KR101150707B1 - KIR (killer cell immunoglobulin-like receptor) typing method using TotalPlex PCR amplification - Google Patents

Abstract

The present invention relates to a method for identifying the genotype of an immunoglobulin-like receptor (KIR) of human killer cells. The method uses a sequence common to all KIR types as a primer to simultaneously amplify a number of different KIR template genes simultaneously (a first PCR), a gene using a sequence specific to each KIR type as a primer Amplifying (secondary PCR), and identifying the KIR genotype of the subject by analyzing the amplified KIR gene by bead array and the like.

Immunoglobulin-like receptor, killer cell immunoglobulin-like receptor, multiple gene co-amplification, bead array, SBS primer

Description

Killer cell immunoglobulin-like receptor (KIR) typing method using TotalPlex PCR amplification}

The present invention relates to a method for identifying genotypes of Killer cell immunoglobulin-like receptors (KIR) of human killer cells using multiple gene amplification techniques. More specifically, the present invention is different from the conventional method of performing electrophoresis and probe hybridization separately, multiple hybridization of multiple probes in one tube at the same time to amplify multiple times in one reaction, and thus the hybridization reaction probe Is a genotyping method that analyzes at a time using bead layers and the like.

Natural killer cells (NK cells) are mononuclear cells derived from lymphocyte precursors and developing in the bone marrow. It has the ability to bind to and kill some types of tumor cells without the need for prior immunization or activation. Killer cell immunogloblin-like receptors (KIR) located on the surface of natural killer cells suppress the role of natural killer cells and prevent them from attacking healthy cells. KIR recognizes autologous cells through interaction with the Human Leukocyte antigen (HLA) and is a very complex combination. KIR is located in the 100-200 kb region of Leukocyte receptor complex (LRC) of chromosome 19 and consists of a total of 15 true genes and two pseudo genes. The KIR gene has a length of about 4-16 kb with 4 to 9 exons, and can be classified into three types according to which domain. Type 1 is divided into a protein consisting of domain 1 and domain 2, type 2 is divided into a protein consisting of domain 5, domain 4, type 3 is composed of three proteins consisting of domains 0, 1, 2. The diversity of these KIR genes has been reported with 17 genes and 119 alleles. Each of the 17 genes is divided into 2 A haplotypes and 17 B haplotypes, and the KIR genes are further divided into 34 haplotypes. In addition, the nomenclature for KIR is the number of extracellular domains (KIR2D and KIR3D having two and each of the other three cell lg- domain) and the tail of the cytoplasmic is long (L ong) (KIR2DL or KIR3DL) or short paper (S hort) (KIR2DS or KIR3DS).

KIR, which has such complex structure and characteristics, analyzes it and confirms this KIR genotype, as shown only in the HLA type, which previously performed autoimmune response during bone marrow transplantation and organ transplantation. In spite of its inadequate association with the genetic metastasis of cancer-related diseases (such as the correlation between liver cancer virus and KIR genotype-Lopez-Vazquez AJ et al. Infect Dis. 2005 Jul 1; 192 (1): 162-5 The importance of KIR genotyping is becoming more and more emphasized in recent years, as it is possible to understand the possibility of disease and predict the onset of disease.

The link between KIR and disease has not yet been established, but the future market is expected to be larger than the tissue compatibility market. However, it is now more likely to be used in transplantation, and as mentioned above, it is increasingly important in the field of identifying HLA types for identifying immune responses.

The identification of KIR genotypes is at a developmental level that has not yet been activated. Initially, ELISA methods using antibodies were mainly used, but currently, methods using PCR-SSP (sequence specific primer) or PCR-SSOP (sequence specific oligonucleotide probe) are the most widely used in the market (Tissue Antigens, 70). : 415-422, 2007; Exp. Gerontol., 39: 1223-1232, 2004; Tissue Antigens, 56: 313-326, 2000). However, in both ELISA, PCR-SSP, and PCR-SSOP methods, multiple analyzes are difficult, and each type requires a separate experiment. Therefore, in Korea, KIR genotyping is carried out on a small scale only in some university hospitals, and development of a kit using a method of multi-amplifying and analyzing genes is not in progress. Research and development using beads is known to be carried out only by some foreign companies (one lambda etc.). This technology is still in its infancy.

As the method using bead array is very simple to use and excellent in reproducibility, it may be a method to replace the existing micro array. In particular, if the existing microarrays were suitable for analyzing a large number of genes at once and finding some meaningful ones, bead arrays have a limited number of analyzes (total 100 can be analyzed). It is not suitable for screening all at once, but it is optimized for easy, quick and accurate analysis of several meaningful ones.

An object of the present invention is to provide a method for easily identifying the genotype of KIR using multiple gene amplification techniques. More specifically, amplify all 16 KIR genotypes through primary PCR in one tube, perform secondary labeling PCR on the amplified 16 genotypes in another tube, and analyze the amplification products by bead array. To provide a method for identifying KIR genotypes quickly and accurately.

In order to achieve the above object, the present invention provides a method for identifying the genotype of the KIR gene of a subject,

(i) A common base sequence located at exon 4 and exon 5 of the KIR gene was prepared as a primer for primary PCR, and the primer mixture was used as a primer for primary PCR. Amplifying exon 4 and exon 5 sites of the KIR gene by performing a primary PCR using as a template;

(ii) preparing a sequence specific for a specific KIR type as a primer for secondary PCR, using the primer mixture as a primer for secondary PCR, and performing secondary PCR using the amplified PCR product as a template; And

(iii) analyzing the amplification products obtained by the PCR reaction to identify the genotype of the KIR gene provides a method for genotyping the KIR gene.

Primer for the first PCR (primer) of the step (i), but is not limited thereto, preferably a primer mixture consisting of primers from SEQ ID NO: 1 to SEQ ID NO: 8. The inventors analyzed DNA sequences for all 16 KIR genotypes in order to use multiple gene amplification techniques to perform PCR reactions at once, and find common sequence pairs of length suitable to set as primers for PCR reactions. It became. These primers may be sequences identical or complementary to the consensus sequence, and may have a "bulge" portion to increase efficiency, such as a "TTTT" sequence located in the middle of SEQ ID NO: 1 to SEQ ID NO: 4 . As shown in Figure 3, in the case of 2DP1 and 3DS1 primers were prepared from the common sequence in exon 4. Unless the KIR genotype of the subject to be identified can be predicted, it is preferable to use a mixture of all primers of SEQ ID NO: 1 to SEQ ID NO: 8 so as to be able to identify all 16 KIR genotypes. However, for the efficiency of PCR reaction, it is necessary to distinguish and react exon 4 and exon 5. Therefore, for exon 5, PCR reaction is performed using any one or more primer set combinations selected from the group consisting of SEQ ID NO: 1 and SEQ ID NO: 2, SEQ ID NO: 1 and SEQ ID NO: 3, and combinations of SEQ ID NO: 1 and SEQ ID NO: 4 Preferably, the exon 4 is preferably subjected to a PCR reaction using a primer set consisting of SEQ ID NO: 5 and SEQ ID NO: 6 and / or SEQ ID NO: 7 and SEQ ID NO: 8.

The primer for secondary PCR in step (ii) is not limited thereto, but may be any one or more primers selected from the group consisting of primers SEQ ID NO: 9 to SEQ ID NO: 24. We found sequence sites that were specific for each of the 16 KIR genotypes and made that site a specific primer sequence capable of labeling each genotype. The secondary PCR primers SEQ ID NO: 9 to SEQ ID NO: 24 is designed to be amplified only in one direction, but can be set to enable bidirectional amplification as necessary.

The step of analyzing the amplification product obtained by the PCR reaction in the identification method, but is not limited to this, the hybridization reaction of the probe-target using bead array or microarray (northern blot, southern blot, allele specific primer PCR, etc. Preferably). More preferably, the analyzing step comprises labeling the gene amplification product with biotin-dNTP (dATP, dGTP, dTTP or dCTP); Binding the labeled gene amplification products to beads that specifically bind to each of the KIR genotype types; And analyzing the results using the bead array analyzer.

There are two main techniques used in the present invention, a multi-amplification technique (TotalPlex) for simultaneously amplifying a desired gene and a technique for accurately determining the type of a multi-amplified gene (ASPE, bead array). The assay according to the present invention is very advantageous in terms of saving reagents, time, labor, and samples since all reactions are possible in one tube, and using techniques such as multiple gene amplification. In addition, the bead array system is currently configured in a 96-well type format, and it takes about one minute to analyze one sample, which is advantageous in mass analysis. Using multiplex technology, time can be reduced to one day, and the amount of genes to be analyzed can be as low as 100 ng in total, and less than 20% of conventional methods can be analyzed considering various reagents and labor. It is expected. In addition, the identification method according to the present invention is expected to be applied not only to KIR, but also to pharmacogenomics for the examination of various genetic diseases and customized medicine.

Hereinafter, the contents for the implementation of the present invention through specific examples. However, the scope of the present invention is not limited by the following examples.

Example  One. Liquid Bead  With array KIR  Genotyping

The development of a KIR genotyping kit using a liquid bead array is generally a five step process (FIG. 2).

1. Gene Amplification (Exon 4 and Exon 5 Sites of the KIR Gene)

2. Activation Step

3. Labeling of ASPE primers with biotin-dCTP as a template of amplified gene product using ASPE (Allele specific primer extension) method

4. Hybridization reaction between labeled genotyping probe and bead probe

5. Analysis and interpretation of results using bead array analyzer

 In this embodiment, a single polymerase chain reaction can amplify a plurality of genes, and each of the genes used as a template and primers capable of complementarily binding to each of them can specifically bind. Many genes can be amplified by one polymerase chain reaction, and the specific selectivity of the primers for the template genes is improved, and the technology for analyzing KIR genotypes using SBS primer manufacturing technology of YBTI Co., Ltd. has been prepared. . This analysis yielded concordant results when analyzed using eight human cell lines (FIG. 4, Example 2).

The multi-gene simultaneous amplification method of the present invention comprises the steps of: (i) selecting each region to be amplified from 2 to 30 target genes (FIG. 3); ( ii ) determine a base sequence capable of complementarily binding to the base sequence at the 5 'end of each of the selected sites, wherein the base sequence of 2 to 4bp located at the center of the determined base sequence is 5 to 8bp of dNTP sequence Preparing 2 to 30 sense primers, substituted with; ( iii ) a base sequence capable of complementarily binding to the base sequence at the 3 'end of each selected site is determined, and the base sequence of 2 to 4bp located at the center of the determined base sequence is 5 to 8bp of dNTP base. Preparing 2 to 30 antisense primers, substituted by sequence (FIG. 5); ( iv ) mixing two to thirty target genes with each of the above-described two to thirty sense primers and antisense primers corresponding to the corresponding target genes, and performing one polymerase chain reaction using the mixture. step; And (v) identifying the amplified product obtained by the electropolymerase chain reaction. At this time, the temperature and time conditions in the polymerase chain reaction are not particularly limited. In addition, the identification of the obtained amplification product is not particularly limited thereto, but may be performed by a hybridization method using a bead array. However, a method such as a microarray may be used, and a method of Southern blotting using a specific KIR genotyping probe used for each hybridization reaction, and each type using a specific allele specific primer PCR and amplified primary PCR products can be identified at a glance through PCR-RFLP using a restriction enzyme that exactly matches a specific sequence.

The base sequences of the SBS primer (primary PCR primer) and the specific primer (primary PCR primer) used in the polymerase chain reaction are shown in Table 1 below.

List of primers used in the polymerase chain reaction of the present invention <1st PCR Primer List> SEQ ID NO: name Sequence (5 'to 3') One KIR exon 5 F agagcaggggagtTTTTgttctcagctcaggt (SEQ ID NO: 1) 2 KIR exon 5 R cctgtgacagaaacTTTTgcagtgggtcact (SEQ ID NO: 2) 3 KIR exon 5 R ' cctgtgacggaaacTTTTgcagtggatcact (SEQ ID NO: 3) 4 2dp1,3dp1 R ' ggaaagagccgaag TTTT tctgtaggtkcctcc (SEQ ID NO: 4) 5 2DP1 F CAA TGT TGG TCA GAT GTC ATG (SEQ ID NO: 5) 6 2DP1 R GTA GGT CCC TGC CAG GTC TTC (SEQ ID NO: 6) 7 3DS1 F TGG ATC TCT AAG GAC CCC T (SEQ ID NO: 7) 8 3DS1 R AGC TGA CAA CTG ATA GGG GGT (SEQ ID NO: 8) <2nd Labeling Primer List> SEQ ID NO: name Sequence (5 'to 3') 9 PCP 2DL1 ctacaaacaaacaaacattatcaa CCACTCGTATGGAGAGTCAT (SEQ ID NO: 9) 10 PCP 2DL2 tgatgtttgattatgatgtagtat GCCCTGCAGAGAACCTACA (SEQ ID NO: 10) 11 PCP 2DL3 cttttcatcttttcatctttcaat C CCT GCA GAG AAC CTA CG T (SEQ ID NO: 11) 12 PCP 2DL4 aatctacaaatccaataatctcat CCRGGCCGGGCTGTAAGC (SEQ ID NO: 12) 13 PCP 2DL5 aatcttactacaaatcctttcttt CCGGCTGGGCTGAGAGT (SEQ ID NO: 13) 14 PCP 2DP1 tcatttcaatcaatcatcaacaat ATC ATG GTG CTC TCC AGT GA (SEQ ID NO: 14) 15 PCP 2DS1 caattcaaatcacaataatcaatc CAT CTG TAG GTC CCT CCA (SEQ ID NO: 15) 16 PCP 2DS2 ttacctttatacctttctttttac TCACGCTCTCTCCTGCCAA (SEQ ID NO: 16) 17 PCP 2DS3 tcatcaatcaatctttttcacttt AGCATCTGTAGGTTCCTCCT (SEQ ID NO: 17) 18 PCP 2DS4 tacactttctttctttctttcttt TGGAATGTTCCGTKGATGC (SEQ ID NO: 18) 19 PCP 2DS5 tcataatctcaacaatctttcttt CCC TCC GTG GGT GGC AGG GT (SEQ ID NO: 19) 20 PCP 3DL1 tacatcaacaattcattcaataca AGAGAGAAGGTTTCTCATATG (SEQ ID NO: 20) 21 PCP 3DL2 atgagtatgttattagtgtatgta TGACCACACGCAGGGCAG (SEQ ID NO: 21) 22 PCP 3DL3 tcaaaatctcaaatactcaaatca GGATAGATGGTAAATGTCAAACA (SEQ ID NO: 22) 23 PCP 3DP1 caattaactacatacaatacatac TGAGAGAGAAGGTTTCCCAC (SEQ ID NO: 23) 24 PCP 3DS1 tcaacaatcttttacaatcaaatc AAG GGC ACG CAT CAT GGA (SEQ ID NO: 24)

By using the multi-gene simultaneous amplification method of the present invention, 16 types of KIR can be amplified by only one polymerase chain reaction, and thus it will be used for diagnosis of diseases and diseases caused by genotype modification of KIR, and researches related to genes It can contribute to the progress of development.

Example  2: in the gene of a human cell line KIR  Genotyping

4 μL of genome DNA of 8 human cell lines (50 ng / μL), 10 × polymerase chain reaction buffer (750 mM Tris-HCl, pH 9.0), 20 mM MgCl ₂ , 500 mM KCl, 200 mM (NH ₄ ) ₂ SO ₄ ,) 2 μl, 2.5 mM dNTP mixture (2.5 mM dATP, 2.5 mM dGTP, 2.5 mM dTTP, 2.5 mM dCTP) 2 μl, Taq polymerase (Biotools, Spain) 1.5 unit primer mixture (0.5 μM) and SBS primer mixture (0.5) [mu] M) is mixed and the mixture is titrated with 20 mu l of distilled water, followed by polymerase chain reaction. This process is a one-step process, the conditions of the polymerase chain reaction is carried out 35 cycles under the conditions of 5 minutes at 94 ℃, 20 seconds at 94 ℃, annealing temperature 57 ℃ 40 seconds, 72 ℃ 2 minutes, After termination, the amplified sections are electrophoresed on 1.5% (w / v) agarose gel (FIG. 6). In FIG. 6, lane 1 is negative control and lanes 5 to 13 are amplified by 8 human cell lines. It can be seen that it is specifically amplified in EXON 5 and EXON 4 of the KIR genotype.

In the two-step process, 0.8 µl of activation buffer and 3 µl of distilled water were added to 0.4 µl of activation enzyme EXON5 and EXON4, respectively, and 8 µl of solution was reacted at 37 ° C for 1 hour and 85 ° C for 15 minutes. Step. The activation step is a process of removing primers or dNTPs remaining after the first PCR reaction in order to increase the efficiency of the second PCR.

As a third step, a polymerase chain reaction for labeling the gene amplification product was performed using 8 µl of the activation product. The gene-labeled polymerase chain reaction was carried out in a buffer solution (750 mM Tris-HCl (pH 9.0), 20 mM MgCl ₂ , 500 mM KCl, 200 mM (NH ₄ ) ₂ SO ₄ ,) 2 μl, 1 mM dAGT mixture (1 mM dATP, 1 mM dGTP, 1 μl of 1 mM dTTP), 1 μl of 10 μM dCTP, 0.25 μl of 0.4mM biotin-labeled dCTP, 1 unit of Taq polymerase (Biotools, Spain) and a mixture of primers (0.5 μM) were added. After titration, polymerase chain reaction is performed. The polymerase chain reaction was carried out for 35 cycles under the conditions of 5 minutes at 94 ° C, 30 seconds at 94 ° C, annealing temperature of 57 ° C for 1 minute, and 72 ° C for 2 minutes.

The 4 step process is the bead binding process of the labeled gene amplification product. 21 μl of 2X hybridization solution (0.4M NaCl, 0.2M Tris (pH 8.0), 0.16% TritonX-100) in 20μl of the gene-labeled polymerase chain reaction product. 1 μl of the bead mixture that will specifically bind to type 16 KIR genotype is allowed to react. The reaction proceeds at 94 ° C for 10 minutes and at 37 ° C for 30 minutes. Transfer the reaction product bound to the beads to a 96well filter plate and wash with 160 μl three times with washing buffer (0.4M NaCl, 0.2M Tris (pH 8.0), 0.16% TritonX-100).

The 5-step process is a result of analysis and interpretation using a bead array analyzer (Luminex Corp., Luminex 100 or Luminex 200, or BioRad Bioplex, etc.) of the reaction product combined with beads.0.2 μl Streptavidin-PE was added to 100 μl of washing solution. Dilute to react with the gene label product bound to the beads. The bead array analyzer separately reads 16 types of KIR genotypes bound to each bead, and expresses the sensitivity of each genotype as a mean of fluorescence intensity (MFI). The results are averaged for each type of MFI values that are negative (there are no KIR-type genotypes), and the cutoff is determined by adding three times the standard deviation (Mean + 3Stdev). Based on this analysis, the results are interpreted (FIG. 1).

Example  3: in the human genome KIR  Genotyping

Even in 2 μl (50ng / μl) of human genome DNA, 16 types of KIR genotypes could be analyzed by the same chain reaction as in Example 1, and the reaction could be analyzed even with less than 10ng of human genome DNA.

4 μl of human genome DNA, 10 × polymerase chain buffer buffer (750 mM Tris-HCl, pH 9.0), 20 mM MgCl ₂ , 500 mM KCl, 200 mM (NH ₄ ) ₂ SO ₄ ,) 2 μl, 2.5 mM Mix 2 μl of dNTP mixture (2.5 mM dATP, 2.5 mM dGTP, 2.5 mM dTTP, 2.5 mM dCTP), a mixture of Taq polymerase (Biotools, Spain) 1.5 unit primer (0.5 μM) and a mixture of SBS primers (0.5 μM) After tertiary distilled water was added, the mixture was titrated with 20 µl, and a polymerase chain reaction was performed. At this time, the conditions of the polymerase chain reaction was carried out for 35 cycles under the conditions of 5 minutes at 94 ℃, 20 seconds at 94 ℃, annealing temperature 57 ℃ 40 seconds, 72 ℃ 2 minutes, and after the reaction was completed, amplified fragments Was electrophoresed on 1.5% (w / v) agarose gel (FIG. 6). Lane 1 of Figure 6 is a negative control and lanes 2 to 5 are the products of amplified human genome samples obtained from oral cells. As a result, it can be seen that it is specifically amplified in EXON5 and EXON4.

In the two-step process, the amplification products EXON5 and EXON4 were added to 0.8 µl of activation buffer and 3 µl of distilled water to 0.4 µl of activating enzyme, respectively. Go through.

As a third step, a polymerase chain reaction for labeling the gene amplification product was performed using 8 µl of the activated product. The gene-labeled polymerase chain reaction was carried out in a buffer solution (750 mM Tris-HCl (pH 9.0), 20 mM MgCl ₂ , 500 mM KCl, 200 mM (NH ₄ ) ₂ SO ₄ ,) 2 μl, 1 mM dAGT mixture (1 mM dATP, 1 mM dGTP, 1 μl of 1 mM dTTP), 1 μl of 10 μM dCTP, 0.25 μl of 0.4mM biotin-labeled dCTP, 1 unit of Taq polymerase (Biotools, Spain) and a mixture of primers (0.5 μM) were added. After titration, polymerase chain reaction is performed. The polymerase chain reaction was carried out for 35 cycles under the conditions of 5 minutes at 94 ° C, 30 seconds at 94 ° C, annealing temperature of 57 ° C for 1 minute, and 72 ° C for 2 minutes.

The 4 step process is the bead binding process of the labeled gene amplification product. 21 μl of 2X hybridization solution (0.4M NaCl, 0.2M Tris (pH 8.0), 0.16% TritonX-100) in 20μl of the gene-labeled polymerase chain reaction product. 1 μl of the bead mixture that will specifically bind to type 16 KIR genotype is allowed to react. The reaction proceeds at 94 ° C for 10 minutes and at 37 ° C for 30 minutes. Transfer the reaction product bound to the beads to a 96well filter plate and wash three times with 160 μl in wash buffer (0.4M NaCl, 0.2M Tris (pH 8.0), 0.16% TritonX-100).

The 5-step process is a result of analyzing and interpreting the reaction product bound to the beads using a bead array analyzer. The 0.2 μl Streptavidin-PE is diluted in 100 μl of the washing solution and reacted with the gene label product bound to the beads. The 16 types of KIR genotypes bound to each bead are read by a bead array analyzer, and the sensitivity of each genotype is expressed as mean of fluorescence intensity (MFI). The results are averaged for each type of MFI values that are negative (there are no KIR-type genotypes), and the cutoff is determined by adding three times the standard deviation (Mean + 3Stdev). Based on this analysis, the results are interpreted (FIG. 1).

1 shows KIR genotyping results according to an embodiment of the present invention.

Figure 2 is a flow chart of the KIR genotyping method using the multiple gene simultaneous amplification method and bead array in accordance with the present invention.

Figure 3 is a table summarizing the positions on the KIR sequence of the consensus primers used for simultaneous multiplex amplification of the present invention.

 4 is a table showing the results of analyzing the KIR type using eight human cell lines. The subtypes of KIR are labeled POS and the ones not labeled NEG.

5 is an exemplary diagram showing the preparation of the KIR genotype 2DL5 and 2DS2 ASPE primer used in the secondary PCR of the present invention.

6 is an exemplary result confirmed by electrophoresis after each of the exon 5 and exon 4 site-specific primary PCR amplification using the primer set used in the present invention.

<110> YeBT <120> KIR typing method using TotalPlex PCR amplication <160> 24 <170> KopatentIn 1.71 <210> 1 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> KIR exon 5 F <400> 1 agagcagggg agtttttgtt ctcagctcag gt 32 <210> 2 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> KIR exon 5 R <400> 2 cctgtgacag aaacttttgc agtgggtcac t 31 <210> 3 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> KIR exon 5 R ' <400> 3 cctgtgacgg aaacttttgc agtggatcac t 31 <210> 4 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> 2dp1,3dp1 R ' <400> 4 ggaaagagcc gaagtttttc tgtaggtkcc tcc 33 <210> 5 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> 2DP1 F <400> 5 caatgttggt cagatgtcat g 21 <210> 6 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> 2DP1 R <400> 6 gtaggtccct gccaggtctt c 21 <210> 7 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> 3DS1 F <400> 7 tggatctcta aggacccct 19 <210> 8 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> 3DS1 R <400> 8 agctgacaac tgataggggg t 21 <210> 9 <211> 44 <212> DNA <213> Artificial Sequence <220> <223> PCP 2DL1 <400> 9 ctacaaacaa acaaacatta tcaaccactc gtatggagag tcat 44 <210> 10 <211> 43 <212> DNA <213> Artificial Sequence <220> <223> PCP 2DL2 <400> 10 tgatgtttga ttatgatgta gtatgccctg cagagaacct aca 43 <210> 11 <211> 43 <212> DNA <213> Artificial Sequence <220> <223> PCP 2DL3 <400> 11 cttttcatct tttcatcttt caatccctgc agagaaccta cgt 43 <210> 12 <211> 42 <212> DNA <213> Artificial Sequence <220> <223> PCP 2DL4 <400> 12 aatctacaaa tccaataatc tcatccrggc cgggctgtaa gc 42 <210> 13 <211> 41 <212> DNA <213> Artificial Sequence <220> <223> PCP 2DL5 <400> 13 aatcttacta caaatccttt ctttccggct gggctgagag t 41 <210> 14 <211> 44 <212> DNA <213> Artificial Sequence <220> <223> PCP 2DP1 <400> 14 tcatttcaat caatcatcaa caatatcatg gtgctctcca gtga 44 <210> 15 <211> 42 <212> DNA <213> Artificial Sequence <220> <223> PCP 2DS1 <400> 15 caattcaaat cacaataatc aatccatctg taggtccctc ca 42 <210> 16 <211> 43 <212> DNA <213> Artificial Sequence <220> <223> PCP 2DS2 <400> 16 ttacctttat acctttcttt ttactcacgc tctctcctgc caa 43 <210> 17 <211> 44 <212> DNA <213> Artificial Sequence <220> <223> PCP 2DS3 <400> 17 tcatcaatca atctttttca ctttagcatc tgtaggttcc tcct 44 <210> 18 <211> 43 <212> DNA <213> Artificial Sequence <220> <223> PCP 2DS4 <400> 18 tacactttct ttctttcttt cttttggaat gttccgtkga tgc 43 <210> 19 <211> 44 <212> DNA <213> Artificial Sequence <220> <223> PCP 2DS5 <400> 19 tcataatctc aacaatcttt ctttccctcc gtgggtggca gggt 44 <210> 20 <211> 45 <212> DNA <213> Artificial Sequence <220> <223> PCP 3DL1 <400> 20 tacatcaaca attcattcaa tacaagagag aaggtttctc atatg 45 <210> 21 <211> 42 <212> DNA <213> Artificial Sequence <220> <223> PCP 3DL2 <400> 21 atgagtatgt tattagtgta tgtatgacca cacgcagggc ag 42 <210> 22 <211> 47 <212> DNA <213> Artificial Sequence <220> <223> PCP 3DL3 <400> 22 tcaaaatctc aaatactcaa atcaggatag atggtaaatg tcaaaca 47 <210> 23 <211> 44 <212> DNA <213> Artificial Sequence <220> <223> PCP 3DP1 <400> 23 caattaacta catacaatac atactgagag agaaggtttc ccac 44 <210> 24 <211> 42 <212> DNA <213> Artificial Sequence <220> <223> PCP 3DS1 <400> 24 tcaacaatct tttacaatca aatcaagggc acgcatcatg ga 42  

Claims (5)

As a method of identifying the genotype of the subject's KIR gene, (i) any one or more primer set combinations selected from the group consisting of SEQ ID NO: 1 and SEQ ID NO: 2, SEQ ID NO: 1 and SEQ ID NO: 3, and combinations of SEQ ID NO: 1 and SEQ ID NO: 4; Or by using a primer mixture consisting of a primer set combination consisting of SEQ ID NO: 5 and SEQ ID NO: 6 or SEQ ID NO: 7 and SEQ ID NO: 8 as a primer for primary PCR, and performing primary PCR using the genome DNA of the subject as a template Amplifying exon 4 and exon 5 sites of the KIR gene; (ii) using at least one primer selected from the group consisting of primers SEQ ID NO: 9 to SEQ ID NO: 24 as a primer for secondary PCR, and performing secondary PCR using the amplified PCR product as a template; And (iii) identifying the genotype of the KIR gene by analyzing the amplification products obtained by the PCR reaction. The method of claim 1, wherein performing the secondary PCR of (ii) comprises preparing a sequence specific to a specific KIR type as a primer for secondary PCR, using the primer mixture as a primer for secondary PCR, The amplified primary PCR product is a template, and the second PCR is performed using biotin-dNTP to label the gene amplification product with biotin-dNTP, and the amplification product obtained by the PCR reaction in the above (iii). Analyzing may include binding the labeled gene amplification products to beads specifically binding to each of the KIR genotypes; And analyzing the result using a bead array analyzer. delete delete delete

Images