CN114807083A - Rapid long-fragment amplification enzyme and application thereof in KIR gene sequencing - Google Patents

Rapid long-fragment amplification enzyme and application thereof in KIR gene sequencing Download PDF

Info

Publication number
CN114807083A
CN114807083A CN202210384065.5A CN202210384065A CN114807083A CN 114807083 A CN114807083 A CN 114807083A CN 202210384065 A CN202210384065 A CN 202210384065A CN 114807083 A CN114807083 A CN 114807083A
Authority
CN
China
Prior art keywords
artificial sequence
kir
amplification
rapid
sequencing
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202210384065.5A
Other languages
Chinese (zh)
Inventor
陈炤源
王浩
章婷婷
崔江应
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Jiangsu Weihe Biotechnology Co ltd
Original Assignee
Jiangsu Weihe Biotechnology Co ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Jiangsu Weihe Biotechnology Co ltd filed Critical Jiangsu Weihe Biotechnology Co ltd
Priority to CN202210384065.5A priority Critical patent/CN114807083A/en
Publication of CN114807083A publication Critical patent/CN114807083A/en
Pending legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/12—Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
    • C12N9/1241—Nucleotidyltransferases (2.7.7)
    • C12N9/1252—DNA-directed DNA polymerase (2.7.7.7), i.e. DNA replicase
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6869—Methods for sequencing
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y207/00—Transferases transferring phosphorus-containing groups (2.7)
    • C12Y207/07—Nucleotidyltransferases (2.7.7)
    • C12Y207/07007—DNA-directed DNA polymerase (2.7.7.7), i.e. DNA replicase

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Molecular Biology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Genetics & Genomics (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Medicinal Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Analytical Chemistry (AREA)
  • Biophysics (AREA)
  • Immunology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention provides a rapid long-fragment amplification enzyme and application thereof in KIR gene sequencing. The rapid long fragment amplification enzyme is DNA polymerase which is modified by amino acid sequence and can rapidly amplify long fragments, and compared with the amino acid sequence of unmodified DNA polymerase, the modified DNA polymerase carries out the following mutations: leucine L at the 145 th site is mutated into glutamine Q, valine V at the 719 th site is mutated into asparagine N, and the nucleotide sequence of the coding gene of the rapid long fragment amplification enzyme is shown as SEQ ID NO 48. The invention has the following technical effects: 1) the DNA polymerase is modified by amino acid sequences and can rapidly amplify long fragments, and the rapid and accurate amplification of long fragment target sequences can be realized; the full-length amplification of KIR subtype genes can be realized in one PCR reaction, and the length is up to 16 kb; 2) can realize the rapid amplification and sequencing typing of KIR genes of samples.

Description

Rapid long-fragment amplification enzyme and application thereof in KIR gene sequencing
Technical Field
The invention relates to a rapid long-fragment amplification enzyme and application thereof in KIR gene sequencing, belonging to the technical field of genetic engineering.
Background
Natural killer cells (NK) are derived from myeloid lymphoid stem cells, and their developmental maturation depends on the bone marrow and thymus microenvironment. NK cells are distributed mainly in peripheral blood and spleen, and are also present in small amounts in lymph nodes and other tissues. NK cells do not express specific antigen recognition receptors and are a class of lymphoid cells distinct from T, B lymphocytes. NK cells can express a variety of surface markers, many of which can also be expressed on the surface of other immune cells. NK cells belong to nonspecific immune cells, which can directly kill some tumor and virus-infected target cells without antigen pre-sensitization, and thus play an important role in the immune process of the body against tumors and early virus or intracellular parasitic bacteria infection. NK cells can kill cells infected by certain viruses and mutant tumor cells, and have no cytotoxicity under normal tissue cells of a host, which indicates that the NK cells have the capacity of identifying the normal tissue cells of the host and abnormal tissue cells in vivo. Recent researches prove that the surface of NK cells has two types of receptors with different functions, wherein one type of receptor can stimulate the NK cells to generate killing action after being combined with corresponding ligands on the surface of target cells, and the receptor is called killer cell activation receptor; another class of receptors, known as killer cell inhibitory receptors, inhibit NK cell killing by binding to a corresponding ligand on the surface of a target cell. The receptors for NK cells to recognize HLA class I molecules consist of two structurally distinct families of molecules. One is called the killer immunoglobulin-like receptor (KIR); the other is known as the killer lectin-like receptor (KLR).
KIR (killer immunoglobulin-like receptor) is a group of receptors which are expressed on the surface of NK cells and certain T cells and specifically recognize human major histocompatibility antigen MHC class i molecules, and plays an important role in immunoregulation of NK cell effector functions. KIR is located on human 19q13.4, Leukocyte Receptor Complex (LRC), spans about 150kb, is arranged head and tail, is encoded by multigene family with clustering and abundant polymorphism, is irregularly arranged, and has diversity in structure and function. Uhrberg et al first used the PCR-SSP method to genotype KIR, showing that different NK cell clones contain different numbers and types of KIR genes. Due to the constant improvement and sophistication of KIR genotyping methods, the constant amplification of KIR gene family members, the ever ignored genes, pseudogenes and variants, and the constant emergence of water, katharane et al demonstrate that by family isolation and genome sequencing and determination of gene sequences, more than 20 KIR haplotypes and at least 40-50 KIR genotypes are present, with 18 KIR genotypes currently detectable at low resolution, namely KIR1D, KIR2D1-5, KIR2DS1-5, KIR3DL1-3, KIR3DS1, pseudogenes Xv, X and KIR2DP1, which exhibit varying degrees of polymorphism. Based on the work of Uhrberg, Norman and Gomez-Lozano et al, other researchers optimized the correctness of KIR typing by readjusting the synthesis of multiple primer pairs.
At present, the main KIR genotyping methods comprise a PCR-RFLP method, a PCR-SSOP method, a PCR-SSP method, a real-time fluorescent quantitative PCR method and a PCR-SBT method. The PCR-RFLP, PCR-restriction fragment length polymorphism detecting technology, has the basic principle that the target DNA is amplified by PCR, and the amplified product is digested by specific endonuclease and cut into fragments with different sizes, which are directly resolved on gel electrophoresis. The method needs to construct allele specific enzyme cutting sites, is complex to operate, cannot automatically obtain results and has subjectivity. The basic method of the PCR-SSOP (polymerase chain reaction) -specific sequence oligonucleotide probe is to use an artificially synthesized KIR type specific oligonucleotide sequence as a probe to be hybridized with a KIR gene fragment of a sample to be detected, which is amplified by PCR, so as to determine the KIR type. The method has a great deal of probe design difficulty, huge manpower and material resources are required to be invested in the optimal condition search of an experimental procedure, a hybridization instrument is required to be equipped, and the repeatability among laboratories is poor and the accuracy needs to be improved. PCR-SSP is sequence specific primer technology, and the basic method is to design a whole set of allele specific primers, obtain KIR type specific amplification product by means of PCR technology, and directly analyze the band type by electrophoresis to determine the KIR type. The method is relatively simple to operate, the steps of enzyme digestion, hybridization and the like are omitted, the results are directly observed by electrophoresis after PCR amplification, and the method is widely applied to clinic nowadays. However, the result cannot be obtained automatically, the subjectivity is achieved, and the accuracy needs to be improved. The Real-time fluorescence quantitative PCR (Real-time PCR) technology can qualitatively or quantitatively detect nucleic acid in a sample by monitoring a fluorescence signal released by a hybridization probe in Real time, is simple to operate and cannot obtain a high typing level. PCR-SBT (PCR-direct sequencing method) can also be used for KIR genotyping, and sanger sequencing is the international gold standard for all current gene detection and is the gold standard for methods including fluorescence quantitative PCR Taqman probe method, common PCR method, chip method, next generation sequencing method, mass spectrometry and the like. However, the traditional KIR sequencing needs to design a plurality of groups of primers in a segmented manner, and the design is complex, so that the method is not widely applied.
Disclosure of Invention
The invention aims to provide a rapid long-fragment amplification enzyme and application thereof in KIR gene sequencing, and the modified DNA polymerase provided by the invention can realize full-length amplification of KIR subtype genes in a PCR reaction, and the length of the amplification enzyme is as long as 16 kb. The method aims to overcome the defects of the prior art, realize the rapid and accurate amplification of long fragment sequences, and realize the full-length amplification of each KIR subtype only by one pair of primer groups, so that the KIR gene sequencing amplification is performed more rapidly and simply.
The technical scheme of the invention is as follows:
the first object of the present invention is to provide a rapid-growth-fragment-amplifying enzyme, which is a DNA polymerase capable of rapidly amplifying a growth fragment modified by an amino acid sequence, wherein the modified DNA polymerase is mutated, compared with the amino acid sequence of an unmodified DNA polymerase, as follows: leucine L at the 145 th site is mutated into glutamine Q, valine V at the 719 th site is mutated into asparagine N, and the nucleotide sequence of the coding gene of the rapid long fragment amplification enzyme is shown as SEQ ID NO 48.
"unmodified DNA Polymerase" in the context of the present invention is Taq DNA Polymerase from Thermo, cat # EP 0406.
In the amino acid sequence of the amplification enzyme, L145Q and V719N change the amino acid active groups from negative charge groups to positively charged amino acid molecules, so that the reaction template DNA can be combined with polymerase more quickly and tightly, and the reaction speed is accelerated.
The second purpose of the invention is to provide the application of the rapid long-fragment amplification enzyme in preparing KIR gene sequencing reagents.
The third purpose of the invention is to provide a KIR genotyping kit, which comprises the rapid long-fragment amplification enzyme, a PCR reaction reagent, a PCR amplification primer and a sequencing primer.
The PCR reaction reagent comprises: 0.5mM deoxynucleotide (dNTP), 40mM magnesium chloride (MgCl2), 80mM potassium chloride (KCl), 60mM Tris-HCl, 1mM tetramethylammonium chloride (TMAC), glycerol 0.6% (v/v), cresol red 0.02% (v/v) and betaine 5% (v/v).
The PCR amplification primer and the sequencing primer are used for detecting 16 common genes of human natural killer cell immunoglobulin-like receptor KIR, and the 16 genes comprise 14 KIR functional genes 2DL1, 2DL2, 2DL3, 2DL4, 2DL5, 2DS1, 2DS2, 2DS3, 2DS4, 2DS5, 3DL1, 3DL2, 3DL3 and 3DS1, and 2 pseudogenes 2DP1 and 3DP 1.
Further, the PCR amplification primers comprise 16 specific amplification primer groups, and the nucleotide sequences of primer pairs contained in each specific amplification primer group are shown in the following table:
Figure BDA0003594005500000031
Figure BDA0003594005500000041
Figure BDA0003594005500000051
further, the sequencing primers comprise 8 universal sequencing primer sets, and the nucleotide sequence of each primer is shown in the following table:
Figure BDA0003594005500000052
Figure BDA0003594005500000061
the invention has the following technical effects:
1) the DNA polymerase is modified by an amino acid sequence and can quickly amplify a long fragment, and the target sequence of the long fragment can be quickly and accurately amplified; the full-length amplification of KIR subtype genes can be realized in one PCR reaction, and the length is up to 16 kb;
2) can realize the rapid amplification and sequencing typing of KIR genes of samples.
Drawings
FIG. 1 is a sample amplification electropherogram;
FIGS. 2-10 are sequencing maps.
Detailed Description
The following detailed description of specific embodiments of the invention is provided, but it should be understood that the scope of the invention is not limited to the specific embodiments.
Example 1
1. Feedstock and apparatus
1.1 preparation of fast long fragment amplification enzyme: the amino acid sequence of DNA polymerase was engineered by gene synthesis to appear as L145Q and V719N. The complete gene sequence of the common codon of the Escherichia coli is synthesized, and the nucleotide sequence of the coding gene of the rapid long-fragment amplification enzyme is shown as SEQ ID NO 48. And expressed by BL21 strain under T7 promoter system.
BL21 strain expression uses recombinant Escherichia coli pUC57 vector, both provided by Jiangsu Saosofei Biotechnology Co., Ltd, and is subjected to gene synthesis by Saosofei to obtain plasmid DNA and engineering bacteria of rapid long-fragment amplification enzyme. Then protein expression and purification are carried out by Jiangsu institute of Biotechnology limited to obtain the rapid long-fragment amplification enzyme (the concentration is 5U/mu L). And the performance of the gene is verified by KIR gene amplification.
The rapid long fragment amplification enzyme can be prepared by a person skilled in the art by a method conventionally used in the art, as required, and is not particularly limited herein.
The sequence of SEQ ID NO 48 is as follows:
ATGCGTGGTATGCTGCCGCTGTTTGAACCGAAAGGTCGTGTTCTGCTGGTCGACGGTCATCATCTGGCATATCGTACCTTTCATGCACTGAAAGGTCTGACCACCAGCCGTGGTGAACCGGTTCAGGCAGTTTATGGTTTTGCAAAAAGCCTGCTGAAAGCACTGAAAGAAGATGGTGATGCAGTTATTGTTGTTTTTGATGCAAAAGCACCGAGCTTTCGTCATGAAGCATACGGTGGTTATAAAGCAGGTCGTGCACCGACCCCGGAAGATTTTCCGCGTCAGCTGGCACTGATTAAAGAACTGGTTGATCTGCTGGGTCTGGCACGTCTGGAAGTTCCGGGTTATGAAGCAGATGATGTTCTGGCAAGCCTGGCAAAAAAAGCAGAAAAAGAAGGTTATGAAGTTCGTATTCTGACCGCAGATAAAGATCTGTATCAGCTGCTGAGCGATCGTATTCATGTTCTGCATCCGGAAGGTTATCTGATTACCCCGGCATGGCTGTGGGAAAAATATGGTCTGCGTCCGGATCAGTGGGCAGATTATCGTGCACTGACCGGTGATGAAAGCGATAATCTGCCGGGTGTTAAAGGTATTGGTGAAAAAACCGCACGTAAACTGCTGGAAGAATGGGGTAGCCTGGAAGCACTGCTGAAAAATCTGGATCGTCTGAAACCGGCAATTCGTGAAAAAATTCTGGCACACATGGATGATCTGAAACTGAGCTGGGATCTGGCAAAAGTTCGTACCGATCTGCCGCTGGAAGTTGACTTTGCAAAACGTCGTGAACCGGATCGTGAACGTCTGCGTGCATTTCTGGAACGTCTGGAATTTGGCAGCCTGCTGCATGAATTCGGTCTGCTGGAAAGCCCGAAAGCACTGGAAGAAGCACCGTGGCCGCCGCCGGAAGGTGCATTTGTTGGTTTTGTTCTGAGCCGTAAAGAACCGATGTGGGCAGACCTGCTGGCACTGGCAGCAGCACGTGGTGGTCGTGTTCATCGTGCACCGGAACCGTATAAAGCACTGCGTGATCTGAAAGAAGCACGTGGTCTGCTGGCAAAAGACCTGAGCGTTCTGGCACTGCGTGAAGGTCTGGGTCTGCCGCCGGGTGATGATCCGATGCTGCTGGCATATCTGCTGGACCCGAGCAATACCACCCCGGAAGGTGTTGCACGTCGTTATGGTGGTGAATGGACCGAAGAAGCAGGTGAACGTGCAGCACTGAGCGAACGTCTGTTTGCAAATCTGTGGGGTCGTCTGGAAGGTGAAGAACGTCTGCTGTGGCTGTATCGTGAAGTTGAACGTCCGCTGAGCGCAGTTCTGGCACACATGGAAGCAACCGGTGTTCGTCTGGATGTTGCATATCTGCGTGCACTGAGCCTGGAAGTTGCAGAAGAAATTGCACGTCTGGAAGCAGAAGTTTTTCGTCTGGCAGGTCATCCGTTTAATCTGAATAGCCGCGATCAGCTGGAACGTGTTCTGTTTGATGAACTGGGTCTGCCGGCAATTGGTAAAACCGAAAAAACCGGTAAACGTAGCACCAGCGCAGCAGTTCTGGAAGCACTGCGTGAAGCACATCCGATTGTTGAAAAAATTCTGCAGTATCGTGAACTGACCAAACTGAAAAGCACCTATATTGATCCGCTGCCGGATCTGATTCATCCGCGTACCGGTCGTCTGCATACCCGTTTTAATCAGACCGCAACCGCAACCGGTCGTCTGAGCAGCAGCGATCCGAATCTGCAGAATATTCCGGTTCGTACCCCGCTGGGTCAGCGTATTCGTCGTGCATTTATTGCAGAAGAAGGTTGGCTGCTGGTTGCACTGGATTATAGCCAGATTGAACTGCGTGTTCTGGCACATCTGAGCGGTGATGAAAATCTGATTCGTGTTTTTCAGGAAGGTCGTGATATTCATACCGAAACCGCAAGCTGGATGTTTGGTGTTCCGCGTGAAGCAGTTGATCCGCTGATGCGTGATGCAGCAAAAACCATTAATTATGGTGTTCTGTATGGTATGAGCGCACATCGTCTGAGCCAGGAACTGGCAATTCCGTATGAAGAAGCACAGGCATTTATTGAACGTTATTTTCAGAGCTTTCCGAAAGTTCGTGCATGGATTGAAAAAACCCTGGAAGAAGGTCGTCGTCGTGGTTATGTTGAAACCCTGTTTGGTCGTCGTCGTTATGTTCCGGATCTGGAAGCACGTGTTAAAAGCGTTCGTGAAGCAGCAGAACGTATGGCATTTAATATGCCGGTTCAGGGTACCGCAGCCGATCTGATGAAACTGGCAATGGTTAAACTGTTTCCGCGTCTGGAAGAAATGGGTGCACGTATGCTGCTGCAGGTTCATGATGAACTGGTTCTGGAAGCACCGAAAGAACGTGCAGAAGCAGTTGCACGTCTGGCAAAAGAAGTTATGGAAGGTGTTTATCCGCTGGCAGTTCCGCTGGAAGTTGAAGTTGGTATTGGTGAAGATTGGCTGAGCGCAAAAGAACTCGAG
1.2KIR genotyping kit
The KIR genotyping kit comprises the rapid long-fragment amplification enzyme, and also comprises a PCR reaction reagent, a PCR amplification primer and a sequencing primer.
1.2.1 preparation of PCR reaction mixture: 0.5mM deoxynucleotide (dNTP), 40mM magnesium chloride (MgCl2), 80mM potassium chloride (KCl), 60mM Tris-HCl, 1mM tetramethylammonium chloride (TMAC), glycerol 0.6% (v/v), cresol red 0.02% (v/v) and betaine 5% (v/v). Preparing 50mL of 2-star PCR reaction mixed solution according to the proportion, storing at-20 ℃ for a long time, and storing at 4 ℃ for later use.
1.2.2 preparation of amplification primer mixture:
according to KIR gene sequences published in an IMGT database, specific primers of each subtype are selected and designed in proper sequence. The designed primer sequences are entered into NCBI website (www.ncbi.nlm.nih.gov) for BLAST analysis, and adjusted by combining with other primer design software such as secondary structure between primers of Oligo analysis, and primers for detecting various types of KIR are selected.
Diluting each amplification primer to 12OD/mL, and mixing the forward primer, the reverse primer and the TE buffer solution according to the volume of 20 muL +960 muL to obtain the mixture of the amplification primers of each subtype of KIR.
TABLE 3 amplification primer mixture
Figure BDA0003594005500000091
1.2.3 preparation of sequencing primer:
diluting each sequencing primer into a stock solution of 12OD/mL, and preparing the stock solution of the sequencing primers and a TE buffer solution according to the following table to obtain a sequencing primer solution.
Figure BDA0003594005500000092
Figure BDA0003594005500000101
The sequencing primer comprises 8 universal sequencing primer groups, and the nucleotide sequence of each primer is shown in the following table:
Figure BDA0003594005500000102
Figure BDA0003594005500000111
1.3 sources of samples
1) Blood sample collection
Blood samples were collected with EDTA anticoagulated blood collection tubes, and human venous whole blood samples were used as experimental samples.
2) Nucleic acid sample extraction
Nucleic acid can be extracted from a sample containing nucleated cells such as whole blood or a layer of leukocytes by a column method to obtain a sufficient amount of nucleic acid of a quality suitable for polymerase chain reaction.
3) Nucleic acid sample quantification
The extracted nucleic acid sample was dissolved in TE solution (10mmol/L Tris-HCl, 0.1mmol/L EDTA).
4) Nucleic acid sample quality specification
The A260/A280 ratio of the nucleic acid sample should be between 1.6 and 2.0.
1.4 required Experimental Equipment
PCR amplification instrument, first generation sequencer, pipettors with different ranges, small-sized bench centrifuge and 96-well plate centrifuge.
2. Sequencing typing procedure
2.1 configuration of the reaction system: each sample needs 16 independent PCR amplification reactions, and the reaction system is prepared according to the following table:
TABLE 4 amplification reaction System
Figure BDA0003594005500000112
2.2 amplification reaction procedure: the total reaction time was about 4 hours, as shown in table 5:
TABLE 5 PCR reaction procedure
Figure BDA0003594005500000113
Figure BDA0003594005500000121
2.3 electrophoretic analysis
The PCR product was applied to a 2% agarose gel, electrophoresed at 200V for 10 to 20 minutes, photographed on an ultraviolet transilluminator, and the quality of the PCR product was confirmed.
The results are shown in FIG. 1. In fig. 1, the lanes are, from left to right: 2DL1, 2DL2, 2DL3, 2DL4, 2DL5, 2DS1, 2DS2, 2DS3, 2DS4, 2DS5, 3DL1, 3DL2, 3DL3, 3DS1, 2DP1, 3DP1 amplification products.
FIG. 1 demonstrates that the rapid long-fragment amplification enzyme of the present invention can be successfully used for amplification of KIR gene.
2.4PCR product purification (ExoSAP-IT) TM )
Add 4. mu.L of ExoSAP-IT TM To remove excess primer and DNA. The procedure was set up with reference to the table below and the purification step was started. General reactionThe time should be about 45 minutes.
TABLE 6 ExoAp PCR reaction Programming
Figure BDA0003594005500000122
2.5 sequencing reactions
The required BDT sequencing reagents were prepared according to table 7.
TABLE 7 BDT sequencing reagent volume Table
Figure BDA0003594005500000123
To each reaction well was added 1.5. mu.L of BDT sequencing reagent, 2.5. mu.L of sequencing primer, and 1. mu.L of purified PCR product. The sequencing reaction program was started in the PCR machine. The total reaction time was about 1 hour and 45 minutes.
TABLE 8 sequencing PCR reaction Programming
Figure BDA0003594005500000131
2.6 purification of sequencing products-ethanol precipitation
Excess BDT was removed by ethanol precipitation.
2.7 Pre-sequencer preparation steps
Before sequencing, 15. mu.L of HiDi formamide was added. The double-stranded DNA was denatured into single strands by treatment at 95 ℃ for 2 minutes using a PCR instrument, and then detected by a sequencer.
The sequencing results are shown in FIGS. 2-10. See the rising of sequencing map, fig. 2-10 are respectively: 8 sequencing results of sample S12 DL 1.
FIGS. 2-10 demonstrate the successful performance of KIR amplification products for continued sanger sequencing.
And (4) conclusion: the amino acid modified DNA polymerase provided by the invention can realize full-length amplification of each KIR subtype gene in a PCR reaction, and the length of the DNA polymerase is as long as 16 kb. The rapid and accurate amplification of the long fragment sequence is realized, and the full-length amplification can be realized by only one pair of primer groups of each KIR subtype, so that the KIR gene sequencing is performed more rapidly and simply.
The above description is only an example of the present invention and is not intended to limit the scope of the present invention, and all equivalent modifications made by the present invention as described in the specification of the present invention or directly or indirectly applied to other related technical fields are included in the scope of the present invention.
Sequence listing
<110> Jiangsu Weihe Biotech Co., Ltd
<120> a rapid long-fragment amplification enzyme and application thereof in KIR gene sequencing
<160> 48
<170> SIPOSequenceListing 1.0
<210> 1
<211> 25
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
aggacactag gtgtcaaatt ctagc 25
<210> 2
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
cagatttgtg gtgtgaggaa gat 23
<210> 3
<211> 17
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
ccgcctgtct gcacaga 17
<210> 4
<211> 19
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
cagcatttgg aagttccgc 19
<210> 5
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
gcaggagaca actttggatc a 21
<210> 6
<211> 24
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 6
gtgagtctga gatgtgtttt gagc 24
<210> 7
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 7
ggtgtgagga agagtgatgc t 21
<210> 8
<211> 17
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 8
tgaaggacgc gaggtgc 17
<210> 9
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 9
tgtacatggt ggtatctgtt gga 23
<210> 10
<211> 17
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 10
cgctcttgag cgagcaa 17
<210> 11
<211> 18
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 11
gggtgtcttg ggcctctc 18
<210> 12
<211> 17
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 12
cccactgggc ctcatga 17
<210> 13
<211> 19
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 13
ctcctgatgg tcctgttcg 19
<210> 14
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 14
cgccaaataa catcctgtgt 20
<210> 15
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 15
tgctcgtgga cagaagacag 20
<210> 16
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 16
cgaggtgtca attctagtga gag 23
<210> 17
<211> 18
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 17
ttgtggcgtg aggaggag 18
<210> 18
<211> 18
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 18
gatgcaaggt ggcaattg 18
<210> 19
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 19
gggcgactga tttttctctg ta 22
<210> 20
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 20
tgagacgtgt tttgagttgg tt 22
<210> 21
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 21
gcagactcac gccttcagag 20
<210> 22
<211> 19
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 22
aatttccagg aagccatgc 19
<210> 23
<211> 24
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 23
tttctctgtg tgaaaacaca gtgt 24
<210> 24
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 24
ggcctcatgc aaggtagaat 20
<210> 25
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 25
gaaaacgcag tgatccaact gta 23
<210> 26
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 26
ggttggatct gagacgtgtt gt 22
<210> 27
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 27
ttcctcacct gtgacagaaa ca 22
<210> 28
<211> 19
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 28
atctccactt ctaggccca 19
<210> 29
<211> 17
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 29
ctccacttcc aggccca 17
<210> 30
<211> 17
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 30
ttgggtgcag gtaggca 17
<210> 31
<211> 18
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 31
tcttggcagc aggtagca 18
<210> 32
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 32
gcacttgctc aaagttctca 20
<210> 33
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 33
cacagagagg aaggagagag a 21
<210> 34
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 34
cacagagagg aagcagagag a 21
<210> 35
<211> 19
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 35
cagagaggga ggagagaga 19
<210> 36
<211> 19
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 36
caggggagtg agttctcag 19
<210> 37
<211> 19
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 37
cagggcagtg agttctcag 19
<210> 38
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 38
tagataagag agtgttggcc at 22
<210> 39
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 39
tagataacag agtgttggcc at 22
<210> 40
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 40
tagataatag aaggttggcc at 22
<210> 41
<211> 19
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 41
gaaaaagcag gagaaagct 19
<210> 42
<211> 19
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 42
gagaaagcag gagaaagct 19
<210> 43
<211> 19
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 43
gagaaagcag gggaaagct 19
<210> 44
<211> 19
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 44
gagaaagcag gaggaagct 19
<210> 45
<211> 24
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 45
cagagagata gaatgtctga gtct 24
<210> 46
<211> 24
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 46
cagagagata gaatgtctgg gtct 24
<210> 47
<211> 24
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 47
cagagagatg gaatgtctga gtct 24
<210> 48
<211> 2502
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 48
atgcgtggta tgctgccgct gtttgaaccg aaaggtcgtg ttctgctggt cgacggtcat 60
catctggcat atcgtacctt tcatgcactg aaaggtctga ccaccagccg tggtgaaccg 120
gttcaggcag tttatggttt tgcaaaaagc ctgctgaaag cactgaaaga agatggtgat 180
gcagttattg ttgtttttga tgcaaaagca ccgagctttc gtcatgaagc atacggtggt 240
tataaagcag gtcgtgcacc gaccccggaa gattttccgc gtcagctggc actgattaaa 300
gaactggttg atctgctggg tctggcacgt ctggaagttc cgggttatga agcagatgat 360
gttctggcaa gcctggcaaa aaaagcagaa aaagaaggtt atgaagttcg tattctgacc 420
gcagataaag atctgtatca gctgctgagc gatcgtattc atgttctgca tccggaaggt 480
tatctgatta ccccggcatg gctgtgggaa aaatatggtc tgcgtccgga tcagtgggca 540
gattatcgtg cactgaccgg tgatgaaagc gataatctgc cgggtgttaa aggtattggt 600
gaaaaaaccg cacgtaaact gctggaagaa tggggtagcc tggaagcact gctgaaaaat 660
ctggatcgtc tgaaaccggc aattcgtgaa aaaattctgg cacacatgga tgatctgaaa 720
ctgagctggg atctggcaaa agttcgtacc gatctgccgc tggaagttga ctttgcaaaa 780
cgtcgtgaac cggatcgtga acgtctgcgt gcatttctgg aacgtctgga atttggcagc 840
ctgctgcatg aattcggtct gctggaaagc ccgaaagcac tggaagaagc accgtggccg 900
ccgccggaag gtgcatttgt tggttttgtt ctgagccgta aagaaccgat gtgggcagac 960
ctgctggcac tggcagcagc acgtggtggt cgtgttcatc gtgcaccgga accgtataaa 1020
gcactgcgtg atctgaaaga agcacgtggt ctgctggcaa aagacctgag cgttctggca 1080
ctgcgtgaag gtctgggtct gccgccgggt gatgatccga tgctgctggc atatctgctg 1140
gacccgagca ataccacccc ggaaggtgtt gcacgtcgtt atggtggtga atggaccgaa 1200
gaagcaggtg aacgtgcagc actgagcgaa cgtctgtttg caaatctgtg gggtcgtctg 1260
gaaggtgaag aacgtctgct gtggctgtat cgtgaagttg aacgtccgct gagcgcagtt 1320
ctggcacaca tggaagcaac cggtgttcgt ctggatgttg catatctgcg tgcactgagc 1380
ctggaagttg cagaagaaat tgcacgtctg gaagcagaag tttttcgtct ggcaggtcat 1440
ccgtttaatc tgaatagccg cgatcagctg gaacgtgttc tgtttgatga actgggtctg 1500
ccggcaattg gtaaaaccga aaaaaccggt aaacgtagca ccagcgcagc agttctggaa 1560
gcactgcgtg aagcacatcc gattgttgaa aaaattctgc agtatcgtga actgaccaaa 1620
ctgaaaagca cctatattga tccgctgccg gatctgattc atccgcgtac cggtcgtctg 1680
catacccgtt ttaatcagac cgcaaccgca accggtcgtc tgagcagcag cgatccgaat 1740
ctgcagaata ttccggttcg taccccgctg ggtcagcgta ttcgtcgtgc atttattgca 1800
gaagaaggtt ggctgctggt tgcactggat tatagccaga ttgaactgcg tgttctggca 1860
catctgagcg gtgatgaaaa tctgattcgt gtttttcagg aaggtcgtga tattcatacc 1920
gaaaccgcaa gctggatgtt tggtgttccg cgtgaagcag ttgatccgct gatgcgtgat 1980
gcagcaaaaa ccattaatta tggtgttctg tatggtatga gcgcacatcg tctgagccag 2040
gaactggcaa ttccgtatga agaagcacag gcatttattg aacgttattt tcagagcttt 2100
ccgaaagttc gtgcatggat tgaaaaaacc ctggaagaag gtcgtcgtcg tggttatgtt 2160
gaaaccctgt ttggtcgtcg tcgttatgtt ccggatctgg aagcacgtgt taaaagcgtt 2220
cgtgaagcag cagaacgtat ggcatttaat atgccggttc agggtaccgc agccgatctg 2280
atgaaactgg caatggttaa actgtttccg cgtctggaag aaatgggtgc acgtatgctg 2340
ctgcaggttc atgatgaact ggttctggaa gcaccgaaag aacgtgcaga agcagttgca 2400
cgtctggcaa aagaagttat ggaaggtgtt tatccgctgg cagttccgct ggaagttgaa 2460
gttggtattg gtgaagattg gctgagcgca aaagaactcg ag 2502

Claims (7)

1. A rapid-growth-fragment-amplifying enzyme which is a DNA polymerase capable of rapidly amplifying a growth fragment modified with an amino acid sequence, wherein the modified DNA polymerase is mutated, as compared with the amino acid sequence of an unmodified DNA polymerase, as follows: leucine L at the 145 th site is mutated into glutamine Q, valine V at the 719 th site is mutated into asparagine N, and the nucleotide sequence of the coding gene of the rapid long fragment amplification enzyme is shown as SEQ ID NO 48.
2. Use of the rapid-growth-fragment-amplifying enzyme according to claim 1 for preparing a KIR gene sequencing reagent.
3. A KIR genotyping kit comprising the rapid long fragment amplification enzyme of claim 1, further comprising PCR reaction reagents, PCR amplification primers, and sequencing primers.
4. The kit of claim 3, wherein the PCR reaction reagents comprise: 0.5mM deoxynucleotide dNTP, 40mM magnesium chloride MgCl2, 80mM potassium chloride KCl, 60mM Tris-HCl, 1mM TMAC, 0.6% v/v glycerol, 0.02% v/v cresol red and 5% v/v betaine.
5. The kit of claim 3, wherein the PCR primers are PCR primers and sequencing primers for detecting 16 common genes of human natural killer cell immunoglobulin-like receptor KIR, and the 16 genes comprise 14 functional genes of KIR such as 2DL1, 2DL2, 2DL3, 2DL4, 2DL5, 2DS1, 2DS2, 2DS3, 2DS4, 2DS5, 3DL1, 3DL2, 3DL3 and 3DS1, and 2 pseudogenes such as 2DP1 and 3DP 1.
6. The kit of claim 5, wherein the PCR amplification primers comprise 16 specific amplification primer sets, and each specific amplification primer set comprises primer pairs with nucleotide sequences shown in the following table:
Figure FDA0003594005490000011
Figure FDA0003594005490000021
7. the kit of claim 5, wherein the sequencing primers comprise 8 universal sequencing primer sets, each primer having a nucleotide sequence as shown in the following table:
Figure FDA0003594005490000022
Figure FDA0003594005490000031
CN202210384065.5A 2022-04-13 2022-04-13 Rapid long-fragment amplification enzyme and application thereof in KIR gene sequencing Pending CN114807083A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202210384065.5A CN114807083A (en) 2022-04-13 2022-04-13 Rapid long-fragment amplification enzyme and application thereof in KIR gene sequencing

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202210384065.5A CN114807083A (en) 2022-04-13 2022-04-13 Rapid long-fragment amplification enzyme and application thereof in KIR gene sequencing

Publications (1)

Publication Number Publication Date
CN114807083A true CN114807083A (en) 2022-07-29

Family

ID=82534178

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202210384065.5A Pending CN114807083A (en) 2022-04-13 2022-04-13 Rapid long-fragment amplification enzyme and application thereof in KIR gene sequencing

Country Status (1)

Country Link
CN (1) CN114807083A (en)

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20200291455A1 (en) * 2019-03-13 2020-09-17 Abclonal Science, Inc. Mutant Taq Polymerase for Faster Amplification
CN111996179A (en) * 2020-08-21 2020-11-27 成都汇瑞新元生物科技有限责任公司 DNA polymerase and application thereof in PCR detection
CN113316636A (en) * 2018-12-20 2021-08-27 深圳华大生命科学研究院 DNA polymerase with improved enzymatic activity and use thereof

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN113316636A (en) * 2018-12-20 2021-08-27 深圳华大生命科学研究院 DNA polymerase with improved enzymatic activity and use thereof
US20200291455A1 (en) * 2019-03-13 2020-09-17 Abclonal Science, Inc. Mutant Taq Polymerase for Faster Amplification
CN113597468A (en) * 2019-03-13 2021-11-02 武汉爱博泰克生物科技有限公司 Mutant Taq polymerase for Rapid amplification
CN111996179A (en) * 2020-08-21 2020-11-27 成都汇瑞新元生物科技有限责任公司 DNA polymerase and application thereof in PCR detection

Similar Documents

Publication Publication Date Title
US8551707B2 (en) Nucleic acid-based tests for RhD typing, gender determination and nucleic acid quantification
CN1332805A (en) Multiplex amplification of short tandem repeat loci
CN110541033B (en) Composition for EGFR gene mutation detection and detection method
CN1257985C (en) Method for detection of susceptibility mutations for ototoxic deafness
Aldridge et al. Denaturing gradient gel electrophoresis: a rapid method for differentiating BoLA‐DRB3 alleles
CN112592981B (en) Primer group, kit and method for DNA archive construction
Iida et al. Identification and characterization of two novel human polymorphic STRs on the Y chromosome
CN108753952A (en) A kind of gene parting detecting reagent for 10 common mutations sites of mankind SLC25A13 genes
CN114807083A (en) Rapid long-fragment amplification enzyme and application thereof in KIR gene sequencing
RU2558231C2 (en) Method, test-system and primers for determination of haplogroups of human y-chromosome
CN113943789B (en) Multiple PCR method, primers and kit for genotyping of human red blood cell blood type antigen system
CN110257505B (en) Non-deletion α thalassemia point mutation rapid detection kit and detection method
TW202214874A (en) Rapid method for genotyping sting variants in human individuals
TWI417545B (en) Methods and kits for genotyping molecular markers in pigs
CN111411149A (en) Primer group, kit and method for detecting gene mutation of hypertrophic cardiomyopathy
CN117512085B (en) Primer group and kit for detecting HLA-DPB1 genotyping
KR101326159B1 (en) Method for Discriminating Between Seriola quinqueradiata and Seriola lalandi and a Kit Therefor
KR101150707B1 (en) KIR (killer cell immunoglobulin-like receptor) typing method using TotalPlex PCR amplification
TWI707864B (en) Oligonucleotide microarray for detection of canine mdr1 gene mutations and determination method thereof and method for determination of the risk of chemotherapy side effects to a subject
Spierings Molecular typing methods for minor histocompatibility antigens
CN113862342A (en) Primer group, probe, kit and method for detecting HLA-DR13 gene
Chida et al. Haplotype-specific sequence encoding the protein kinase, interferon-inducible double-stranded RNA-dependent activator in the human leukocyte antigen class II region
CN110904218A (en) Primer group, kit and method for detecting familial mediterranean fever monogenic diseases
CN117925802A (en) Primer composition for HLA-I and HPA multiplex PCR, application and genotyping method
CN117210551A (en) ARMS-PCR primer combination and kit for detecting 10 bovine genetic defect genes

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination