CN114807235A

CN114807235A - Construction method of immortalized mesenchymal stem cells and method for preparing exosome

Info

Publication number: CN114807235A
Application number: CN202110062621.2A
Authority: CN
Inventors: 夏玉龙; 吴炯
Original assignee: Suzhou Hengkang Life Science Co ltd
Current assignee: Suzhou Hengkang Life Science Co ltd
Priority date: 2021-01-18
Filing date: 2021-01-18
Publication date: 2022-07-29
Anticipated expiration: 2041-01-18
Also published as: CN114807235B

Abstract

The application relates to the field of mesenchymal stem cell culture, and particularly discloses a construction method of immortalized mesenchymal stem cells and a method for preparing exosomes. The construction method of the immortalized mesenchymal stem cells comprises the following steps: synthesizing genes; constructing a recombinant lentivirus plasmid; packaging the lentivirus; transfecting the mesenchymal stem cells by using lentiviruses to obtain the immortalized mesenchymal stem cells. The method for preparing exosomes comprises: culturing immortalized mesenchymal stem cells; separation and purification: collecting supernatant, centrifuging, removing cell debris, collecting supernatant, and filtering; centrifuging again, discarding the supernatant, and resuspending the exosome precipitate to obtain an exosome suspension; centrifuging the exosome suspension, and removing supernatant to obtain exosomes. The construction method of the immortalized mesenchymal stem cell can construct the immortalized mesenchymal stem cell which secretes a large amount of exosomes, can obtain a large amount of exosomes without culturing cells on a large scale, and can reduce the cell culture cost to a certain extent.

Description

Construction method of immortalized mesenchymal stem cells and method for preparing exosome

Technical Field

The application relates to the field of mesenchymal stem cell culture, in particular to a construction method of immortalized mesenchymal stem cells and a method for preparing exosomes.

Background

The exosome is a micro-membrane vesicle which can be secreted by most cells in an organism, has a lipid bilayer membrane, is widely existed and distributed in various body fluids, carries and transmits important signal molecules, and forms a brand-new cell-cell transmission system; not only influences the physiological state of cells and is closely related to the occurrence and the process of various diseases, but also can be used as a carrier of cancer vaccines and anti-cancer drugs and a potential substitute of cell therapy.

In regenerative therapy application, the exosome can avoid some defects of stem cell therapy, such as ethical problems and the like, and the exosome is simple to separate, high in stability, convenient to store, accurate in quantification and analysis, and can be used as an effective substitute for the stem cell therapy. Compared with the mesenchymal stem cells, the exosome has low immunogenicity, no tumorigenic risk, higher safety and larger tissue regeneration potential, so the mesenchymal stem cell exosome has great advantages in tissue regeneration.

However, the mesenchymal stem cells have insufficient in-vitro expansion capacity, and after several passages, the cells begin to age, and the regeneration capacity of exosomes secreted by aged mesenchymal stem cells is obviously impaired, so that the treatment effect is greatly reduced. Therefore, in order to obtain sufficient amount of exosome with regeneration potential for treatment, related enterprises choose to expand the culture scale of mesenchymal cells and repeatedly prepare mesenchymal cells.

In view of the above-mentioned related art, the inventors thought that the manner of scaling up the culture scale could produce a large amount of mesenchymal stem cell exosomes, but the manner of scaling up the culture scale would undoubtedly increase the cost of the cell culture and also increase a large amount of labor.

Disclosure of Invention

In order to solve the problem that a large amount of exosomes can be prepared only by culturing mesenchymal stem cells on a large scale, the application provides a construction method of immortalized mesenchymal stem cells and a method for preparing exosomes.

In a first aspect, the present application provides a method for constructing an immortalized mesenchymal stem cell, which adopts the following technical scheme:

a construction method of immortalized mesenchymal stem cells comprises the following steps:

s1, gene synthesis: connecting the c-Myc sequence and the CD9 sequence by using a P2A sequence to synthesize a Myc-P2A-CD9 gene segment;

s2, constructing a recombinant lentivirus plasmid: the Myc-P2A-CD9 gene fragment is connected to pLV-Flag (C1) plasmid;

s3, slow virus packaging: transfecting 293T cells by using the recombinant lentivirus plasmid in S2, and collecting lentivirus;

s4, constructing the immortalized mesenchymal stem cells: and (3) transfecting the mesenchymal stem cells by using the lentivirus in the S3 to obtain the immortalized mesenchymal stem cells.

By adopting the technical scheme, the c-Myc is the earliest discovered protooncogene and has a plurality of functional regions related to tumor formation, the protein transcribed and expressed enters the cell nucleus through the nuclear membrane to be specifically combined with the promoter binding site of telomerase, the rapid expression of telomerase mRNA is induced, the activity of the telomerase is directly activated, and the immortalization of the cell is promoted; CD9 has various biological functions, plays an important role in cell adhesion, cell motility, activation, differentiation, tumor metastasis and the like, and can promote the secretion of exosomes by cells;

P2A acts as a self-cleaving peptide that enables one transcript to produce multiple proteins. The traditional technical scheme for simultaneously expressing a plurality of genes is to utilize a plurality of promoters and open reading frames, wherein the plurality of promoters can cause the vector to be remarkably increased, and the subsequent transfection efficiency is possibly low; multiple promoters also tend to place a metabolic burden on the host cell. The size of P2A is only 60bp, when c-Myc gene and CD9 gene are connected, the length of the vector is not obviously increased, the host cell metabolism burden caused by multiple promoters can be reduced, and the subsequent cell transfection efficiency can be enhanced.

According to the technical scheme, P2A is connected with a c-Myc gene and a CD9 gene to construct a recombinant lentivirus plasmid, the recombinant lentivirus plasmid is used for packaging a recombinant lentivirus, the recombinant lentivirus is used for infecting mesenchymal stem cells, and therefore after protein translation, the two proteins, namely the c-Myc and the CD9, obtained by shearing P2A can respectively have the function of driving. Under the action of c-Myc, the mesenchymal stem cells enter immortalization, under the action of CD9, the mesenchymal stem cells can secrete a large amount of exosomes, and then immortalized mesenchymal stem cells which can be subjected to unlimited passage and secrete a large amount of exosomes can be obtained, a large amount of exosomes can be obtained without large-scale cell culture, and the cell culture cost can be reduced to a certain extent.

Preferably, the connection in step S2 is performed by the following method:

1) enzyme digestion: carrying out enzyme digestion on the Myc-P2A-CD9 gene fragment to obtain a target gene fragment, and carrying out linear enzyme digestion on pLV-Flag (C1) plasmid to obtain a linear plasmid;

2) recovering the target gene fragment and the linearized plasmid;

3) connecting: mixing 9.5-10.5 μ L of ligation reagent, 2.3-2.7 μ L of linearized plasmid and 7.3-7.7 μ L of target gene fragment, reacting at 16 deg.C for 28-32min to obtain ligation product containing recombinant lentivirus plasmid pLV-MYC-P2A-CD 9;

4) and (3) transformation: transforming DH5 alpha competent cells by using the ligation product in 3), and carrying out plasmid extraction to obtain a recombinant lentivirus plasmid pLV-MYC-P2A-CD 9.

By adopting the technical scheme, the linearized plasmid and the target gene fragment can be better connected by using the specific dosage of the connecting reagent, the linearized plasmid and the target gene fragment, and the recombinant lentivirus plasmid can be accurately constructed through transformation and plasmid extraction.

Preferably, the enzyme digestion is specifically performed by the following method:

enzyme digestion of Myc-P2A-CD9 gene fragment: taking 0.8-1.2 mu g of Myc-P2A-CD9 gene fragment, adding 0.8-1.2 mu L of restriction enzyme Xba I, 0.8-1.2 mu L of restriction enzyme EcoR I and 4.8-5.2 mu L of buffer solution, adding double distilled water until the total volume is 50 mu L, placing at 37 ℃ and reacting for 55-65min to obtain a sample A;

the pLV-Flag (C1) plasmid was linearized: taking 0.8-1.2 mu g of pLV-Flag (C1) plasmid, adding 0.8-1.2 mu L of restriction enzyme Xba I, 0.8-1.2 mu L of restriction enzyme EcoR I and 4.8-5.2 mu L of buffer solution, adding double distilled water until the total volume is 50 mu L, placing at 37 ℃ for reaction for 55-65min, and obtaining a sample B.

By adopting the technical scheme, the Myc-P2A-CD9 gene fragment and the pLV-Flag (C1) plasmid are respectively digested by using a restriction enzyme Xba I and a restriction enzyme EcoR I, so that the required target gene fragment and the required linearized plasmid are obtained.

Preferably, the target gene fragment and linearized plasmid are recovered by the following method:

1) preparing agarose gel;

2) agarose gel electrophoresis: mixing the sample A and the sample B with a DNA loading buffer solution which is 5 times concentrated respectively until the final concentration of the DNA loading buffer solution is one time concentrated, adding the mixed solution into an agarose gel spotting hole, and performing electrophoresis for 28-32min under the voltage of 120V;

3) cutting the target strip into glue: the agarose gel containing the target band is cut off and transferred to a centrifuge tube, and then the target gene fragment and the linearized plasmid are recovered.

By adopting the technical scheme and adopting the agarose gel electrophoresis mode to recover the target gene fragment and the linearized plasmid, impurities such as protein, other organic compounds, inorganic salt ions and the like can be removed, and the high purity of the obtained target gene fragment and the linearized plasmid can be ensured to a certain extent.

Preferably, the ligation product containing the recombinant lentiviral plasmid pLV-MYC-P2A-CD9 is used for transforming DH5 alpha competent cells by the following method:

1) mixing 9.5-10.5 μ L ligation product containing recombinant lentivirus plasmid pLV-MYC-P2A-CD9 and 98-102 μ L DH5 α competent cell to obtain mixture, and ice-cooling the mixture for 19-21 min;

2) after ice bath, the mixture is placed in hot water at 42 ℃ for 85-95s, and then ice bath is carried out for 115-125 s;

3) adding the mixture into 180-202 mu L of LB liquid culture medium without antibiotics, and resuscitating at 37 ℃ and 200rpm for 55-65min to obtain mixed bacterial liquid;

4) sucking 98-102 μ L of mixed bacteria liquid, spreading the mixed bacteria liquid in LB solid culture medium containing 100 μ g/mL antibiotic, and culturing in an incubator for 23-25 h.

By adopting the technical scheme, the DH5 alpha competent cell is selected to carry out DNA transformation, the transformation efficiency is high, and the construction of the recombinant lentivirus plasmid is facilitated.

Preferably, in step S3, the specific operation of lentivirus packaging is as follows:

1) cell inoculation: inoculating 293T cells into a culture plate containing a lentivirus packaging culture medium, and culturing for 23-25 h;

2) diluting the recombinant lentiviral plasmid to 1 μ g/μ L;

preparing a tube A: taking 248-252 mu L serum-free culture medium and 6.5-7.5 mu L transfection reagent, and mixing uniformly;

preparing a tube B: taking 248-252 mu L serum-free culture medium, 3.8-4.2 mu g pretreated plasmid and 5.5-6.5 mu L transfection reagent, and mixing uniformly;

3) preparation of liposome-DNA complexes: mixing tube A and tube B, and incubating at room temperature for 9-11 min;

4) transfection: removing 1mL of culture medium from each well of the culture plate, adding 495-505 μ L of liposome-DNA complex into each well, and incubating at 37 ℃ for 7.7-8.2 h; replacing the culture medium in the culture plate, and continuously culturing for 12-14 h;

5) collecting: and collecting supernatant in each hole of the culture plate, and carrying out centrifugal concentration to obtain the recombinant lentivirus.

By adopting the technical scheme, the 293T cell is selected for transfection test, so that the transfection efficiency is high, and the recombinant lentivirus can be packaged conveniently.

Preferably, the pretreated plasmid is prepared by mixing the following raw materials: 1.8-2.2. mu.L of recombinant lentiviral plasmid, 1.1-1.3. mu.L of psPAX2, and 0.7-0.9. mu.L of pMD 2G.

By adopting the technical scheme, the recombinant lentivirus plasmid can transcribe the lentivirus genetic material but cannot translate the lentivirus envelope and the carrier plasmid of the protein component; the psPAX2 is a plasmid capable of expressing lentivirus capsids, and an expression product can easily pass through a cell membrane through an adhesion mechanism, the psPAX2 is a membrane protein plasmid of lentivirus, the psPAX2, the psPAX2 and the recombinant lentivirus plasmid are co-transferred into 293T cells, and when the genome of the 293T cells is expressed, a target gene transcribed along with the protein translated from the psPAX2 and the psPAX2 can be assembled into the lentivirus.

Preferably, the transfection is performed when the confluency of the cells in the culture plate reaches 60 to 70% in said step 4).

By adopting the technical scheme, the transfection reagent generally has certain toxicity to cells, transfection is carried out when the confluence degree is low, the tolerance of the cells to the transfection reagent is low, and the subsequent culture and amplification of the cells can be influenced; transfection is performed when the confluency is too high, and although the tolerance of cells to the transfection reagent is high, the confluency is too high, which affects subsequent cell screening and reduces the transfection efficiency. By performing transfection when the degree of confluence of cells reaches a value within a specific range, the tolerance of the cells to the transfection reagent can be improved to some extent, and the possibility of the damage of cell activity due to the overgrowth of the cells can be reduced.

In a second aspect, the present application provides a method for preparing exosomes, using the following technical scheme:

a method of preparing exosomes comprising the steps of:

(1) inoculating immortalized mesenchymal stem cells and culturing;

(2) separation and purification:

a) collecting supernatant, centrifuging, removing cell debris, collecting supernatant, and filtering;

b) centrifuging the filtered supernatant in the step a), discarding the supernatant, and resuspending the exosome precipitate to obtain an exosome heavy suspension;

c) centrifuging the exosome suspension in the step b), and removing supernatant to obtain exosomes.

By adopting the technical scheme, the immortalized mesenchymal stem cells are cultured to secrete exosomes, and the exosomes can be obtained by collecting supernatant and centrifuging.

Preferably, step a) is centrifuged at 10000g for 10min, and step b) and step c) are both centrifuged at 120000g for 90 min.

Through adopting above-mentioned technical scheme, be favorable to the exosome to deposit for the exosome can produce the separation with other impurity, thereby can obtain the higher exosome of purity.

In summary, the present application has the following beneficial effects:

1. according to the application, the mesenchymal stem cells are transfected by the recombinant lentiviruses carrying the c-Myc gene and the CD9 gene, so that the mesenchymal stem cells enter immortalization and can secrete a large amount of exosomes, the cost of culturing the mesenchymal stem cells on a large scale is reduced, and the problems of difficult material drawing and easy aging of the mesenchymal stem cells are solved.

2. According to the application, the C-Myc gene and the CD9 gene are connected by utilizing P2A, so that the c-Myc and CD9 proteins are translated and regret to form two independent proteins through self-cutting of P2A, and the respective functions of c-Myc and CD9 driving are not influenced, so that the mesenchymal stem cells can enter immortalization and can secrete a large amount of exosomes.

3. The size of P2A selected in the application is only 60bp, so that the metabolic burden of host cells caused by multiple promoters can be reduced, the cell transfection efficiency can be enhanced, and the establishment of immortalized mesenchymal stem cells is facilitated.

Drawings

FIG. 1 is an electrophoretic detection chart of the Myc-P2A-CD9 gene fragment obtained in example 1 of the present application.

Detailed Description

The present application will be described in further detail with reference to examples.

The sources of the raw materials in the present application are shown in table 1:

TABLE 1 sources of the respective raw materials

Preparation example of 1 XTAE buffer solution

Taking 4.84g Tris buffer solution and 0.744g Na ₂ EDTA.2H ₂ O, 1.142mL acetic acid, added to ddH ₂ In O, ddH is continuously added ₂ And O is added until the total volume is 1L, and the mixture is stirred and dissolved to obtain the 1 XTAE buffer solution.

Preparation example of agarose gel

Adding 0.5g agarose into 50mL 1 XTAE buffer solution, mixing, boiling with microwave oven for 2min, adding into gel tank, and condensing.

Preparation example of liquid Medium

Taking 10g of tryptone, 5g of yeast extract and 10g of NaCl, adding ddH ₂ Dissolving in O, and continuously adding ddH ₂ Adjusting pH to 7.0 to total volume of 1L, and autoclaving at 121 deg.C for 15 min.

Preparation example of solid Medium

Taking 10g of tryptone, 5g of yeast extract and 10g of NaCl, adding ddH ₂ Dissolving in O, adjusting pH to 7.0, adding 10g agar powder, and adding ddH ₂ O till the total volume is 1L, and then autoclaving at 121 deg.C for 15 min.

Preparation example of antibiotic

1g of the corresponding antibiotic powder ampicillin was dissolved in 20mL of ddH ₂ And O, filtering and sterilizing by using a membrane bacteria filter with the pore diameter of 0.22 mu m.

Preparation example of buffer solution

Preparing 20mM Tris-HCl, 500mM NaCl and 0.05% Tween20 into a total volume of 1L, and fully and uniformly mixing to obtain the TBST buffer solution, wherein the pH value of the TBST buffer solution is 7.5.

Examples

Example 1

s1, gene synthesis:

1) sequence design: the coding sequences of c-Myc and CD9 are respectively inquired on NCBI website, the P2A sequence can be referred to documents of High clearance Efficiency of a 2A Peptide Derived from Porcine Teschovirus-1 in Human Cell Lines, Zebraphish and MicepploS one.2011, (6) (4) e18556, and MYC-P2A-CD9 polycistrons containing Xba I and EcoR I enzyme cutting sites and a cloning sequence are designed.

The c-Myc sequence is as follows:

CTGGATTTTTTTCGGGTAGTGGAAAACCAGCAGCCTCCCGCGACGATGCCCCTCAACGTTAGCTTCACCAACAGGAACTATGACCTCGACTACGACTCGGTGCAGCCGTATTTCTACTGCGACGAGGAGGAGAACTTCTACCAGCAGCAGCAGCAGAGCGAGCTGCAGCCCCCGGCGCCCAGCGAGGATATCTGGAAGAAATTCGAGCTGCTGCCCACCCCGCCCCTGTCCCCTAGCCGCCGCTCCGGGCTCTGCTCGCCCTCCTACGTTGCGGTCACACCCTTCTCCCTTCGGGGAGACAACGACGGCGGTGGCGGGAGCTTCTCCACGGCCGACCAGCTGGAGATGGTGACCGAGCTGCTGGGAGGAGACATGGTGAACCAGAGTTTCATCTGCGACCCGGACGACGAGACCTTCATCAAAAACATCATCATCCAGGACTGTATGTGGAGCGGCTTCTCGGCCGCCGCCAAGCTCGTCTCAGAGAAGCTGGCCTCCTACCAGGCTGCGCGCAAAGACAGCGGCAGCCCGAACCCCGCCCGCGGCCACAGCGTCTGCTCCACCTCCAGCTTGTACCTGCAGGATCTGAGCGCCGCCGCCTCAGAGTGCATCGACCCCTCGGTGGTCTTCCCCTACCCTCTCAACGACAGCAGCTCGCCCAAGTCCTGCGCCTCGCAAGACTCCAGCGCCTTCTCTCCGTCCTCGGATTCTCTGCTCTCCTCGACGGAGTCCTCCCCGCAGGGCAGCCCCGAGCCCCTGGTGCTCCATGAGGAGACACCGCCCACCACCAGCAGCGACTCTGAGGAGGAACAAGAAGATGAGGAAGAAATCGATGTTGTTTCTGTGGAAAAGAGGCAGGCTCCTGGCAAAAGGTCAGAGTCTGGATCACCTTCTGCTGGAGGCCACAGCAAACCTCCTCACAGCCCACTGGTCCTCAAGAGGTGCCACGTCTCCACACATCAGCACAACTACGCAGCGCCTCCCTCCACTCGGAAGGACTATCCTGCTGCCAAGAGGGTCAAGTTGGACAGTGTCAGAGTCCTGAGACAGATCAGCAACAACCGAAAATGCACCAGCCCCAGGTCCTCGGACACCGAGGAGAATGTCAAGAGGCGAACACACAACGTCTTGGAGCGCCAGAGGAGGAACGAGCTAAAACGGAGCTTTTTTGCCCTGCGTGACCAGATCCCGGAGTTGGAAAACAATGAAAAGGCCCCCAAGGTAGTTATCCTTAAAAAAGCCACAGCATACATCCTGTCCGTCCAAGCAGAGGAGCAAAAGCTCATTTCTGAAGAGGACTTGTTGCGGAAACGACGAGAACAGTTGAAACACAAACTTGAACAGCTACGGAACTCTTGTGCGTAA

the CD9 sequence is as follows:

ATGAGC GTCCTGTCCA GCTGGGAGCT GTGCGTCAAA TACGCAATTT TCATCTTCAA CTTTGTCTTC TGGCTTGCAG GGACTGGAGT GCTGGCTGTG GGATTATGGC TTCGTTTCGA CTCCAGGACC AAAGCACTGT TTGAAGGAGA AGACGCGCCC TCTGTCTTCT TCACTGGTGT TTATCTGCTG ATCGCTGCAG GAGCGTTGAT GATGGTGGTG GGATTCCTGG GATGCTGTGG AGCCATTAAA GAGTCGCCCT GCATGCTGGG ACTGTTCTTC ATCTTCCTGC TCATCATCTT TGCTGCTGAA GTGGCTGCAG GGATCTGGGG ACTGTCCAAC ACGCACACGG TCATAGAGGA AGTCACAGAG TTTTATAAGC AGACTTTTGA CAACTACAGG ACCACCAAAC AGGAAGCGCT GAAGGAGACC CTCCGCCTGA TCCACTTTGG GCTGGACTGC TGCGGTCCTA CAGGAAGCGT CTTCGATGCT GCCAAAGACA TCTGTCCAAA GCAGGAAGGA CTGGCCGTCC TCGTTACCAC GAGTTGCCCA AAAGCCATCG ATGAAGTATT CAACAACAAG CTGCACATCA TCGGTGGAGT TGGGATCGGT ATTGGCGTCA TCATGATCTT TGGGATGATC TTCAGCATGA TCCTTTGCTG TGCCATCAAG AGGTCCAGAG AATATGTGTAA

the designed MYC-P2A-CD9 sequence is as follows:

TCTAGAGCCACCATGGATTTTTTTCGGGTAGTGGAAAACCAGCAGCCTCCCGCGACGATGCCCCTCAACGTTAGCTTCACCAACAGGAACTATGACCTCGACTACGACTCGGTGCAGCCGTATTTCTACTGCGACGAGGAGGAGAACTTCTACCAGCAGCAGCAGCAGAGCGAGCTGCAGCCCCCGGCGCCCAGCGAGGATATCTGGAAGAAATTCGAGCTGCTGCCCACCCCGCCCCTGTCCCCTAGCCGCCGCTCCGGGCTCTGCTCGCCCTCCTACGTTGCGGTCACACCCTTCTCCCTTCGGGGAGACAACGACGGCGGTGGCGGGAGCTTCTCCACGGCCGACCAGCTGGAGATGGTGACCGAGCTGCTGGGAGGAGACATGGTGAACCAGAGTTTCATCTGCGACCCGGACGACGAGACCTTCATCAAAAACATCATCATCCAGGACTGTATGTGGAGCGGCTTCTCGGCCGCCGCCAAGCTCGTCTCAGAGAAGCTGGCCTCCTACCAGGCTGCGCGCAAAGACAGCGGCAGCCCGAACCCCGCCCGCGGCCACAGCGTCTGCTCCACCTCCAGCTTGTACCTGCAGGATCTGAGCGCCGCCGCCTCAGAGTGCATCGACCCCTCGGTGGTCTTCCCCTACCCTCTCAACGACAGCAGCTCGCCCAAGTCCTGCGCCTCGCAAGACTCCAGCGCCTTCTCTCCGTCCTCGGATTCTCTGCTCTCCTCGACGGAGTCCTCCCCGCAGGGCAGCCCCGAGCCCCTGGTGCTCCATGAGGAGACACCGCCCACCACCAGCAGCGACTCTGAGGAGGAACAAGAAGATGAGGAAGAAATCGATGTTGTTTCTGTGGAAAAGAGGCAGGCTCCTGGCAAAAGGTCAGAGTCTGGATCACCTTCTGCTGGAGGCCACAGCAAACCTCCTCACAGCCCACTGGTCCTCAAGAGGTGCCACGTCTCCACACATCAGCACAACTACGCAGCGCCTCCCTCCACTCGGAAGGACTATCCTGCTGCCAAGAGGGTCAAGTTGGACAGTGTCAGAGTCCTGAGACAGATCAGCAACAACCGAAAATGCACCAGCCCCAGGTCCTCGGACACCGAGGAGAATGTCAAGAGGCGAACACACAACGTCTTGGAGCGCCAGAGGAGGAACGAGCTAAAACGGAGCTTTTTTGCCCTGCGTGACCAGATCCCGGAGTTGGAAAACAATGAAAAGGCCCCCAAGGTAGTTATCCTTAAAAAAGCCACAGCATACATCCTGTCCGTCCAAGCAGAGGAGCAAAAGCTCATTTCTGAAGAGGACTTGTTGCGGAAACGACGAGAACAGTTGAAACACAAACTTGAACAGCTACGGAACTCTTGTGCG GGA AGC GGA GCT ACT AAC TTC AGC CTG AAG CAG GCT GGA GAC GTG GAG AAC CCT GGA CCTATGAGCGTCCTGTCCA GCTGGGAGCTGTGCGTCAAATACGCAATTTTCATCTTCAACTTTGTCTTCTGGCTTGCAGGGACTGGAGTGCTGGCTGTGGGATTATGGCTTCGTTTCGACTCCAGGACCAAAGCACTGTTTGAAGGAGAAGACGCGCCCTCTGTCTTCTTCACTGGTGTTTATCTGCTGATCGCTGCAGGAGCGTTGATGATGGTGGTGGGATTCCTGGGATGCTGTGGAGCCATTAAAGAGTCGCCCTGCATGCTGGGACTGTTCTTCATCTTCCTGCTCATCATCTTTGCTGCTGAAGTGGCTGCAGGGATCTGGGGACTGTCCAACACGCACACGGTCATAGAGGAAGTCACAGAGTTTTATAAGCAGACTTTTGACAACTACAGGACCACCAAACAGGAAGCGCTGAAGGAGACCCTCCGCCTGATCCACTTTGGGCTGGACTGCTGCGGTCCTACAGGAAGCGTCTTCGATGCTGCCAAAGACATCTGTCCAAAGCAGGAAGGACTGGCCGTCCTCGTTACCACGAGTTGCCCAAAAGCCATCGATGAAGTATTCAACAACAAGCTGCACATCATCGGTGGAGTTGGGATCGGTATTGGCGTCATCATGATCTTTGGGATGATCTTCAGCATGATCCTTTGCTGTGCCATCAAGAGGTCCAGAG AATATGTGTAAGAATTC；

2) Myc-P2A-CD9 gene fragment synthesis: synthesizing a target sequence by using a Droligo BLP192 DNA synthesizer, respectively taking 100g of adenine monomer, 100g of thymine monomer, 100g of guanine monomer and 100g of cytosine monomer, respectively dissolving the monomers by using acetonitrile, adding the dissolved monomers into the synthesizer, synthesizing a primer on a synthesis column according to the operation instruction of the synthesizer, and performing ammonolysis elution by using ammonia gas to obtain a primer fragment;

3) and (3) PCR amplification: PCR amplification was performed using the PCR kit KOD-Plus-Neo:

a. the first round of reaction: taking 5. mu.L of 2mM dNTP, 5. mu.L of the primer fragment synthesized in step 2), 1. mu.L of DNA polymerase, 5. mu.L of 10 XDNA polymerase buffer solution, and 25. mu.L of 25 mM MgSO 25 ₄ 、9μL ddH ₂ O, the total reaction volume is 50 mu L, the mixture is fully mixed and placed in a PCR amplification instrument, and then amplification is carried out according to the following conditions: pre-denaturing at 95 ℃ for 2min, denaturing at 98 ℃ for 30s, annealing at 58 ℃ for 30s (18 cycles), extending at 72 ℃ for 30s/1kb, and final extending at 72 ℃ for 2min to obtain a first-stage product;

b. and (3) carrying out a second reaction: mu.L of 2mM dNTP, 2. mu.L of primer, 5. mu.L of the primary product obtained in step a, 25. mu.L of 25 mM MgSO 25 ₄ 5. mu.L of 10 XDNA polymerase buffer, 1. mu.L of DNA polymerase, 10. mu.L of ddH ₂ O, the total reaction volume is 50 mu L, the mixture is fully mixed and added into a PCR amplification instrument, and then amplification is carried out according to the following conditions: pre-denaturation at 95 ℃ for 2min, denaturation at 98 ℃ for 30s, annealing at 58 ℃ for 30s (25 cycles), extension at 72 ℃ for 30s/1kb, and final extension at 72 ℃ for 2min to obtain the fragment of Myc-P2A-CD9 gene.

Further, the Myc-P2A-CD9 gene fragment obtained is detected by the following specific operations:

1) 5 mu g of the obtained Myc-P2A-CD9 gene fragment is taken for electrophoresis detection, the detection result is shown in figure 1, as shown in figure 1, the first lane in figure 1 is a PCR product, the second lane is a DNA marker, and the first lane in the figure shows a band of about 2000 bp. The analysis shows that the size of the Myc-P2A-CD9 gene fragment related to the application is 2100bp, and is consistent with the size shown in the figure, which indicates that the product synthesized by the application is the Myc-P2A-CD9 gene fragment;

2) and carrying out agarose gel electrophoresis purification and recovery on the residual Myc-P2A-CD9 gene fragment.

S2, constructing a recombinant lentivirus plasmid:

1) enzyme digestion

Enzyme digestion of Myc-P2A-CD9 gene fragment: taking 1.0 mu g of Myc-P2A-CD9 gene fragment, adding 1.0 mu L of restriction endonuclease Xba I, 1.0 mu L of restriction endonuclease EcoR I and 5.0 mu L of CutSmart Buffer solution, finally adding double distilled water until the total volume is 50 mu L, placing the mixture at 37 ℃ and reacting for 60min to obtain a sample A;

the pLV-Flag (C1) plasmid was linearized: taking 1.0 mu g of pLV-Flag (C1) plasmid, adding 1.0 mu L of restriction enzyme Xba I, 1.0 mu L of restriction enzyme EcoR I and 5.0 mu L of CutSmart Buffer solution, finally adding double distilled water until the total volume is 50 mu L, placing the mixture at 37 ℃ for reacting for 60min to obtain a sample B;

2) recovery of target gene fragment and linearized plasmid

Agarose gel electrophoresis: performing operation by using an agarose gel recovery kit, mixing the sample A and the sample B with a DNA loading buffer solution concentrated by 5 times respectively, adding the mixed solution into an agarose gel spotting hole after the DNA loading buffer solution is concentrated by one time to perform electrophoresis for 30min under the voltage of 120V;

cutting the target strip into glue: cutting the agarose gel containing the target band by using an ultraviolet gel cutting instrument and transferring the agarose gel into a 1.5mL centrifuge tube;

recovering a target strip: recovering target gene fragments and linearized plasmids according to the operating steps of the agarose gel recovery kit, and storing at-20 ℃;

3) connection of

Selecting a Ligation high Ver.2 kit for operation, taking 10 mu L of Ligation high Ver.2, 2.5 mu L of linearized plasmid and 7.5 mu L of target gene fragment, mixing uniformly, and reacting for 30min at 16 ℃ to obtain a Ligation product containing the recombinant lentivirus plasmid pLV-MYC-P2A-CD 9;

4) transformation of

a. Thawing 100 μ L DH5 α competent cells on ice, adding 10 μ L ligation product containing recombinant lentivirus plasmid pLV-MYC-P2A-CD9, mixing, and ice-cooling for 20 min;

b. after ice-bath, the mixture was placed in a water bath at 42 ℃ for 90s by heat shock and then immediately placed on ice for 2 min;

c. adding 200 μ L of LB liquid culture medium without antibiotics into the mixture, and resuscitating at 37 deg.C and 200rpm for 60min to obtain mixed bacterial liquid;

d. taking 100 mu L of mixed bacterial liquid, coating the mixed bacterial liquid on an LB solid culture medium containing 100 mu g/mL antibiotics, inverting the mixed bacterial liquid in an incubator at 37 ℃ for 24 hours for culture, and observing that a monoclonal colony appears on the LB solid culture medium after 24 hours;

5) plasmid extraction

And (3) selecting an Omega plasmid minipill kit for operation.

a. Taking the monoclonal colony in the step 4) to a centrifuge tube, adding 5mL of LB liquid medium containing 100 mu g/mL of antibiotic, and culturing for 14h at 37 ℃ by a bacterial culture shaker at 200 rpm;

b. centrifuging 3mL of bacterial solution at room temperature at 10000 Xg for 1 min; removing the supernatant, adding 250 mu L of a solution I containing RNase A in the kit, and shaking by using a vortex oscillator until the thalli are completely suspended;

c. adding a solution II in a 250-mu L kit, and inverting the centrifuge tube for 5 times to obtain a clear lysate;

d. adding 350 mu L of solution III in the kit, inverting the centrifuge tube until white flocculent precipitate appears in the centrifuge tube, and centrifuging at 10000 Xg for 10min at room temperature;

e. sucking the supernatant, transferring to an absorption column with an assembled centrifuge tube with the volume of 2mL, and centrifuging at room temperature at 10000 Xg for 1min until the lysate completely passes through the absorption column;

f. discarding the filtrate, adding 500 μ L Buffer HB, centrifuging at 10000 × g for 1min, cleaning the absorption column, and removing residual protein to ensure the purity of DNA;

g. discarding the filtrate, washing the absorption column with 750 μ L Wash Buffer diluted with 100% ethanol, centrifuging at 10000 × g for 1min, adding 50 μ L Wash Buffer to Wash the absorption column, centrifuging at 10000 × g for 1 min;

h. putting the absorption column into a 1.5mL centrifuge tube, adding 50 μ L sterile deionized water, centrifuging at 10000 Xg rotation speed for 5min, and collecting the supernatant to obtain the recombinant lentivirus plasmid.

Furthermore, sequencing is carried out on the obtained recombinant lentivirus plasmid, and the sequencing result is consistent with the designed MYC-P2A-CD9 sequence, which indicates that the recombinant lentivirus plasmid is successfully constructed.

S3, slow virus packaging:

1) cell seeding

In the afternoon of the day, 293T cells were collected at 5 x 10 ⁵ The density of individual cells/well was seeded in 6-well plates containing 2mL of lentivirus packaging medium at 37 ℃ with 5% CO ₂ Incubating overnight under conditions to achieve a cell density of 70% confluence;

2) transfection in the next morning

a. The recombinant lentiviral plasmid was diluted to 1. mu.g/mL using Opti-MEM medium;

b. preparing a tube A: taking 250 mu L of serum-free culture medium and 7 mu L of Lipofectamine3000 transfection reagent, and uniformly mixing by vortex for 10 s;

c. preparing a tube B: uniformly mixing 2 mu L of recombinant lentivirus plasmid, 1.2 mu L of psPAX2 and 0.8 mu L of pMD2G to obtain pretreated plasmid;

taking 250 mu L of serum-free culture medium, 4 mu g of pretreated plasmid and 6 mu L of Lipofectamine3000 transfection reagent, and uniformly mixing by vortex for 10 s;

d. preparation of liposome-DNA complexes: mixing the contents of the tube A and the tube B uniformly, and incubating at room temperature for 10 min;

e. removing 1mL of culture medium from each well of the culture plate, adding 500 μ L of liposome-DNA complex into each well, gently stirring the culture plate, and mixing; at 37 ℃ with 5% CO ₂ Incubating for 8h under the condition;

f. change of plating medium in each well: aspirate the medium containing the liposome-DNA complex from each well and then place the plate medium in 2mL of pre-warmed lentiviral packaging medium; at 37 ℃ with 5% CO ₂ Incubating overnight under the condition;

g. the first virus batch was collected on day three: 48h after transfection, 2mL of cell supernatant was collected from each well, transferred to a 15mL conical tube and stored at 4 ℃;

h. the plate medium in each well was replaced again: by usingThe collected medium was replaced with 2mL of preheated lentiviral packaging medium at 37 ℃ in 5% CO ₂ Incubating overnight under the condition;

i. the second batch of virus was collected on day four: after 72h of transfection, 2mL of cell supernatant was collected from each well and mixed with the supernatant collected in step g; centrifuging at 2000rpm for 10min at room temperature, removing cell debris, collecting and transferring supernatant to a centrifuge tube, and discarding cell precipitate;

j. and (3) virus concentration: the centrifuge tubes in step i were placed in a Lenti-X Concentrator: adding a Lenti-X Concentrator into the supernatant at a volume ratio of 1:3, and incubating overnight at 4 ℃;

k. centrifuging at 4 deg.C for 60min at 1500g, removing supernatant, and precipitating to obtain recombinant lentivirus; adding DMEM basic culture medium to resuspend virus precipitate, subpackaging at 50 ul/tube, and storing in refrigerator at-80 deg.C for use.

S4, constructing the immortalized mesenchymal stem cells:

1) recovery and culture of mesenchymal stem cells

a. Taking out the cryopreserved human umbilical mesenchymal stem cells from the liquid nitrogen tank, putting the cryopreserved human umbilical mesenchymal stem cells into a refrigerator at minus 80 ℃ for 2-3 min, taking out the cryopreserved cells, and putting the cryopreserved tubes into warm water at 37 ℃ for thawing;

b. disinfecting the outer wall of the cryopreservation tube orifice by using 75% alcohol, and transferring the cell cryopreservation suspension into a 15mL centrifuge tube filled with 9mL complete culture medium;

c. centrifuging the cell suspension for 5min at 250g, removing the supernatant, and adding 2mL of complete culture medium preheated to 37 ℃;

d. cells were seeded into T25 flasks and complete medium was added at 37 ℃ with 5% CO ₂ Culturing in an incubator with saturated humidity; subsequently, the fresh complete culture medium is replaced every two days until the cell reaches 80% confluence degree for standby;

2) infecting mesenchymal stem cells

a. The mesenchymal stem cells in the step 1) are treated according to 1 x 10 ⁵ The individual cells/well were seeded into 6-well plates containing mesenchymal stem cell complete medium;

b. b, when the cells in the step a reach 80% confluence, infecting the mesenchymal stem cells with the recombinant lentiviruses according to the infection complex number of MOI =20, and simultaneously adding polybrene to enable the final concentration of the polybrene to be 10 mug/mL; setting a control hole, wherein recombinant lentivirus and polybrene are not added in the control hole;

c. and after 48h of infection, adding puromycin into the virus-infected hole and the control hole to enable the final concentration of puromycin to be 3 mug/mL for screening, and continuing culturing for 7 days to ensure that all cells in the control hole die, so that the cells in the virus-infected hole are the umbilical cord mesenchymal stem cell MSC-MYC/CD9 cell strain expressing MYC and CD9, namely the immortalized mesenchymal stem cells.

Further, the obtained immortalized mesenchymal stem cells are identified by the following specific identification method:

1) 1 x 10 each of immortalized mesenchymal cells and mesenchymal stem cells not infected by recombinant virus ⁶ Respectively adding 100 mu L of RIPA lysate containing 1% PMSF, uniformly mixing by vortex for 30s, and standing on ice for 30 min;

2) centrifuging at 12000rpm for 30min at 4 deg.C, and transferring the supernatant into a centrifuge tube;

3) adding 6 × protein loading to working concentration (1 ×), and heating at 100 ℃ to denature the protein;

4) taking 40 mu L of each of the two cell lysates in the step 3) and 40 mu L, loading 10% SDS-PAGE, and performing electrophoresis at 120V for 120 min;

5) transferring the protein in SDS-PAGE to a PVDF membrane through a constant current of 350mA for 120min, placing the PVDF membrane in a confining liquid containing 5% skimmed milk, and sealing at 4 ℃ overnight;

6) cutting the sealed PVDF membrane into two parts, wherein each part contains virus-infected mesenchymal stem cell lysate and virus-uninfected mesenchymal stem cell lysate, respectively putting the two parts of PVDF membrane into 10ml of rabbit anti-human Myc primary antibody containing 0.5 mu g/ml and 10ml of rabbit anti-human CD9 primary antibody containing 1:1000 dilution, and incubating for 1h at room temperature;

7) washing PVDF membrane with TBST buffer solution for 5 times, each time for 5 min; then 10ml goat anti-rabbit IgG secondary antibody marked by horseradish peroxidase diluted according to the proportion of 1:100000 is added, and the incubation is carried out for 1h at room temperature; washing with TBST buffer for 5 times, each for 5 min;

8) after ECL hypersensitive color developing solution is added, a solar imaging system is utilized to carry out photographing analysis.

The result shows that the lysate of virus-infected mesenchymal stem cells on the PVDF membrane incubated by the rabbit anti-human Myc primary antibody shows two bands with stronger signals, which are respectively positioned at 75KD and 50 KD; the lysate of virus-infected mesenchymal stem cells incubated with rabbit anti-human CD9 primary antibody showed two bands with stronger signals, respectively at 75KD and 25 KD.

In the control group, a band with a weaker signal is detected on the PVDF membrane incubated by the rabbit anti-human Myc primary antibody of the mesenchymal stem cell lysate without virus infection, and is positioned at 50 KD; a band with a weaker signal was detected on the PVDF membrane of the rabbit anti-human CD9 primary antibody, and was located at 25 KD.

The analysis shows that the molecular weight of the human c-Myc protein is 50KD, the molecular weight of the CD9 protein is 25KD, and the immortalized mesenchymal stem cells express the c-Myc protein and the CD9 protein. Thus, virus-infected mesenchymal stem cell lysates on rabbit anti-human Myc primary-antibody incubated PVDF membranes showed a 75KD band (intact protein that has not been sheared) and a 50KD band (c-Myc protein after shearing); rabbit anti-human CD9 primary antibody incubated virus-infected mesenchymal stem cell lysate showed a 75KD band (intact protein that has not been sheared) and a 25KD band (CD 9 protein after shearing); in the control group, the virus-uninfected mesenchymal stem cell lysate showed a 50KD band (sheared c-Myc protein) on the PVDF membrane incubated by the rabbit anti-human Myc primary antibody, and a 25KD band (sheared CD9 protein) on the PVDF membrane incubated by the rabbit anti-human CD9 primary antibody. Therefore, the application proves that the immortalized mesenchymal stem cell capable of stably expressing the c-Myc protein and the CD9 protein is successfully constructed, and the c-Myc protein and the CD9 protein can form two independent protein molecules after being sheared by P2A and can have respective driving functions.

Further, phenotype analysis and identification are carried out on the immortalized mesenchymal stem cells, and the specific identification method comprises the following steps:

1) immortalized mesenchymal stem cells are treated according to 1 x 10 ⁵ Add individual cells/tube to 5mL BD tube;

2) adding D-PBS buffer solution, centrifuging at 4 deg.C and 1500rpm for 5min, discarding supernatant, and repeating the steps once;

3) discarding the supernatant, adding CD90-PE antibody and CD45-FITC antibody, and incubating for 20min on ice away from light;

4) discarding the supernatant, adding D-PBS buffer solution, centrifuging at 4 deg.C and 1500rpm for 5min, discarding the supernatant, and repeating the steps once;

5) 200 μ L D-PBS buffer was added to the BD tube to resuspend the cells, which were then detected by loading on a BD FACSEverse flow cytometer.

The results show that CD90 is positive and CD45 is negative, indicating that the obtained cells are stable immortalized mesenchymal stem cells.

Further, subculturing and identifying the immortalized mesenchymal stem cells by the following specific identification method:

1) culturing the cells in a T75 culture flask, washing the cells 3 times with 6mL of 1 XPBS buffer preheated to 37 ℃, and removing the 1 XPBS buffer by suction;

2) adding 3mL of Trypsin-EDTA preheated to 37 ℃, rotating a T75 culture bottle to cover the surface of the cells with the Trypsin-EDTA, slightly beating the wall of a culture vessel to remove the walls of the cells after observing that about 70-80% of the cells are rounded under a microscope;

3) adding 6mL of complete medium preheated to 37 ℃ to stop digestion;

4) sucking liquid by using a suction pipe, repeatedly blowing and beating the bottom wall of the culture vessel to ensure that cells are thoroughly separated from the bottom wall of the vessel, transferring the cell suspension into a 15mL centrifuge tube, centrifuging for 5min at the rotating speed of 250g, removing supernatant, and adding 2mL of complete culture medium to suspend the cells;

5) counting the number of living cells by trypan blue staining;

6) according to 2.5 x 10 ⁴ Individual cell/cm ² Cells were seeded at a density of 5% CO at 37 ℃ ² Culturing in an incubator with saturated humidity;

7) the cells were passaged 100 times according to the above-mentioned passage method, and the cell morphology and growth rate were observed.

The result shows that the morphology and the growth speed of the cells have no obvious change after 100 passages, which indicates that the c-Myc protein in the stem cells can play a role and lead the stem cells to be capable of infinitely proliferating, thereby proving that the immortalized mesenchymal stem cells are successfully constructed by the application.

Example 2

A method for preparing exosomes by using the immortalized mesenchymal stem cells constructed in the embodiment 1 comprises the following specific steps:

(1) cell culture

1) Take 1 x 10 ⁶ Immortalized mesenchymal stem cells constructed in example 1 were seeded into a cell culture dish containing 20mL of a complete culture medium of mesenchymal stem cells and incubated in a Likang HF100 three-gas incubator with 0.5% oxygen and 99.5% nitrogen:

2) when the cells grow to 50% confluence, discarding the supernatant, replacing with sterile D-PBD buffer solution, incubating for 12h in a Likang HF100 three-gas culture box with 0.5% oxygen and 99.5% nitrogen, and collecting the supernatant;

(2) exosome separation purification

1) Centrifuging the supernatant collected in the step (1) at 4 ℃ at 10000g for 10min, removing cell debris, and collecting the supernatant;

2) filtering the supernatant obtained in the step 1) by using a membrane filter with the aperture of 0.22 um, and collecting filtrate;

3) centrifuging the filtrate at 4 deg.C at 120000g for 90min, discarding supernatant, and resuspending the exosome precipitate with normal saline; and repeating the steps once, and discarding the supernatant to obtain the precipitate as the exosome.

Further, the obtained exosomes are detected by a Western Blot method, and the method specifically comprises the following steps:

1) preparing exosome by using the method for preparing exosome described in example 2 and non-immortalized mesenchymal stem cells, then taking 20 mu L of exosome separated and purified in example 2 and exosome secreted by the non-immortalized mesenchymal stem cells, respectively adding 100 mu L of RIPA lysate containing 1% PMSF, and incubating for 15min at 4 ℃ to fully lyse the exosome;

2) adding 6 × protein loading to working concentration (1 ×), and heating at 100 deg.C for 5min to denature the protein;

3) respectively taking more than 20 mu L of two samples, loading 10% SDS-PAGE, and carrying out electrophoresis for 120 minutes at the voltage of 100V;

4) rotating the membrane for 120min under the voltage of 100V, so that the protein is transferred to the PVDF membrane; placing the PVDF membrane after membrane conversion in a sealing solution containing 5% of skimmed milk powder, and sealing at 4 ℃ overnight;

5) putting the sealed PVDF membrane into 10mL of rabbit anti-human HSP70 primary antibody containing 0.5ug/mL, and incubating for 1h at room temperature; then washing with TBST buffer for 5 times, each time for 5 min;

6) putting 10ml of goat anti-rabbit IgG (H & L) secondary antibody labeled by horseradish peroxidase diluted according to the ratio of 1:100000 into the washed PVDF membrane, and incubating for 1H at room temperature; then washing with TBST buffer for 5 times, each time for 5 min;

7) after ECL hypersensitive developing solution is added, a day energy imaging system is utilized to carry out photographing analysis.

The results show that a 50KD band can be detected in both exosome lysates, whereas the signal detected for exosome lysates secreted by immortalized mesenchymal stem cells is stronger. The molecular weight of the human HSP70 protein was analyzed to be 50KD, and thus, a 50KD band could be detected in both exosome lysates. Compared with non-immortalized mesenchymal stem cells, the immortalized mesenchymal stem cells can secrete more exosomes, so that signals detected by exosome lysates secreted by the immortalized mesenchymal stem cells are stronger, and the immortalized mesenchymal stem cells constructed in the application can secrete a large amount of exosomes.

The present embodiment is only for explaining the present application, and it is not limited to the present application, and those skilled in the art can make modifications of the present embodiment without inventive contribution as needed after reading the present specification, but all of them are protected by patent law within the scope of the claims of the present application.

Claims

1. A construction method of immortalized mesenchymal stem cells is characterized in that: the method comprises the following steps:

2. The method for constructing immortalized mesenchymal stem cells according to claim 1, wherein the method comprises the following steps: in step S2, the following method is adopted for connection:

2) recovering the target gene fragment and the linearized plasmid;

3. The method for constructing immortalized mesenchymal stem cells according to claim 2, wherein the method comprises the following steps: the enzyme digestion is carried out by adopting the following method:

4. The method for constructing immortalized mesenchymal stem cells according to claim 3, wherein the method comprises the following steps: the target gene fragment and the linearized plasmid are recovered by the following method:

1) preparing agarose gel;

5. The method for constructing immortalized mesenchymal stem cells according to claim 2, wherein the method comprises the following steps: the ligation product containing the recombinant lentiviral plasmid pLV-MYC-P2A-CD9 was used to transform DH5 alpha competent cells as follows:

4) sucking 98-102 μ L of mixed bacteria liquid, spreading into LB solid culture medium containing 100 μ g/mL antibiotic, and culturing in incubator for 23-25 h.

6. The method for constructing immortalized mesenchymal stem cells according to claim 1, wherein the method comprises the following steps: in step S3, the specific operation of lentivirus packaging is as follows:

2) diluting the recombinant lentiviral plasmid to 1 μ g/μ L;

5) collecting: and collecting supernatant in each hole of the culture plate, and performing centrifugal concentration to obtain the recombinant lentivirus.

7. The method for constructing immortalized mesenchymal stem cells according to claim 6, wherein the method comprises the following steps: the pretreated plasmid is prepared by mixing the following raw materials: 1.8-2.2. mu.L of recombinant lentiviral plasmid, 1.1-1.3. mu.L of psPAX2, and 0.7-0.9. mu.L of pMD 2G.

8. The method for constructing immortalized mesenchymal stem cells according to claim 6, wherein the method comprises the following steps: the transfection is performed in step 4) when the confluency of cells in the culture plate reaches 60-70%.

9. A method of preparing exosomes, characterized in that: preparation using immortalized mesenchymal stem cells according to any one of claims 1 to 8, comprising the steps of:

(1) inoculating immortalized mesenchymal stem cells and culturing;

(2) separation and purification:

10. A method of producing exosomes according to claim 9, characterised in that: the step a) is centrifuged at 10000g for 10min, and the step b) and the step c) are both centrifuged at 120000g for 90 min.