CN114807235B - Construction method of immortalized mesenchymal stem cells and method for preparing exosomes - Google Patents
Construction method of immortalized mesenchymal stem cells and method for preparing exosomes Download PDFInfo
- Publication number
- CN114807235B CN114807235B CN202110062621.2A CN202110062621A CN114807235B CN 114807235 B CN114807235 B CN 114807235B CN 202110062621 A CN202110062621 A CN 202110062621A CN 114807235 B CN114807235 B CN 114807235B
- Authority
- CN
- China
- Prior art keywords
- mesenchymal stem
- stem cells
- plasmid
- myc
- exosome
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
- C12N15/86—Viral vectors
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
- C07K14/70596—Molecules with a "CD"-designation not provided for elsewhere
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/82—Translation products from oncogenes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
- C12N5/06—Animal cells or tissues; Human cells or tissues
- C12N5/0602—Vertebrate cells
- C12N5/0652—Cells of skeletal and connective tissues; Mesenchyme
- C12N5/0662—Stem cells
- C12N5/0668—Mesenchymal stem cells from other natural sources
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/95—Fusion polypeptide containing a motif/fusion for degradation (ubiquitin fusions, PEST sequence)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
- C12N15/86—Viral vectors
- C12N15/867—Retroviral vectors
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2510/00—Genetically modified cells
- C12N2510/04—Immortalised cells
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Genetics & Genomics (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Zoology (AREA)
- Biotechnology (AREA)
- General Health & Medical Sciences (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biochemistry (AREA)
- Wood Science & Technology (AREA)
- Biophysics (AREA)
- General Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- Medicinal Chemistry (AREA)
- Cell Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Microbiology (AREA)
- Gastroenterology & Hepatology (AREA)
- Developmental Biology & Embryology (AREA)
- Immunology (AREA)
- Toxicology (AREA)
- Rheumatology (AREA)
- Virology (AREA)
- Physics & Mathematics (AREA)
- Plant Pathology (AREA)
- Oncology (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The application relates to the field of mesenchymal stem cell culture, and in particular discloses a construction method of immortalized mesenchymal stem cells and a method for preparing exosomes. The construction method of the immortalized mesenchymal stem cells comprises the following steps: synthesizing genes; constructing recombinant lentiviral plasmids; packaging lentiviruses; and transfecting the mesenchymal stem cells by using slow viruses to obtain the immortalized mesenchymal stem cells. The method for preparing exosomes comprises the following steps: immortalized mesenchymal stem cells are cultured; and (3) separating and purifying: collecting supernatant, centrifuging, removing cell debris, collecting supernatant, and filtering; centrifuging again, removing supernatant, and suspending exosome precipitate to obtain exosome heavy suspension; centrifuging the exosome heavy suspension, and removing supernatant to obtain exosome. The construction method of the immortalized mesenchymal stem cells can construct the mesenchymal stem cells which are immortalized and secrete a large amount of exosomes, can obtain a large amount of exosomes without culturing cells on a large scale, and can reduce the cell culture cost to a certain extent.
Description
Technical Field
The application relates to the field of mesenchymal stem cell culture, in particular to a construction method of immortalized mesenchymal stem cells and a method for preparing exosomes.
Background
The exosome is a tiny membrane bubble which can be secreted by most cells in the body, has a lipid bilayer membrane, is widely existed and distributed in various body fluids, carries and transmits important signal molecules, and forms a brand-new cell-cell transmission system; not only affects the physiological state of cells and is closely related to the occurrence and progress of various diseases, but also can be used as a carrier of cancer vaccines and anticancer drugs and a potential substitute for cell treatment.
In regenerative therapy application, exosomes can avoid some defects of stem cell therapy, such as ethical problems, and the like, and the exosomes are simple to separate, high in stability, convenient to store, capable of being accurately quantified and analyzed, and can be used as an effective substitute for stem cell therapy. Compared with the mesenchymal stem cells, the exosome has low immunogenicity, no tumorigenic risk, higher safety and greater tissue regeneration potential, so that the mesenchymal stem cell exosome has great advantages in tissue regeneration.
However, the mesenchymal stem cells have insufficient in-vitro expansion capacity, cells begin to age after several passages, the regeneration capacity of exosomes secreted by the aged mesenchymal stem cells is obviously impaired, and the therapeutic effect is also greatly impaired. Therefore, in order to obtain a sufficient amount of exosomes with regenerative potential for use in therapy, related enterprises choose to expand the culture scale of mesenchymal cells, and repeatedly prepare mesenchymal cells.
In view of the above-mentioned related art, the inventors considered that the method of expanding the culture scale can produce a large amount of mesenchymal stem cell exosomes, but this method of expanding the cell culture scale would certainly increase the cost of cell culture and would also increase a large amount of labor.
Disclosure of Invention
In order to solve the problem that a large amount of exosomes can be prepared by culturing mesenchymal stem cells in a large scale, the application provides a construction method of immortalized mesenchymal stem cells and a method for preparing exosomes.
In a first aspect, the application provides a construction method of immortalized mesenchymal stem cells, which adopts the following technical scheme:
the construction method of the immortalized mesenchymal stem cells comprises the following steps:
s1, gene synthesis: connecting the c-Myc sequence and the CD9 sequence by using the P2A sequence to synthesize Myc-P2A-CD9 gene fragments;
s2, constructing a recombinant lentiviral plasmid: ligating the Myc-P2A-CD9 gene fragment to the pLV-Flag (C1) plasmid;
s3, packaging lentiviruses: transfecting 293T cells by using the recombinant lentiviral plasmid in S2, and collecting lentiviruses;
s4, constructing immortalized mesenchymal stem cells: and (3) transfecting the mesenchymal stem cells by using the slow virus in the S3 to obtain the immortalized mesenchymal stem cells.
By adopting the technical scheme, the c-Myc is the earliest protooncogene, has a plurality of functional areas related to neoplasia, and transcriptionally expressed proteins enter a cell nucleus through a nuclear membrane to be specifically combined with a promoter binding site of telomerase, so that the telomerase mRNA is induced to express rapidly, the telomerase activity is directly activated, and the cells are promoted to enter immortalization; CD9 has various biological functions, plays an important role in cell adhesion, cell movement, activation, differentiation, tumor metastasis and the like, and can promote cells to secrete exosomes;
P2A acts as a self-cleaving peptide, enabling the production of multiple proteins from one transcript. The traditional technical scheme for simultaneously expressing a plurality of genes is that a plurality of promoters and open reading frames are utilized, and the promoters can lead to obvious increase of vectors and possibly lead to low subsequent transfection efficiency; multiple promoters also tend to place a metabolic burden on the host cell. The P2A has the size of only 60bp, and the length of the vector can not be obviously increased when the c-Myc gene and the CD9 gene are connected, so that the host cell metabolism burden brought by multiple promoters can be reduced, and the subsequent cell transfection efficiency can be enhanced.
The technical scheme is that a recombinant lentiviral plasmid is constructed by connecting a c-Myc gene and a CD9 gene with P2A, then the recombinant lentiviral plasmid is used for packaging the recombinant lentivirus, and the mesenchymal stem cells are infected by the recombinant lentivirus, so that after protein translation, two proteins, namely the c-Myc and the CD9, obtained by shearing the P2A can respectively run. The mesenchymal stem cells enter immortalization under the action of c-Myc, and can secrete a large amount of exosomes under the action of CD9, so that the immortalized mesenchymal stem cells which can be passaged infinitely and secrete a large amount of exosomes can be obtained, a large amount of exosomes can be obtained without large-scale cell culture, and the cell culture cost can be reduced to a certain extent.
Preferably, the step S2 is performed by the following method:
1) And (3) enzyme cutting: performing enzyme digestion on Myc-P2A-CD9 gene fragments to obtain target gene fragments, and performing linearization enzyme digestion on pLV-Flag (C1) plasmids to obtain linearization plasmids;
2) Recovering the target gene fragment and linearization plasmid;
3) And (3) connection: uniformly mixing 9.5-10.5 mu L of connecting reagent, 2.3-2.7 mu L of linearization plasmid and 7.3-7.7 mu L of target gene fragment, and reacting at 16 ℃ for 28-32min to obtain a connecting product containing recombinant lentiviral plasmid pLV-MYC-P2A-CD 9;
4) Conversion: transforming DH5 alpha competent cells by using the connection product in the step 3), and extracting plasmids to obtain recombinant lentiviral plasmids pLV-MYC-P2A-CD9.
By adopting the technical scheme, the linearized plasmid and the target gene fragment can be better connected by using a specific amount of connecting reagent, the linearized plasmid and the target gene fragment, and then the recombinant lentiviral plasmid can be accurately constructed through transformation and plasmid extraction.
Preferably, the enzyme digestion is specifically performed by the following method:
enzymatic cleavage of Myc-P2A-CD9 Gene fragment: taking 0.8-1.2 mu g Myc-P2A-CD9 gene fragment, adding 0.8-1.2 mu L restriction enzyme Xba I, 0.8-1.2 mu L restriction enzyme EcoR I and 4.8-5.2 mu L buffer solution, adding double distilled water until the total volume is 50 mu L, and placing the mixture at 37 ℃ for reaction for 55-65min to obtain a sample A;
linearized cleavage of pLV-Flag (C1) plasmid: taking 0.8-1.2 mu g of pLV-Flag (C1) plasmid, adding 0.8-1.2 mu L of restriction enzyme Xba I, 0.8-1.2 mu L of restriction enzyme EcoR I and 4.8-5.2 mu L of buffer solution, adding double distilled water to a total volume of 50 mu L, and placing the mixture at 37 ℃ for reaction for 55-65min to obtain a sample B.
By adopting the technical scheme, the restriction enzyme Xba I and the restriction enzyme EcoR I are utilized to respectively carry out enzyme digestion on the Myc-P2A-CD9 gene fragment and the pLV-Flag (C1) plasmid, thereby obtaining the required target gene fragment and linearization plasmid.
Preferably, the gene fragment of interest and linearized plasmid are recovered using the following method:
1) Preparing agarose gel;
2) Agarose gel electrophoresis: mixing the sample A and the sample B with 5 times of concentrated DNA loading buffer solution respectively, concentrating until the final concentration of the DNA loading buffer solution is one time, adding the mixed solution into agarose gel sample application holes, and carrying out electrophoresis for 28-32min under 120V voltage;
3) Cutting the target strip: agarose gel containing the target band was excised and transferred to a centrifuge tube, followed by recovery of the target gene fragment and linearization plasmid.
By adopting the technical scheme, the target gene fragment and the linearization plasmid are recovered by adopting an agarose gel electrophoresis mode, impurities such as protein, other organic compounds, inorganic salt ions and the like can be removed, and the obtained target gene fragment and linearization plasmid can be ensured to have higher purity to a certain extent.
Preferably, the ligation product containing the recombinant lentiviral plasmid pLV-MYC-P2A-CD9 was transformed into DH 5. Alpha. Competent cells by the following method:
1) Mixing 9.5-10.5 μl of ligation product containing recombinant lentiviral plasmid pLV-MYC-P2A-CD9 and 98-102 μl DH5 α competent cells to obtain a mixture, and ice-bathing the mixture for 19-21min;
2) After ice bath, placing the mixture into hot water at 42 ℃ for 85-95s, and then ice-bathing for 115-125s;
3) Adding the mixture into 180-202 mu L of LB liquid medium without antibiotics, resuscitating for 55-65min at 37 ℃ and 200rpm to obtain mixed bacterial liquid;
4) Sucking 98-102 mu L of the mixed bacterial liquid, coating the mixed bacterial liquid into LB solid medium containing 100 mu g/mL of antibiotics, and culturing the mixed bacterial liquid in an incubator for 23-25 hours.
By adopting the technical scheme, DH5 alpha competent cells are selected for DNA transformation, so that the transformation efficiency is high, and the construction of recombinant lentiviral plasmids is facilitated.
Preferably, in the step S3, the specific operation manner of the lentiviral package is as follows:
1) Cell inoculation: inoculating 293T cells into a culture plate containing a lentivirus packaging culture medium, and culturing for 23-25 hours;
2) Diluting the recombinant lentiviral plasmid to 1. Mu.g/. Mu.L;
preparing a pipe A: mixing 248-252 μl of serum-free culture medium and 6.5-7.5 μl of transfection reagent;
preparing a B pipe: mixing 248-252 μl of serum-free culture medium, 3.8-4.2 μg of pretreated plasmid and 5.5-6.5 μl of transfection reagent;
3) Preparation of liposome-DNA complexes: mixing the tube A and the tube B uniformly, and incubating for 9-11min at room temperature;
4) Transfection: removing 1mL of culture medium from each well of the culture plate, adding 495-505 mu L of liposome-DNA complex into each well, and incubating at 37 ℃ for 7.7-8.2h; changing the culture medium in the culture plate, and continuously culturing for 12-14h;
5) And (3) collecting: collecting supernatant in each hole of the culture plate, and centrifuging and concentrating to obtain the recombinant lentivirus.
By adopting the technical scheme, 293T cells are selected for transfection test, so that the transfection efficiency is high, and the recombinant lentivirus is packaged.
Preferably, the pretreated plasmid is prepared by mixing the following raw materials: 1.8-2.2. Mu.L of recombinant lentiviral plasmid, 1.1-1.3. Mu.L of psPAX2 and 0.7-0.9. Mu.L of pMD2G.
By adopting the technical scheme, the recombinant lentiviral plasmid can transcribe lentiviral genetic material, but can not translate the vector plasmid of the coat and protein component of the lentivirus; the psPAX2 is a plasmid capable of expressing lentivirus shells, an expression product can penetrate cell membranes more easily through an adhesion mechanism, the psPAX2 is a membrane protein plasmid of lentivirus, the psPAX2 and the recombinant lentivirus plasmid are co-transferred into 293T cells, and when the genome of the 293T cells is expressed, a target gene transcribed along with the expression product and proteins translated by the psPAX2 and the psPAX2 can be assembled into the lentivirus.
Preferably, the transfection in step 4) is performed when the cell confluency in the culture plate reaches 60-70%.
By adopting the technical scheme, the transfection reagent generally has certain toxicity to cells, and is transfected when the confluence is low, so that the tolerance of the cells to the transfection reagent is low, and the subsequent culture and amplification of the cells can be influenced; transfection is performed at too high a confluence, which, although highly resistant to the transfection reagent, can affect subsequent cell selection and also reduce transfection efficiency. By performing transfection when the confluency of cells reaches a specific range of values, the tolerance of the cells to the transfection reagent can be increased to some extent, while the likelihood of damage to cell activity due to overgrowth of the cells can be reduced.
In a second aspect, the present application provides a method for preparing exosomes, which adopts the following technical scheme:
a method of preparing an exosome comprising the steps of:
(1) Inoculating immortalized mesenchymal stem cells, and culturing;
(2) And (3) separating and purifying:
a) Collecting supernatant, centrifuging, removing cell debris, collecting supernatant, and filtering;
b) Centrifuging the supernatant obtained after the filtration in the step a), discarding the supernatant, and resuspending exosome sediment to obtain exosome heavy suspension;
c) Centrifuging the exosome heavy suspension in the step b), and removing the supernatant to obtain the exosome.
By adopting the technical scheme, the immortalized mesenchymal stem cells are cultured so as to secrete exosomes, and the supernatant is collected and centrifuged, so that the exosomes can be obtained.
Preferably, step a) is centrifuged at 10000g for 10min, and step b) and step c) are both centrifuged at 120000g for 90min.
By adopting the technical scheme, the exosome precipitation is facilitated, and the exosome can be separated from other impurities, so that the exosome with higher purity can be obtained.
In summary, the application has the following beneficial effects:
1. the application uses the recombinant slow virus carrying the c-Myc gene and the CD9 gene to transfect the mesenchymal stem cells, so that the mesenchymal stem cells enter immortalization and can secrete exosomes in a large quantity, the cost for culturing the mesenchymal stem cells on a large scale is reduced, and the problems of difficult material taking and easy aging of the mesenchymal stem cells are solved.
2. According to the application, the P2A is utilized to connect the c-Myc gene and the CD9 gene, so that the c-Myc and CD9 proteins are translated into two independent proteins through self-cutting of the P2A without influencing the respective running functions of the c-Myc and CD9, and therefore, the mesenchymal stem cells can enter immortalization and can secrete a large amount of exosomes.
3. The size of the P2A selected by the application is only 60bp, which can reduce the host cell metabolism burden brought by multiple promoters, can enhance the cell transfection efficiency and is beneficial to constructing the immortalized mesenchymal stem cells.
Drawings
FIG. 1 is a diagram showing the electrophoresis detection of the Myc-P2A-CD9 gene fragment obtained in example 1 of the present application.
Detailed Description
The present application will be described in further detail with reference to examples.
The sources of the raw materials in the application are shown in table 1:
TABLE 1 sources of the raw materials
Preparation example of 1×TAE buffer
4.84g Tris buffer, 0.744g Na 2 EDTA.2H 2 O, 1.142mL acetic acid, add to ddH 2 O, add ddH continuously 2 O is dissolved by stirring until the total volume is 1L, and the 1 xTAE buffer solution is obtained.
Preparation example of agarose gel
Taking 0.5g agarose, adding 50mL 1 xTAE buffer solution, uniformly mixing, boiling for 2min by using a microwave oven, and then adding into a gel tank for condensation.
Preparation example of liquid Medium
10g of tryptone, 5g of yeast extract and 10g of NaCl are taken and ddH is added 2 Dissolving in O, and continuing adding ddH 2 O and adjusting the pH to 7.0 until the total volume is 1L, and then autoclaving at 121 ℃ for 15 min.
Preparation example of solid Medium
10g of tryptone, 5g of yeast extract and 10g of NaCl are taken and ddH is added 2 Dissolving in O, adjusting pH to 7.0, adding 10g of agar powder, and continuously adding ddH 2 O is added until the total volume is 1L, and then the mixture is autoclaved at 121 ℃ for 15 min.
Preparation examples of antibiotics
1g of ampicillin powder corresponding to the antibiotic was dissolved in 20mL of ddH 2 In O, filtering and sterilizing by using a film bacterial filter with the aperture of 0.22 mu m.
Preparation example of buffer
And preparing 20mM Tris-HCl, 500mM NaCl and 0.05% Tween20 into a total volume of 1L, and fully and uniformly mixing to obtain the TBST buffer solution, wherein the pH value of the TBST buffer solution is 7.5.
Examples
Example 1
The construction method of the immortalized mesenchymal stem cells comprises the following steps:
s1, gene synthesis:
1) Sequence design: the coding sequences of c-Myc and CD9 are respectively searched at NCBI website, and the P2A sequence can refer to documents High Cleavage Efficiency of a A Peptide Derived from Porcine Teschovirus-1 in Human Cell Lines, zebrafish and MicePLoS one.2011 and 6 (4): e18556, and MYC-P2A-CD9 polycistronic containing Xba I and EcoR I restriction sites and a gram sequence is designed.
The c-Myc sequence is as follows:
CTGGATTTTTTTCGGGTAGTGGAAAACCAGCAGCCTCCCGCGACGATGCCCCTCAACGTTAGCTTCACCAACAGGAACTATGACCTCGACTACGACTCGGTGCAGCCGTATTTCTACTGCGACGAGGAGGAGAACTTCTACCAGCAGCAGCAGCAGAGCGAGCTGCAGCCCCCGGCGCCCAGCGAGGATATCTGGAAGAAATTCGAGCTGCTGCCCACCCCGCCCCTGTCCCCTAGCCGCCGCTCCGGGCTCTGCTCGCCCTCCTACGTTGCGGTCACACCCTTCTCCCTTCGGGGAGACAACGACGGCGGTGGCGGGAGCTTCTCCACGGCCGACCAGCTGGAGATGGTGACCGAGCTGCTGGGAGGAGACATGGTGAACCAGAGTTTCATCTGCGACCCGGACGACGAGACCTTCATCAAAAACATCATCATCCAGGACTGTATGTGGAGCGGCTTCTCGGCCGCCGCCAAGCTCGTCTCAGAGAAGCTGGCCTCCTACCAGGCTGCGCGCAAAGACAGCGGCAGCCCGAACCCCGCCCGCGGCCACAGCGTCTGCTCCACCTCCAGCTTGTACCTGCAGGATCTGAGCGCCGCCGCCTCAGAGTGCATCGACCCCTCGGTGGTCTTCCCCTACCCTCTCAACGACAGCAGCTCGCCCAAGTCCTGCGCCTCGCAAGACTCCAGCGCCTTCTCTCCGTCCTCGGATTCTCTGCTCTCCTCGACGGAGTCCTCCCCGCAGGGCAGCCCCGAGCCCCTGGTGCTCCATGAGGAGACACCGCCCACCACCAGCAGCGACTCTGAGGAGGAACAAGAAGATGAGGAAGAAATCGATGTTGTTTCTGTGGAAAAGAGGCAGGCTCCTGGCAAAAGGTCAGAGTCTGGATCACCTTCTGCTGGAGGCCACAGCAAACCTCCTCACAGCCCACTGGTCCTCAAGAGGTGCCACGTCTCCACACATCAGCACAACTACGCAGCGCCTCCCTCCACTCGGAAGGACTATCCTGCTGCCAAGAGGGTCAAGTTGGACAGTGTCAGAGTCCTGAGACAGATCAGCAACAACCGAAAATGCACCAGCCCCAGGTCCTCGGACACCGAGGAGAATGTCAAGAGGCGAACACACAACGTCTTGGAGCGCCAGAGGAGGAACGAGCTAAAACGGAGCTTTTTTGCCCTGCGTGACCAGATCCCGGAGTTGGAAAACAATGAAAAGGCCCCCAAGGTAGTTATCCTTAAAAAAGCCACAGCATACATCCTGTCCGTCCAAGCAGAGGAGCAAAAGCTCATTTCTGAAGAGGACTTGTTGCGGAAACGACGAGAACAGTTGAAACACAAACTTGAACAGCTACGGAACTCTTGTGCGTAA
the CD9 sequence is as follows:
ATGAGC GTCCTGTCCA GCTGGGAGCT GTGCGTCAAA TACGCAATTT TCATCTTCAA CTTTGTCTTC TGGCTTGCAG GGACTGGAGT GCTGGCTGTG GGATTATGGC TTCGTTTCGA CTCCAGGACC AAAGCACTGT TTGAAGGAGA AGACGCGCCC TCTGTCTTCT TCACTGGTGT TTATCTGCTG ATCGCTGCAG GAGCGTTGAT GATGGTGGTG GGATTCCTGG GATGCTGTGG AGCCATTAAA GAGTCGCCCT GCATGCTGGG ACTGTTCTTC ATCTTCCTGC TCATCATCTT TGCTGCTGAA GTGGCTGCAG GGATCTGGGG ACTGTCCAAC ACGCACACGG TCATAGAGGA AGTCACAGAG TTTTATAAGC AGACTTTTGA CAACTACAGG ACCACCAAAC AGGAAGCGCT GAAGGAGACC CTCCGCCTGA TCCACTTTGG GCTGGACTGC TGCGGTCCTA CAGGAAGCGT CTTCGATGCT GCCAAAGACA TCTGTCCAAA GCAGGAAGGA CTGGCCGTCC TCGTTACCAC GAGTTGCCCA AAAGCCATCG ATGAAGTATT CAACAACAAG CTGCACATCA TCGGTGGAGT TGGGATCGGT ATTGGCGTCA TCATGATCTT TGGGATGATC TTCAGCATGA TCCTTTGCTG TGCCATCAAG AGGTCCAGAG AATATGTGTAA
the designed MYC-P2A-CD9 sequence is as follows:
TCTAGAGCCACCATGGATTTTTTTCGGGTAGTGGAAAACCAGCAGCCTCCCGCGACGATGCCCCTCAACGTTAGCTTCACCAACAGGAACTATGACCTCGACTACGACTCGGTGCAGCCGTATTTCTACTGCGACGAGGAGGAGAACTTCTACCAGCAGCAGCAGCAGAGCGAGCTGCAGCCCCCGGCGCCCAGCGAGGATATCTGGAAGAAATTCGAGCTGCTGCCCACCCCGCCCCTGTCCCCTAGCCGCCGCTCCGGGCTCTGCTCGCCCTCCTACGTTGCGGTCACACCCTTCTCCCTTCGGGGAGACAACGACGGCGGTGGCGGGAGCTTCTCCACGGCCGACCAGCTGGAGATGGTGACCGAGCTGCTGGGAGGAGACATGGTGAACCAGAGTTTCATCTGCGACCCGGACGACGAGACCTTCATCAAAAACATCATCATCCAGGACTGTATGTGGAGCGGCTTCTCGGCCGCCGCCAAGCTCGTCTCAGAGAAGCTGGCCTCCTACCAGGCTGCGCGCAAAGACAGCGGCAGCCCGAACCCCGCCCGCGGCCACAGCGTCTGCTCCACCTCCAGCTTGTACCTGCAGGATCTGAGCGCCGCCGCCTCAGAGTGCATCGACCCCTCGGTGGTCTTCCCCTACCCTCTCAACGACAGCAGCTCGCCCAAGTCCTGCGCCTCGCAAGACTCCAGCGCCTTCTCTCCGTCCTCGGATTCTCTGCTCTCCTCGACGGAGTCCTCCCCGCAGGGCAGCCCCGAGCCCCTGGTGCTCCATGAGGAGACACCGCCCACCACCAGCAGCGACTCTGAGGAGGAACAAGAAGATGAGGAAGAAATCGATGTTGTTTCTGTGGAAAAGAGGCAGGCTCCTGGCAAAAGGTCAGAGTCTGGATCACCTTCTGCTGGAGGCCACAGCAAACCTCCTCACAGCCCACTGGTCCTCAAGAGGTGCCACGTCTCCACACATCAGCACAACTACGCAGCGCCTCCCTCCACTCGGAAGGACTATCCTGCTGCCAAGAGGGTCAAGTTGGACAGTGTCAGAGTCCTGAGACAGATCAGCAACAACCGAAAATGCACCAGCCCCAGGTCCTCGGACACCGAGGAGAATGTCAAGAGGCGAACACACAACGTCTTGGAGCGCCAGAGGAGGAACGAGCTAAAACGGAGCTTTTTTGCCCTGCGTGACCAGATCCCGGAGTTGGAAAACAATGAAAAGGCCCCCAAGGTAGTTATCCTTAAAAAAGCCACAGCATACATCCTGTCCGTCCAAGCAGAGGAGCAAAAGCTCATTTCTGAAGAGGACTTGTTGCGGAAACGACGAGAACAGTTGAAACACAAACTTGAACAGCTACGGAACTCTTGTGCG GGA AGC GGA GCT ACT AAC TTC AGC CTG AAG CAG GCT GGA GAC GTG GAG AAC CCT GGA CCTATGAGCGTCCTGTCCA GCTGGGAGCTGTGCGTCAAATACGCAATTTTCATCTTCAACTTTGTCTTCTGGCTTGCAGGGACTGGAGTGCTGGCTGTGGGATTATGGCTTCGTTTCGACTCCAGGACCAAAGCACTGTTTGAAGGAGAAGACGCGCCCTCTGTCTTCTTCACTGGTGTTTATCTGCTGATCGCTGCAGGAGCGTTGATGATGGTGGTGGGATTCCTGGGATGCTGTGGAGCCATTAAAGAGTCGCCCTGCATGCTGGGACTGTTCTTCATCTTCCTGCTCATCATCTTTGCTGCTGAAGTGGCTGCAGGGATCTGGGGACTGTCCAACACGCACACGGTCATAGAGGAAGTCACAGAGTTTTATAAGCAGACTTTTGACAACTACAGGACCACCAAACAGGAAGCGCTGAAGGAGACCCTCCGCCTGATCCACTTTGGGCTGGACTGCTGCGGTCCTACAGGAAGCGTCTTCGATGCTGCCAAAGACATCTGTCCAAAGCAGGAAGGACTGGCCGTCCTCGTTACCACGAGTTGCCCAAAAGCCATCGATGAAGTATTCAACAACAAGCTGCACATCATCGGTGGAGTTGGGATCGGTATTGGCGTCATCATGATCTTTGGGATGATCTTCAGCATGATCCTTTGCTGTGCCATCAAGAGGTCCAGAG AATATGTGTAAGAATTC；
2) Myc-P2A-CD9 gene fragment synthesis: synthesizing a target sequence by using a Droligo BLP192 DNA synthesizer, respectively taking 100g of adenine monomer, 100g of thymine monomer, 100g of guanine monomer and 100g of cytosine monomer, respectively dissolving with acetonitrile, adding into the synthesizer, synthesizing a primer on a synthesis column according to the operation instruction of the synthesizer, and eluting by ammonia ammonolysis to obtain a primer fragment;
3) And (3) PCR amplification: PCR amplification procedure was performed using the PCR kit KOD-Plus-Neo:
a. first round reaction: mu.L of 2mM dNTP was taken5. Mu.L of the primer fragment synthesized in step 2), 1. Mu.L of DNA polymerase, 5. Mu.L of 10 XDNA polymerase buffer, 25. Mu.L of 25 mM MgSO 4 、9μL ddH 2 O, total reaction volume 50. Mu.L, was placed in a PCR amplification apparatus after thoroughly mixing, and then amplified according to the following conditions: pre-denaturing at 95deg.C for 2min, denaturing at 98deg.C for 30s, annealing at 58deg.C for 30s (18 cycles), extending at 72deg.C for 30s/1kb, and final extending at 72deg.C for 2min to obtain primary product;
b. second round reaction: mu.L of 2mM dNTP, 2. Mu.L of primer, 5. Mu.L of the primary product obtained in step a, 25. Mu.L of 25 mM MgSO were taken 4 5. Mu.L of 10 XDNA polymerase buffer, 1. Mu.L of DNA polymerase, 10. Mu.L of ddH 2 O, 50 mu L of total reaction volume, and adding the mixture into a PCR amplification instrument after fully mixing, and then amplifying according to the following conditions: the Myc-P2A-CD9 gene fragment was obtained by pre-denaturing at 95℃for 2min, denaturing at 98℃for 30s, annealing at 58℃for 30s (25 cycles), extending at 72℃for 30s/1kb, and final extending at 72℃for 2 min.
Further, the obtained Myc-P2A-CD9 gene fragment is detected, and the specific operation is as follows:
1) And 5 mug of the obtained Myc-P2A-CD9 gene fragment is taken for electrophoresis detection, the detection result is shown in figure 1, as shown in figure 1, the first lane in figure 1 is a PCR product, the second lane is a DNA marker, and the first lane in figure shows a band of about 2000 bp. Analysis shows that the size of the Myc-P2A-CD9 gene fragment related to the application is 2100bp, which is consistent with the size shown in the figure, and shows that the synthesized product is the Myc-P2A-CD9 gene fragment;
2) The remaining Myc-P2A-CD9 gene fragment was recovered by agarose gel electrophoresis.
S2, constructing a recombinant lentiviral plasmid:
1) Enzyme cutting
Enzymatic cleavage of Myc-P2A-CD9 Gene fragment: taking 1.0 mu g of Myc-P2A-CD9 gene fragment, adding 1.0 mu L of restriction enzyme Xba I, 1.0 mu L of restriction enzyme EcoR I and 5.0 mu L of CutSmart Buffer, adding double distilled water to a total volume of 50 mu L, and reacting at 37 ℃ for 60min to obtain a sample A;
linearized cleavage of pLV-Flag (C1) plasmid: taking 1.0 mu g of pLV-Flag (C1) plasmid, adding 1.0 mu L of restriction enzyme Xba I, 1.0 mu L of restriction enzyme EcoR I and 5.0 mu L of CutSmart Buffer solution, adding double distilled water to the total volume of 50 mu L, and reacting at 37 ℃ for 60min to obtain a sample B;
2) Recovery of the Gene fragment of interest and linearization plasmid
Agarose gel electrophoresis: the method comprises the steps of operating by using an agarose gel recovery kit, taking a sample A and a sample B, respectively mixing the sample A and the sample B with 5 times of concentrated DNA loading buffer solution until the final concentration of the DNA loading buffer solution is concentrated by one time, adding the mixed solution into an agarose gel sample application hole, and carrying out electrophoresis for 30min under 120V voltage;
cutting the target strip: agarose gel containing the target band is cut off by an ultraviolet gum cutter and transferred into a 1.5mL centrifuge tube;
target band recovery: recovering the target gene fragment and linearization plasmid according to the operation steps of the agarose gel recovery kit, and preserving at-20 ℃;
3) Connection
Selecting a Ligation high Ver.2 Ligation kit for operation, taking 10 mu L of Ligation high Ver.2, 2.5 mu L of linearization plasmid and 7.5 mu L of target gene fragment, uniformly mixing, and reacting at 16 ℃ for 30min to obtain a Ligation product containing recombinant lentiviral plasmid pLV-MYC-P2A-CD 9;
4) Transformation
a. Thawing 100 μL DH5 alpha competent cells on ice, adding 10 μL of a ligation product containing recombinant lentiviral plasmid pLV-MYC-P2A-CD9, mixing, and ice-bathing for 20min;
b. after ice bath, placing the mixture into a water bath kettle at 42 ℃ for heat shock for 90s, and then immediately placing the mixture on ice for 2min;
c. adding 200 mu L of LB liquid medium without antibiotics into the mixture, and resuscitating for 60min at 37 ℃ and 200rpm to obtain mixed bacterial liquid;
d. 100 mu L of mixed bacterial liquid is taken and coated on LB solid medium containing 100 mu g/mL of antibiotics, and the mixed bacterial liquid is cultured in an incubator at 37 ℃ for inversion for 24 hours, and after 24 hours, monoclonal colonies appear on the LB solid medium;
5) Plasmid extraction
The Omega plasmid miniprep kit is selected for operation.
a. Taking the monoclonal colony in the step 4), adding 5mL of LB liquid medium containing 100 mug/mL of antibiotics into a centrifuge tube, and culturing for 14h at a temperature of 37 ℃ on a bacterial culture shaking table at 200 rpm;
b. taking 3mL of bacterial liquid, and centrifuging at 10000 Xg for 1min at room temperature; removing the supernatant, adding 250 mu L of RNase A-containing solution I in the kit, and oscillating by using a vortex oscillator until the thalli are completely suspended;
c. adding the solution II in the 250 mu L kit, inverting the centrifuge tube for 5 times to obtain clear lysate;
d. adding solution III in the 350 mu L kit, inverting the centrifuge tube until white flocculent precipitate appears in the centrifuge tube, and centrifuging at 10000 Xg for 10min at room temperature;
e. sucking the supernatant, transferring to an absorption column with an assembled centrifuge tube with the volume of 2mL, centrifuging at 10000 Xg for 1min at room temperature until the lysate completely passes through the absorption column;
f. removing filtrate, adding 500 μl Buffer HB, centrifuging at 10000×g rotation speed for 1min, cleaning absorption column, and removing residual protein to ensure DNA purity;
g. discarding the filtrate, cleaning the absorption column with 750 μl Wash Buffer diluted with 100% ethanol, centrifuging at 10000×g for 1min, cleaning the absorption column with 50 μl Wash Buffer, and centrifuging at 10000×g for 1min;
h. the absorption column is placed into a 1.5mL centrifuge tube, 50 mu L of sterile deionized water is added, the centrifugation is carried out for 5min at 10000 Xg, and the supernatant fluid is collected, thus obtaining the recombinant lentiviral plasmid.
Further, the obtained recombinant lentiviral plasmid is sequenced, and the sequencing result is consistent with the designed MYC-P2A-CD9 sequence, which indicates that the recombinant lentiviral plasmid is successfully constructed.
S3, packaging lentiviruses:
1) Cell seeding
In the afternoon of the day, 293T cells were taken at 5×10 5 Density of individual cells/wells seeded on the medium containingIn a 6-well plate with 2mL lentiviral packaging medium, at 37℃and 5% CO 2 Incubating overnight under conditions to achieve a cell density of 70% confluency;
2) Transfection was performed the next morning
a. Diluting the recombinant lentiviral plasmid to 1 μg/mL using Opti-MEM medium;
b. preparing a pipe A: taking 250 mu L of serum-free culture medium and 7 mu L of Lipofectamine3000 transfection reagent, and uniformly mixing by vortex for 10s;
c. preparing a B pipe: taking 2 mu L of recombinant lentiviral plasmid, 1.2 mu L of psPAX2 and 0.8 mu L of pMD2G, and uniformly mixing to obtain a pretreated plasmid;
taking 250 mu L of serum-free culture medium, 4 mu g of pretreated plasmid and 6 mu L of Lipofectamine3000 transfection reagent, and uniformly vortex mixing for 10s;
d. preparation of liposome-DNA complexes: mixing the content of the tube A and the content of the tube B uniformly, and incubating for 10min at room temperature;
e. removing 1mL of culture medium from each hole of the culture plate, adding 500 mu L of liposome-DNA complex into each hole, gently stirring the culture plate, and uniformly mixing; at 37℃with 5% CO 2 Incubating for 8 hours under the condition;
f. plate medium was changed in each well: the medium containing liposome-DNA complexes was aspirated from each well, and the plate medium was then placed in 2mL of pre-warmed lentiviral packaging medium; at 37℃with 5% CO 2 Incubating overnight under the condition;
g. the first batch of virus was collected on day three: after 48h transfection, 2mL of cell supernatant was collected from each well, transferred into a 15mL conical tube and stored at 4 ℃;
h. the plate medium in each well was replaced again: the collected medium was replaced with 2mL of pre-warmed lentiviral packaging medium at 37℃with 5% CO 2 Incubating overnight under the condition;
i. the second batch of virus was collected on day four: after 72h of transfection, 2mL of cell supernatant was collected from each well and mixed with the supernatant collected in step g; centrifuging at 2000rpm for 10min at room temperature, removing cell debris, collecting and transferring supernatant into a centrifuge tube, and discarding cell sediment;
j. virus concentration: into the centrifuge tube in step i, according to the Lenti-X Concentrator: adding a Lenti-X Concentrator into the supernatant in a volume ratio of 1:3, and incubating at 4 ℃ overnight;
k. centrifuging 1500g at 4deg.C for 60min, discarding supernatant, and precipitating to obtain recombinant lentivirus; adding DMEM basal medium to resuspend virus precipitate, subpackaging at 50 ul/tube, and storing in a refrigerator at-80 ℃ for standby.
S4, constructing immortalized mesenchymal stem cells:
1) Resuscitating and culturing mesenchymal stem cells
a. Taking out frozen human umbilical cord mesenchymal stem cells from a liquid nitrogen tank, placing into a refrigerator at-80 ℃ for 2-3 min, taking out the frozen cells, and placing the frozen tube into warm water at 37 ℃ for thawing;
b. sterilizing the outer wall of the freezing tube orifice with 75% alcohol, and transferring the cell freezing suspension into a 15mL centrifuge tube filled with 9mL of complete culture medium;
c. centrifuging the cell suspension at 250g for 5min, discarding the supernatant, and adding 2mL of complete medium preheated to 37 ℃;
d. inoculating cells into T25 flask, adding complete medium, and adding 5% CO at 37deg.C 2 Culturing in a saturated humidity incubator; subsequently, fresh complete culture medium is replaced every two days until the cells reach 80% confluence for standby;
2) Infection of mesenchymal stem cells
a. The mesenchymal stem cells in the step 1) are subjected to the following steps of 1 to 10 5 Individual cells/well were seeded into 6-well plates containing mesenchymal stem cell complete medium;
b. c, when the cells in the step a reach 80% confluence, infecting the mesenchymal stem cells with the recombinant lentivirus according to the multiplicity of infection of MOI=20, and simultaneously adding the polybrene so that the final concentration of the polybrene is 10 mug/mL; setting a control hole, wherein no recombinant lentivirus and polybrene are added in the control hole;
c. after 48h infection, puromycin is added into the virus infection hole and the control hole, the final concentration of puromycin is 3 mug/mL for screening, and when the culture is continued for 7 days, the cells in the control hole can be completely dead, so that the middle cells in the virus infection hole are umbilical mesenchymal stem cell MSC-MYC/CD9 cell lines expressing MYC and CD9, namely immortalized mesenchymal stem cells.
Further, the obtained immortalized mesenchymal stem cells are identified, and the specific identification method is as follows:
1) Taking 1 x 10 each of immortalized mesenchymal cells and mesenchymal stem cells not infected by recombinant viruses 6 Separately, 100. Mu.L of RIPA lysate containing 1% PMSF is added, mixed by vortex for 30s, and placed on ice for 30min;
2) Centrifuging at 12000rpm for 30min at 4deg.C, and transferring the supernatant into a centrifuge tube;
3) Adding 6 x protein loading to working concentration (1×), heating at 100deg.C to denature protein;
4) Taking 40 mu L of each of the two cell lysates in the step 3) and two 40 mu L of each cell lysate respectively, loading 10% SDS-PAGE, and carrying out electrophoresis for 120min under 120V voltage;
5) Transferring protein in SDS-PAGE to PVDF membrane via 350mA constant current for 120min, placing PVDF membrane in sealing liquid containing 5% skimmed milk, sealing overnight at 4deg.C;
6) Cutting the sealed PVDF membrane into two parts, wherein each part contains a mesenchymal stem cell lysate infected by viruses and a mesenchymal stem cell lysate not infected by viruses, respectively placing 10ml of rabbit anti-human Myc primary antibody containing 0.5 mug/ml and 10ml of rabbit anti-human CD9 primary antibody containing 1:1000 dilution into the two parts of PVDF membranes, and incubating for 1h at room temperature;
7) Washing PVDF membrane with TBST buffer solution for 5 times, each time for 5min; then 10ml of goat anti-rabbit IgG secondary antibody marked by horseradish peroxidase diluted according to 1:100000 is put into the mixture, and the mixture is incubated at room temperature for 1h; washing with TBST buffer solution for 5 times and 5min each time;
8) And after the ECL hypersensitive color development liquid is added, a photographing analysis is carried out by using a natural energy imaging system.
The results show that the virus-infected mesenchymal stem cell lysate on the rabbit anti-human Myc primary-antibody incubated PVDF membrane shows two bands with stronger signals, which are respectively located at 75KD and 50KD; the virus-infected mesenchymal stem cell lysate incubated with rabbit anti-human CD9 primary antibody showed two bands with stronger signals at 75KD and 25KD, respectively.
In the control group, a weak signal band is detected on a PVDF membrane incubated by rabbit anti-human Myc primary antibody of mesenchymal stem cell lysate of uninfected virus and is positioned at 50KD; a band with weaker signal was detected on PVDF membrane with rabbit anti-human CD9 primary antibody, at 25KD.
Analysis shows that the molecular weight of the human c-Myc protein is 50KD, the molecular weight of the CD9 protein is 25KD, and the immortalized mesenchymal stem cells express the c-Myc protein and the CD9 protein. Thus, virus-infected mesenchymal stem cell lysates on PVDF membranes incubated with rabbit anti-human Myc primary antibody showed 75KD bands (intact proteins that have not been sheared) and 50KD bands (sheared c-Myc proteins); the virus-infected mesenchymal stem cell lysate incubated with rabbit anti-human CD9 primary antibody showed 75KD bands (intact proteins that have not been sheared) and 25KD bands (sheared CD9 proteins); in the control group, the non-virus infected mesenchymal stem cell lysate showed 50KD bands (sheared c-Myc protein) on PVDF membrane incubated with rabbit anti-human Myc primary antibody and 25KD bands (sheared CD9 protein) on PVDF membrane with rabbit anti-human CD9 primary antibody. Therefore, the application proves that the immortalized mesenchymal stem cells capable of stably expressing the c-Myc protein and the CD9 protein are successfully constructed, and the c-Myc protein and the CD9 protein can form two independent protein molecules after being sheared by P2A so as to be capable of running functions.
Further, the phenotype analysis and identification are carried out on the immortalized mesenchymal stem cells, and the specific identification method is as follows:
1) Immortalized mesenchymal stem cells were according to 1 x 10 5 Individual cells/tube were added to a 5mL BD tube;
2) Adding D-PBS buffer solution, centrifuging at 1500rpm for 5min at 4deg.C, discarding supernatant, and repeating the steps once;
3) Removing supernatant, adding CD90-PE antibody and CD45-FITC antibody, and incubating for 20min in ice in dark place;
4) Removing supernatant, adding D-PBS buffer solution, centrifuging at 1500rpm for 5min at 4deg.C, removing supernatant, and repeating the steps once;
5) Cells were resuspended in 200 μ L D-PBS buffer to BD tubes and loaded using BD FACSVerse flow cytometer.
The results showed that CD90 was positive and CD45 was negative, indicating that the obtained cells were stable immortalized mesenchymal stem cells.
Further, carrying out subculture identification on the immortalized mesenchymal stem cells, wherein the specific identification method comprises the following steps:
1) Cells were cultured using a T75 flask, washed 3 times with 6mL of 1 x PBS buffer pre-warmed to 37 ℃ and aspirated;
2) Adding 3mL of Trypsin-EDTA preheated to 37 ℃, rotating a T75 culture bottle to enable the Trypsin-EDTA to cover the cell surface, and after about 70% -80% of cells are observed to be rounded under a microscope, tapping the wall of a culture vessel to enable the cells to be desquamated;
3) Digestion was terminated by adding 6mL of complete medium pre-heated to 37 ℃;
4) Sucking liquid by a suction pipe, repeatedly blowing the bottom wall of the culture vessel to thoroughly separate cells from the bottom wall of the vessel, transferring the cell suspension into a 15mL centrifuge tube, centrifuging at a rotating speed of 250g for 5min, discarding the supernatant, and adding 2mL of complete culture medium to resuspend the cells;
5) Counting the number of living cells by trypan blue staining the cells;
6) According to 2.5 x 10 4 Individual cells/cm 2 Density inoculation of cells at 37 ℃, 5% co 2 Culturing in a saturated humidity incubator;
7) The cells were passaged 100 times according to the passaging method described above, and the cell morphology and growth rate were observed.
The results show that the morphology and the growth rate of the cells are not obviously changed when the cells are passaged for 100 times, which shows that the c-Myc protein in the stem cells can play a role, so that the stem cells can be proliferated indefinitely, thereby proving that the immortalized mesenchymal stem cells are successfully constructed.
Example 2
A method for preparing exosomes, using the immortalized mesenchymal stem cells constructed in example 1, comprising the following steps:
(1) Cell culture
1) Take 1 x 10 6 Immortalized mesenchymal stem cells constructed in example 1 were inoculated into a cell culture dish containing 20mL of mesenchymal stem cell complete medium and incubated in a power HF100 three-gas incubator with 0.5% oxygen and 99.5% nitrogen:
2) When the cells grow to 50% confluence, discarding the supernatant, replacing the supernatant with a sterile D-PBD buffer solution, incubating the mixture in a Likang HF100 three-gas incubator with 0.5% oxygen and 99.5% nitrogen for 12 hours, and collecting the supernatant;
(2) Exosome separation and purification
1) Centrifuging the supernatant collected in the step (1) at a rotation speed of 10000g for 10min at a temperature of 4 ℃ to remove cell debris, and collecting the supernatant;
2) Filtering the supernatant in the step 1) by using a membrane filter with the pore diameter of 0.22 and um, and collecting filtrate;
3) Centrifuging the filtrate at 4deg.C at 120000g for 90min, discarding supernatant, and resuspending exosome precipitate with physiological saline; and repeating the steps once, discarding the supernatant, and obtaining the precipitate as the exosome.
Further, the obtained exosomes are detected by a Western Blot method, and the specific operation is as follows:
1) Preparing exosomes by using non-immortalized mesenchymal stem cells by adopting the method for preparing exosomes described in example 2, then taking 20 mu L of each of the exosomes separated and purified in example 2 and the exosomes secreted by the non-immortalized mesenchymal stem cells, respectively adding 100 mu L of RIPA lysate containing 1% PMSF, and incubating at 4 ℃ for 15min to enable the exosomes to be fully lysed;
2) Adding 6 Xprotein loading to working concentration (1X), heating at 100deg.C for 5min to denature protein;
3) Respectively taking more than 20 mu L of two samples, loading 10% SDS-PAGE, and carrying out electrophoresis for 120 minutes under 100V voltage;
4) Transferring the protein to PVDF membrane under 100V voltage for 120min; placing the PVDF film after film transfer in a sealing liquid containing 5% of skimmed milk powder, and sealing at 4 ℃ overnight;
5) Placing 10mL of the PVDF membrane after sealing into a rabbit anti-human HSP70 primary antibody containing 0.5ug/mL, and incubating for 1h at room temperature; then washing with TBST buffer solution for 5 times, each time for 5min;
6) Putting 10ml of goat anti-rabbit IgG (H & L) secondary antibody marked by horseradish peroxidase diluted according to 1:100000 into the washed PVDF membrane, and incubating for 1H at room temperature; then washing with TBST buffer solution for 5 times, each time for 5min;
7) And after the ECL hypersensitive color development liquid is added, a photographing analysis is carried out by using a natural energy imaging system.
The results showed that 50KD bands could be detected in both exosome lysates, whereas the signal detected by the exosome lysates secreted by immortalized mesenchymal stem cells was stronger. Analysis suggests that the molecular weight of the human HSP70 protein is 50KD and therefore 50KD bands can be detected for both exosome lysates. Compared with non-immortalized mesenchymal stem cells, immortalized mesenchymal stem cells can secrete more exosomes, so that the signals detected by exosome lysates secreted by the immortalized mesenchymal stem cells are stronger, and the fact that the immortalized mesenchymal stem cells constructed in the application can secrete a large amount of exosomes is also proved.
The present embodiment is only for explanation of the present application and is not to be construed as limiting the present application, and modifications to the present embodiment, which may not creatively contribute to the present application as required by those skilled in the art after reading the present specification, are all protected by patent laws within the scope of claims of the present application.
Claims (8)
1. A construction method of immortalized mesenchymal stem cells is characterized by comprising the following steps: the method comprises the following steps:
s1, gene synthesis: connecting the c-Myc sequence and the CD9 sequence by using the P2A sequence to synthesize Myc-P2A-CD9 gene fragments;
s2, constructing a recombinant lentiviral plasmid: ligating the Myc-P2A-CD9 gene fragment to the pLV-Flag (C1) plasmid;
s3, packaging lentiviruses: transfecting 293T cells by using the recombinant lentiviral plasmid in S2, and collecting lentiviruses;
s4, constructing immortalized mesenchymal stem cells: transfecting the mesenchymal stem cells by using the slow virus in the S3 to obtain the immortalized mesenchymal stem cells;
the Myc-P2A-CD9 gene fragment sequence is as follows:
TCTAGAGCCACCATGGATTTTTTTCGGGTAGTGGAAAACCAGCAGCCTCCCGCGACGATGCCCCTCAACGTTAGCTTCACCAACAGGAACTATGACCTCGACTACGACTCGGTGCAGCCGTATTTCTACTGCGACGAGGAGGAGAACTTCTACCAGCAGCAGCAGCAGAGCGAGCTGCAGCCCCCGGCGCCCAGCGAGGATATCTGGAAGAAATTCGAGCTGCTGCCCACCCCGCCCCTGTCCCCTAGCCGCCGCTCCGGGCTCTGCTCGCCCTCCTACGTTGCGGTCACACCCTTCTCCCTTCGGGGAGACAACGACGGCGGTGGCGGGAGCTTCTCCACGGCCGACCAGCTGGAGATGGTGACCGAGCTGCTGGGAGGAGACATGGTGAACCAGAGTTTCATCTGCGACCCGGACGACGAGACCTTCATCAAAAACATCATCATCCAGGACTGTATGTGGAGCGGCTTCTCGGCCGCCGCCAAGCTCGTCTCAGAGAAGCTGGCCTCCTACCAGGCTGCGCGCAAAGACAGCGGCAGCCCGAACCCCGCCCGCGGCCACAGCGTCTGCTCCACCTCCAGCTTGTACCTGCAGGATCTGAGCGCCGCCGCCTCAGAGTGCATCGACCCCTCGGTGGTCTTCCCCTACCCTCTCAACGACAGCAGCTCGCCCAAGTCCTGCGCCTCGCAAGACTCCAGCGCCTTCTCTCCGTCCTCGGATTCTCTGCTCTCCTCGACGGAGTCCTCCCCGCAGGGCAGCCCCGAGCCCCTGGTGCTCCATGAGGAGACACCGCCCACCACCAGCAGCGACTCTGAGGAGGAACAAGAAGATGAGGAAGAAATCGATGTTGTTTCTGTGGAAAAGAGGCAGGCTCCTGGCAAAAGGTCAGAGTCTGGATCACCTTCTGCTGGAGGCCACAGCAAACCTCCTCACAGCCCACTGGTCCTCAAGAGGTGCCACGTCTCCACACATCAGCACAACTACGCAGCGCCTCCCTCCACTCGGAAGGACTATCCTGCTGCCAAGAGGGTCAAGTTGGACAGTGTCAGAGTCCTGAGACAGATCAGCAACAACCGAAAATGCACCAGCCCCAGGTCCTCGGACACCGAGGAGAATGTCAAGAGGCGAACACACAACGTCTTGGAGCGCCAGAGGAGGAACGAGCTAAAACGGAGCTTTTTTGCCCTGCGTGACCAGATCCCGGAGTTGGAAAACAATGAAAAGGCCCCCAAGGTAGTTATCCTTAAAAAAGCCACAGCATACATCCTGTCCGTCCAAGCAGAGGAGCAAAAGCTCATTTCTGAAGAGGACTTGTTGCGGAAACGACGAGAACAGTTGAAACACAAACTTGAACAGCTACGGAACTCTTGTGCG GGA AGC GGA GCT ACT AAC TTC AGC CTG AAG CAG GCT GGA GAC GTG GAG AAC CCT GGA CCTATGAGCGTCCTGTCCA GCTGGGAGCTGTGCGTCAAATACGCAATTTTCATCTTCAACTTTGTCTTCTGGCTTGCAGGGACTGGAGTGCTGGCTGTGGGATTATGGCTTCGTTTCGACTCCAGGACCAAAGCACTGTTTGAAGGAGAAGACGCGCCCTCTGTCTTCTTCACTGGTGTTTATCTGCTGATCGCTGCAGGAGCGTTGATGATGGTGGTGGGATTCCTGGGATGCTGTGGAGCCATTAAAGAGTCGCCCTGCATGCTGGGACTGTTCTTCATCTTCCTGCTCATCATCTTTGCTGCTGAAGTGGCTGCAGGGATCTGGGGACTGTCCAACACGCACACGGTCATAGAGGAAGTCACAGAGTTTTATAAGCAGACTTTTGACAACTACAGGACCACCAAACAGGAAGCGCTGAAGGAGACCCTCCGCCTGATCCACTTTGGGCTGGACTGCTGCGGTCCTACAGGAAGCGTCTTCGATGCTGCCAAAGACATCTGTCCAAAGCAGGAAGGACTGGCCGTCCTCGTTACCACGAGTTGCCCAAAAGCCATCGATGAAGTATTCAACAACAAGCTGCACATCATCGGTGGAGTTGGGATCGGTATTGGCGTCATCATGATCTTTGGGATGATCTTCAGCATGATCCTTTGCTGTGCCATCAAGAGGTCCAGAG AATATGTGTAAGAATTC；
in the step S3, the specific operation mode of the lentiviral package is as follows:
1) Cell inoculation: inoculating 293T cells into a culture plate containing a lentivirus packaging culture medium, and culturing for 23-25 hours;
2) Diluting the recombinant lentiviral plasmid to 1. Mu.g/. Mu.L;
preparing a pipe A: mixing 248-252 μl of serum-free culture medium and 6.5-7.5 μl of transfection reagent;
preparing a B pipe: mixing 248-252 μl of serum-free culture medium, 3.8-4.2 μg of pretreated plasmid and 5.5-6.5 μl of transfection reagent;
3) Preparation of liposome-DNA complexes: mixing the tube A and the tube B uniformly, and incubating for 9-11min at room temperature;
4) Transfection: removing 1mL of culture medium from each well of the culture plate, adding 495-505 mu L of liposome-DNA complex into each well, and incubating at 37 ℃ for 7.7-8.2h; changing the culture medium in the culture plate, and continuously culturing for 12-14h;
5) And (3) collecting: collecting supernatant in each hole of the culture plate, and centrifuging and concentrating to obtain recombinant lentivirus;
the pretreated plasmid is prepared by mixing the following raw materials: 1.8-2.2. Mu.L of recombinant lentiviral plasmid, 1.1-1.3. Mu.L of psPAX2 and 0.7-0.9. Mu.L of pMD2G.
2. The method for constructing immortalized mesenchymal stem cells according to claim 1, wherein the method comprises the steps of: the step S2 adopts the following method for connection:
1) And (3) enzyme cutting: performing enzyme digestion on Myc-P2A-CD9 gene fragments to obtain target gene fragments, and performing linearization enzyme digestion on pLV-Flag (C1) plasmids to obtain linearization plasmids;
2) Recovering the target gene fragment and linearization plasmid;
3) And (3) connection: uniformly mixing 9.5-10.5 mu L of connecting reagent, 2.3-2.7 mu L of linearization plasmid and 7.3-7.7 mu L of target gene fragment, and reacting at 16 ℃ for 28-32min to obtain a connecting product containing recombinant lentiviral plasmid pLV-MYC-P2A-CD 9;
4) Conversion: transforming DH5 alpha competent cells by using the connection product in the step 3), and extracting plasmids to obtain recombinant lentiviral plasmids pLV-MYC-P2A-CD9.
3. The method for constructing immortalized mesenchymal stem cells according to claim 2, wherein: the enzyme digestion is specifically carried out by the following method:
enzymatic cleavage of Myc-P2A-CD9 Gene fragment: taking 0.8-1.2 mu g Myc-P2A-CD9 gene fragment, adding 0.8-1.2 mu L restriction enzyme Xba I, 0.8-1.2 mu L restriction enzyme EcoR I and 4.8-5.2 mu L buffer solution, adding double distilled water until the total volume is 50 mu L, and placing the mixture at 37 ℃ for reaction for 55-65min to obtain a sample A;
linearized cleavage of pLV-Flag (C1) plasmid: taking 0.8-1.2 mu g of pLV-Flag (C1) plasmid, adding 0.8-1.2 mu L of restriction enzyme Xba I, 0.8-1.2 mu L of restriction enzyme EcoR I and 4.8-5.2 mu L of buffer solution, adding double distilled water to a total volume of 50 mu L, and placing the mixture at 37 ℃ for reaction for 55-65min to obtain a sample B.
4. A method of constructing immortalized mesenchymal stem cells according to claim 3, wherein: the target gene fragment and the linearization plasmid are recovered by adopting the following method:
1) Preparing agarose gel;
2) Agarose gel electrophoresis: mixing the sample A and the sample B with 5 times of concentrated DNA loading buffer solution respectively, concentrating until the final concentration of the DNA loading buffer solution is one time, adding the mixed solution into agarose gel sample application holes, and carrying out electrophoresis for 28-32min under 120V voltage;
3) Cutting the target strip: agarose gel containing the target band was excised and transferred to a centrifuge tube, followed by recovery of the target gene fragment and linearization plasmid.
5. The method for constructing immortalized mesenchymal stem cells according to claim 2, wherein: the ligation product containing the recombinant lentiviral plasmid pLV-MYC-P2A-CD9 was transformed into DH 5. Alpha. Competent cells by the following method:
1) Mixing 9.5-10.5 μl of ligation product containing recombinant lentiviral plasmid pLV-MYC-P2A-CD9 and 98-102 μl DH5 α competent cells to obtain a mixture, and ice-bathing the mixture for 19-21min;
2) After ice bath, placing the mixture into hot water at 42 ℃ for 85-95s, and then ice-bathing for 115-125s;
3) Adding the mixture into 180-202 mu L of LB liquid medium without antibiotics, resuscitating for 55-65min at 37 ℃ and 200rpm to obtain mixed bacterial liquid;
4) Sucking 98-102 mu L of the mixed bacterial liquid, coating the mixed bacterial liquid into LB solid medium containing 100 mu g/mL of antibiotics, and culturing the mixed bacterial liquid in an incubator for 23-25 hours.
6. The method for constructing immortalized mesenchymal stem cells according to claim 1, wherein the method comprises the steps of: the transfection is performed in step 4) when the cell confluency in the culture plate reaches 60-70%.
7. A method of preparing an exosome, characterized by: preparation using the immortalized mesenchymal stem cell of any one of claims 1-6, comprising the steps of:
(1) Inoculating immortalized mesenchymal stem cells, and culturing;
(2) And (3) separating and purifying:
a) Collecting supernatant, centrifuging, removing cell debris, collecting supernatant, and filtering;
b) Centrifuging the supernatant obtained after the filtration in the step a), discarding the supernatant, and resuspending exosome sediment to obtain exosome heavy suspension;
c) Centrifuging the exosome heavy suspension in the step b), and removing the supernatant to obtain the exosome.
8. A method of preparing an exosome according to claim 7, wherein: step a) was centrifuged at 10000g for 10min, and step b) and step c) were both centrifuged at 120000g for 90min.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110062621.2A CN114807235B (en) | 2021-01-18 | 2021-01-18 | Construction method of immortalized mesenchymal stem cells and method for preparing exosomes |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110062621.2A CN114807235B (en) | 2021-01-18 | 2021-01-18 | Construction method of immortalized mesenchymal stem cells and method for preparing exosomes |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN114807235A CN114807235A (en) | 2022-07-29 |
| CN114807235B true CN114807235B (en) | 2023-08-18 |
Family
ID=82524695
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202110062621.2A Active CN114807235B (en) | 2021-01-18 | 2021-01-18 | Construction method of immortalized mesenchymal stem cells and method for preparing exosomes |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN114807235B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN117327660A (en) * | 2023-10-17 | 2024-01-02 | 安可来(重庆)生物医药科技有限公司 | Immortalized mesenchymal stem cell line for simultaneously expressing IL1-RN and COL17A protein and preparation method and application thereof |
Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107937442A (en) * | 2017-11-13 | 2018-04-20 | 北京多赢时代科技有限公司 | A kind of immortal human fat mesenchymal stem cell system and its method for building up |
| CN108642004A (en) * | 2018-05-17 | 2018-10-12 | 广东芙金干细胞再生医学有限公司 | A kind of preparation method of excretion body and the stem cell proliferating agent containing excretion body |
| CN109097326A (en) * | 2018-08-10 | 2018-12-28 | 广东唯泰生物科技有限公司 | A kind of method and its application preparing mescenchymal stem cell excretion body |
| CN109097328A (en) * | 2018-08-24 | 2018-12-28 | 深圳市浊安认证生物技术有限公司 | One species specific mescenchymal stem cell excretion body extracting method |
| CA3110905A1 (en) * | 2018-08-31 | 2020-03-05 | Invectys SA | Chimeric antigen receptors against multiple hla-g isoforms |
| CN110946876A (en) * | 2019-10-28 | 2020-04-03 | 天津市康婷生物工程集团有限公司 | Application of mesenchymal stem cell exosome preparation in treating alopecia areata |
| CN112048471A (en) * | 2020-09-21 | 2020-12-08 | 淄博市中心医院 | Preparation method of bone marrow mesenchymal stem cell exosome |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JPWO2003038076A1 (en) * | 2001-10-31 | 2005-02-24 | 株式会社レノメディクス研究所 | Immortalized mesenchymal cells and their use |
-
2021
- 2021-01-18 CN CN202110062621.2A patent/CN114807235B/en active Active
Patent Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107937442A (en) * | 2017-11-13 | 2018-04-20 | 北京多赢时代科技有限公司 | A kind of immortal human fat mesenchymal stem cell system and its method for building up |
| CN108642004A (en) * | 2018-05-17 | 2018-10-12 | 广东芙金干细胞再生医学有限公司 | A kind of preparation method of excretion body and the stem cell proliferating agent containing excretion body |
| CN109097326A (en) * | 2018-08-10 | 2018-12-28 | 广东唯泰生物科技有限公司 | A kind of method and its application preparing mescenchymal stem cell excretion body |
| CN109097328A (en) * | 2018-08-24 | 2018-12-28 | 深圳市浊安认证生物技术有限公司 | One species specific mescenchymal stem cell excretion body extracting method |
| CA3110905A1 (en) * | 2018-08-31 | 2020-03-05 | Invectys SA | Chimeric antigen receptors against multiple hla-g isoforms |
| CN110946876A (en) * | 2019-10-28 | 2020-04-03 | 天津市康婷生物工程集团有限公司 | Application of mesenchymal stem cell exosome preparation in treating alopecia areata |
| CN112048471A (en) * | 2020-09-21 | 2020-12-08 | 淄博市中心医院 | Preparation method of bone marrow mesenchymal stem cell exosome |
Also Published As
| Publication number | Publication date |
|---|---|
| CN114807235A (en) | 2022-07-29 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108251423A (en) | The sgRNA and Activiation method of CRISPR-Cas9 systemic characteristics targeting people's RSPO2 genes and application | |
| CN108315330A (en) | The sgRNA and knockout technique of CRISPR-Cas9 systemic characteristics targeting people's RSPO2 genes and application | |
| CN111172114B (en) | Humanized pre-intestinal cancer lesion immortalized epithelial cell line, construction method and application thereof | |
| CN107164409B (en) | Canine distemper virus sensitive cell line SLAM-MDCK and construction method and application thereof | |
| CN114807235B (en) | Construction method of immortalized mesenchymal stem cells and method for preparing exosomes | |
| CN111073856A (en) | Trophoblast, preparation method thereof and application thereof in NK cell amplification | |
| CN112029803A (en) | Lentiviral overexpression viral vector and preparation method and application thereof | |
| CN106497952A (en) | A kind of based on the film ankyrin of CD86, its preparation method and application | |
| CN111718958A (en) | Rabbit hemorrhagic disease virus type 1 and type 2VP60 bivalent recombinant baculovirus vector inactivated vaccine and preparation method and application thereof | |
| CN112143713A (en) | Recombinant adenovirus expressing porcine coronavirus S1 gene and preparation method thereof | |
| CN105624162B (en) | For the siRNA of mammal R-Spondin2 gene targets, ShorthairpinRNA and carrier and application | |
| CN106432497B (en) | Utilize the method for safflower suspension cell production CD20 antibody | |
| CN109486771B (en) | CHO cell strain construction method for high expression SOD3 and SOD3 protein purification method | |
| CN111378621B (en) | B lymphoma cell strain stably transfected by EB virus latent membrane protein 1, construction method and application thereof | |
| CN114657144A (en) | Preparation and application of traceable umbilical cord mesenchymal stem cells capable of secreting human IL-10 and TGF-beta simultaneously | |
| CN112961841A (en) | Packaging method for rapidly obtaining high-titer lentiviruses | |
| CN107043785A (en) | A kind of integrated slow virus carrier expression system | |
| CN110257414A (en) | A kind of preparation method and its usage of mouse MIP3 α-endoglin Fc fusion protein | |
| CN113817733B (en) | LncRNA transcribed from 34kb region upstream of MYB gene, expression vector and application thereof | |
| CN117384856B (en) | Immortalized COPD human bronchial epithelial cell strain, construction method and application thereof | |
| CN109266683A (en) | A kind of slow virus recombinant vector and its preparation method and application comprising E4BP4 gene | |
| CN114480292B (en) | Method for constructing CAR-T cells by utilizing shRNA to silence human Tim-3 gene and application thereof | |
| CN116042526B (en) | Normal human immortalized colon fibroblasts with P16 gene specific methylation | |
| CN111228292B (en) | Application of human TPT1/TCTP gene in preparation of antitumor drugs | |
| CN111394295B (en) | Preparation of immobilized arginine deiminase and production thereof 14/15 N]Method for producing L-citrulline |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |