexes such as germination rate, germination vigor and the like. The effect of the OsLOX10 gene on seed storage tolerance is shown in tables 3, 4 and fig. 7. In the experiment, 50 seeds of each group are selected in the experiment process, and four groups of the raw germination data of the seeds after artificial aging are obtained by repeating each experiment, wherein table 3 shows the number of the seeds germinated on the 7 th day, and table 4 shows the number of the seeds germinated on the 14 th day.
Table 3: 7-day germination condition data of artificial aged seeds of OsLOX10 genes
Rice species WT lox10-1 lox10-2 LOX10-OE1 LOX10-OE2
First group of 12 16 23 6 13
Second group of 11 21 23 9 10
Third group of 10 20 21 5 8
Fourth group 14 19 19 9 11
Table 4: 14-day germination condition data of artificial aging seeds of OsLOX10 genes
Rice species WT lox10-1 lox10-2 LOX10-OE1 LOX10-OE2
First group of 19 27 30 14 23
Second group of 18 34 33 20 18
Third group of 23 33 28 15 20
Fourth group 21 29 26 19 20
Analysis shows that after aging for 18 days, the germination rate of the gene knockout mutant seeds is stronger than that of wild type and over-expression strains.
The invention is based on rice, corresponding plants are prepared and screened through knockout and overexpression of the OsLOX10 gene, and the germination rate, the germination potential and the seed storage property of the seeds obtained from the corresponding plants are further examined. Experiments show that the germination rate of the artificially aged seeds is higher than that of wild and over-expressed strains, so that the gene knockout seedling has the property of improving the aging resistance of the seeds. For newly picked gene over-expression seeds, the over-expression enhances the germination rate of the seeds, including germination rate, germination vigor, seedling vigor index and the like. The invention discovers that the OsLOX10 gene can play a role in regulating the activity of seeds and the storage property of the seeds through specific embodiments, and provides a novel scheme for prolonging the storage property of rice seeds.

Claims (8)

1. The application of the rice OsLOX10 gene in regulating the activity of rice seeds is characterized in that the CDS region of the OsLOX10 gene has a gene with a sequence shown as SEQ NO. 1 or a complementary sequence thereof.
2. The use of the rice OsLOX10 gene according to claim 1, wherein the regulation of rice seed activity is regulation of rice seed germination vigor, seed germination rate and/or seed storage property.
3. The use of the OsLOX10 gene for regulating activity of rice seeds according to claim 2, wherein the storage property of rice seeds is improved by knocking out the OsLOX10 gene or reducing the expression level of the protein encoded by the OsLOX10 gene in rice, and the protein encoded by the OsLOX10 gene has an amino acid sequence shown as SEQ NO. 2.
4. The use of the rice OsLOX10 gene according to claim 2, wherein the germination vigor or germination percentage of the seeds is improved by overexpressing the OsLOX10 gene or increasing the expression level or expression activity of the protein encoded by the gene in rice.
5. The use of the rice OsLOX10 gene according to claim 3, wherein the improvement of germination vigor or germination percentage of the seeds is improvement of germination vigor or germination percentage of newly harvested rice seeds.
6. The use of the rice OsLOX10 gene according to claim 3 for regulating activity of rice seeds, wherein the method for knocking out the OsLOX10 gene comprises: selecting an OsLOX10 knockout target point, introducing the target point through PCR amplification, constructing a CRISPR/Cas9 knockout vector of the gene by utilizing a Golden Gate cloning method, integrating a vector DNA fragment carrying the OsLox10-CRISPR-Cas9 knockout target point into rice callus cells by agrobacterium and inducing differentiation into seedlings; wherein the OsLOX10 knockout target OsLox10-Cas9-T1 is shown in SEQ NO. 3; osLox10-Cas9-T2 is shown as SEQ NO. 4.
7. The use of the rice OsLOX10 gene according to claim 4 for regulating activity of rice seeds, wherein the method for overexpressing the OsLOX10 gene comprises: carrying out PCR amplification by taking a plasmid containing a target gene as a template, then carrying out connection transformation to construct an OsLOX10 over-expression vector, integrating the over-expression vector into rice callus cells through agrobacterium and inducing differentiation into seedlings; wherein in the PCR amplification, the primers are as follows: osLox10-OE-F is shown as SEQ NO. 5, and OsLox10-OE-R is shown as SEQ NO. 6.
8. The use of the rice OsLOX10 gene according to claim 1, wherein the rice is Kitaake.
CN202211712411.4A 2022-12-29 2022-12-29 Application of rice lipoxygenase OsLOX10 gene in regulation of activity of rice seeds Pending CN116732090A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202211712411.4A CN116732090A (en) 2022-12-29 2022-12-29 Application of rice lipoxygenase OsLOX10 gene in regulation of activity of rice seeds

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202211712411.4A CN116732090A (en) 2022-12-29 2022-12-29 Application of rice lipoxygenase OsLOX10 gene in regulation of activity of rice seeds

Publications (1)

Publication Number Publication Date
CN116732090A true CN116732090A (en) 2023-09-12

Family

ID=87913891

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202211712411.4A Pending CN116732090A (en) 2022-12-29 2022-12-29 Application of rice lipoxygenase OsLOX10 gene in regulation of activity of rice seeds

Country Status (1)

Country Link
CN (1) CN116732090A (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN116731986A (en) * 2022-12-29 2023-09-12 福建省农业科学院水稻研究所 Application of rice OsLOX10 gene in regulation of salt and alkali stress resistance of rice

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2016200987A1 (en) * 2015-06-08 2016-12-15 Indigo Agriculture, Inc. Streptomyces endophyte compositions and methods for improved agronomic traits in plants
CN109929856A (en) * 2019-04-11 2019-06-25 华中农业大学 The application of rice fatty acid '-hydroxylase gene OsFAH2
CN112553224A (en) * 2020-10-30 2021-03-26 广东省农业科学院农业生物基因研究中心 Application of histone deacetylase gene OsHDT701 in prolonging life of plant seeds
CN116731986A (en) * 2022-12-29 2023-09-12 福建省农业科学院水稻研究所 Application of rice OsLOX10 gene in regulation of salt and alkali stress resistance of rice

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2016200987A1 (en) * 2015-06-08 2016-12-15 Indigo Agriculture, Inc. Streptomyces endophyte compositions and methods for improved agronomic traits in plants
CN109929856A (en) * 2019-04-11 2019-06-25 华中农业大学 The application of rice fatty acid '-hydroxylase gene OsFAH2
CN112553224A (en) * 2020-10-30 2021-03-26 广东省农业科学院农业生物基因研究中心 Application of histone deacetylase gene OsHDT701 in prolonging life of plant seeds
CN116731986A (en) * 2022-12-29 2023-09-12 福建省农业科学院水稻研究所 Application of rice OsLOX10 gene in regulation of salt and alkali stress resistance of rice

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
HUANG J等: "OsLOX2, a rice type I lipoxygenase, confers opposite effects on seed germination and longevity", 《TRANSGENIC RESEARCH》, vol. 23, no. 4, 31 August 2014 (2014-08-31), pages 643 *
SINHA K等: "Mobilization of storage lipid reserve and expression analysis of lipase and lipoxygenase genes in rice (Oryza sativa var. Pusa Basmati 1) bran during germination", 《PHYTOCHEMISTRY》, vol. 180, 31 December 2020 (2020-12-31), pages 112538 *
WANG F等: "The lipoxygenase OsLOX10 affects seed longevity and resistance to saline-alkaline stress during rice seedlings", 《PLANT MOLECULAR BIOLOGY》, vol. 111, no. 4, 31 March 2023 (2023-03-31), pages 415 - 428 *
杜明等: "影响水稻种子活力的储藏因素分析", 《土壤与作物》, vol. 7, no. 4, 15 December 2018 (2018-12-15), pages 419 - 422 *
王福祥等: "水稻所水稻抗逆分子育种团队在水稻种子活力和耐盐碱研究方面取得进展", 《福建稻麦科技》, vol. 41, no. 1, 31 March 2023 (2023-03-31), pages 58 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN116731986A (en) * 2022-12-29 2023-09-12 福建省农业科学院水稻研究所 Application of rice OsLOX10 gene in regulation of salt and alkali stress resistance of rice

Similar Documents

Publication Publication Date Title
CN114369599B (en) Long-chain non-coding RNA gene for increasing rice yield and application thereof
CN112522291B (en) Rice OsSH3P2 gene and application thereof
CN117757769B (en) CsMEK5 gene and application of coded protein thereof in improving citrus canker resistance and transgenic plant
CN116732090A (en) Application of rice lipoxygenase OsLOX10 gene in regulation of activity of rice seeds
CN116731986A (en) Application of rice OsLOX10 gene in regulation of salt and alkali stress resistance of rice
CN116716336B (en) Application of OsSKIPa gene and encoding protein thereof in regulation and control of plant seed development
CN114480416B (en) Application of tsaoko AtDRM2 gene in improving cold resistance of plants
CN112553224B (en) Application of histone deacetylase gene OsHDT701 in prolonging life of plant seeds
Otani et al. Genetic transformation of sweet potato (Ipomoea batatas (L.) Lam.) by Agrobacterium tumefaciens
CN110922459B (en) Application of SlSNAT1 protein and related biological material thereof in regulation and control of plant seed aging resistance
CN117887732B (en) BnARF14 gene and application of protein thereof in improving grain weight character of plants
CN116063433B (en) Gene for regulating oil content of rape seeds and application thereof
CN114381462B (en) Application of tsaoko AtDRM1 gene in improving heat resistance of plants
CN117844849B (en) Genetic transformation method of Mongolian agropyron
CN116121298B (en) Application of inhibiting expression of HSRP1 gene in improving heat resistance of plants
CN117417950A (en) Rice tillering regulatory gene, mutant, preparation method and application thereof
KR101238259B1 (en) ADH gene increasing seed germination of plant at anaerobic condition and uses thereof
AU2005330877B2 (en) Method of constructing transgenic ice plant
CN118853740A (en) Application of soybean SOC5 gene in regulation and control of plant seed quality and yield
CN118638802A (en) Tobacco transcription factor NtWRKY gene, protein and application thereof in flavonoid anabolism
CN118745439A (en) Method for improving citrus canker resistance by CsERF gene and application
Do et al. Agrobacterium-mediated transformation of Nang Thom Cho Dao, an indica rice variety
CN116355870A (en) Application of maize ribonucleotide reductase large subunit ZmLSC1 gene in plant variety breeding
CN117551686A (en) Method for regulating and controlling VRN1 gene transcription level of poaceae plant, biological material and application thereof
CN116444637A (en) Protein GmWRKY100 related to plant leaf senescence and yield regulation, and coding gene and application thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination