CN114806903B - Trichoderma reesei engineering strain with synchronously improved cellulase expression and secretion capacity and construction and application thereof - Google Patents

Trichoderma reesei engineering strain with synchronously improved cellulase expression and secretion capacity and construction and application thereof Download PDF

Info

Publication number
CN114806903B
CN114806903B CN202210581356.3A CN202210581356A CN114806903B CN 114806903 B CN114806903 B CN 114806903B CN 202210581356 A CN202210581356 A CN 202210581356A CN 114806903 B CN114806903 B CN 114806903B
Authority
CN
China
Prior art keywords
strain
trichoderma reesei
cellulase
sec63
expression
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN202210581356.3A
Other languages
Chinese (zh)
Other versions
CN114806903A (en
Inventor
钟耀华
沈林静
钱远超
刘红
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Shandong University
Original Assignee
Shandong University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Shandong University filed Critical Shandong University
Priority to CN202210581356.3A priority Critical patent/CN114806903B/en
Publication of CN114806903A publication Critical patent/CN114806903A/en
Application granted granted Critical
Publication of CN114806903B publication Critical patent/CN114806903B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/37—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from fungi
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/14—Fungi; Culture media therefor
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/66—General methods for inserting a gene into a vector to form a recombinant vector using cleavage and ligation; Use of non-functional linkers or adaptors, e.g. linkers containing the sequence for a restriction endonuclease
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/80—Vectors or expression systems specially adapted for eukaryotic hosts for fungi
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/24—Hydrolases (3) acting on glycosyl compounds (3.2)
    • C12N9/2402—Hydrolases (3) acting on glycosyl compounds (3.2) hydrolysing O- and S- glycosyl compounds (3.2.1)
    • C12N9/2405—Glucanases
    • C12N9/2434—Glucanases acting on beta-1,4-glucosidic bonds
    • C12N9/2437—Cellulases (3.2.1.4; 3.2.1.74; 3.2.1.91; 3.2.1.150)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P19/00—Preparation of compounds containing saccharide radicals
    • C12P19/02—Monosaccharides
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P19/00—Preparation of compounds containing saccharide radicals
    • C12P19/14—Preparation of compounds containing saccharide radicals produced by the action of a carbohydrase (EC 3.2.x), e.g. by alpha-amylase, e.g. by cellulase, hemicellulase
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y302/00—Hydrolases acting on glycosyl compounds, i.e. glycosylases (3.2)
    • C12Y302/01—Glycosidases, i.e. enzymes hydrolysing O- and S-glycosyl compounds (3.2.1)
    • C12Y302/01004—Cellulase (3.2.1.4), i.e. endo-1,4-beta-glucanase
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02E—REDUCTION OF GREENHOUSE GAS [GHG] EMISSIONS, RELATED TO ENERGY GENERATION, TRANSMISSION OR DISTRIBUTION
    • Y02E50/00—Technologies for the production of fuel of non-fossil origin
    • Y02E50/10—Biofuels, e.g. bio-diesel

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Biomedical Technology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Mycology (AREA)
  • Biophysics (AREA)
  • Medicinal Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • General Chemical & Material Sciences (AREA)
  • Plant Pathology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Botany (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Virology (AREA)
  • Enzymes And Modification Thereof (AREA)

Abstract

The invention discloses a Trichoderma reesei engineering strain QCDS with synchronously improved cellulase expression and secretion capacity, which takes Trichoderma reesei QEB4 as an original strain, constructs a xyr gene which is xyr1 overexpression box expressed by a constitutive promoter Pcdna1 in a genome, has a nucleic acid sequence shown as SEQ ID NO.1, and simultaneously has a sec63 gene which is sec63 overexpression box expressed by a cellulose inducible promoter Pegl2, and has a nucleic acid sequence shown as SEQ ID NO. 2. The invention also discloses application of the strain in producing cellulase by fermentation and application of a strain fermentation product cellulase liquid in improving glucose release amount after saccharification of hydrolyzed biomass materials. Experiments prove that the cellulase expression and secretion capacity of the engineering strain are obviously improved, the cellulase activity reaches 27.1IU/mL, and the engineering strain has good industrial development and application prospects in cellulase production and degradation of lignocellulose biomass materials.

Description

Trichoderma reesei engineering strain with synchronously improved cellulase expression and secretion capacity and construction and application thereof
Technical Field
The invention belongs to the technical field of genetic engineering, and particularly relates to a Trichoderma reesei engineering strain with synchronously improved cellulase expression and secretion capacity, and a construction method and application thereof.
Background
The lignocellulose biomass is one of the most abundant renewable resources on the earth, and has very wide application prospect in the development process of new energy. However, the high production costs of cellulases have been the major obstacle limiting the conversion of such biomass. Trichoderma reesei, a filamentous fungus, is a main industrial production strain of cellulase at present, and the produced cellulase is widely applied to the fields of energy, textiles and the like. However, the yield still cannot meet the industrial demand, and thus there is a need to further increase the cellulase yield of trichoderma reesei.
The current methods for increasing cellulase yield mainly include: strain mutagenesis, fermentation process optimization, construction of engineering strains by using genetic engineering technology, and the like; wherein, the genetic engineering technology is used for modifying the genome of Trichoderma reesei so as to realize high-level expression and secretion of the cellulase, which is an important means for reducing the high production cost of the cellulase. As a main secretory protein of Trichoderma reesei, the production of cellulase is controlled by gene transcription, protein translation, post-translational modification to different levels of protein secretion and the like. Trichoderma reesei has a complex cellulase transcription regulation network, and at least four transcription activators (Xyr, ace2, ace3 and Hap2/3/5 complexes) and three transcription repressors (Ace 1, cre1, rce 1) have been found to play important roles in the expression of cellulase genes. In addition, cellulases need to undergo a series of protein folding and sorting processes in the endoplasmic reticulum during secretion, including protein transport (Sec 61, sec63, etc.), protein folding (Bip 1, pdi1, etc.), and glycosylation processes (Gls 1, gls 2), etc. By modifying a transcription regulation network and a secretion pathway for controlling transcription expression and secretion of Trichoderma reesei cellulase, efficient production of cellulase is expected to be realized. However, the genetic engineering approaches currently used are often limited to a single aspect, which limits the cellulase production potential exploitation of trichoderma reesei. Through searching, a document or a technical scheme for simultaneously modifying transcription levels (such as a transcription activating factor of Xyr and the like) and secretion processes (such as a key secretion element Sec63 and the like) in an engineering method for improving cellulase and a trichoderma reesei engineering strain for synchronously improving the expression and secretion capacity of related cellulase as well as a construction method and application thereof are not reported at present.
Disclosure of Invention
Aiming at the defects of the prior art, the invention aims to provide a Trichoderma reesei engineering strain with synchronously improved cellulase expression and secretion capability, and a construction method and application thereof.
The Trichoderma reesei engineering strain with synchronously improved cellulase expression and secretion capacity is characterized in that: the strain is named as QCDS, the strain takes Trichoderma reesei QEB4 as an initial strain, a xyr gene which is expressed by a constitutive promoter Pcdna1, namely xyr1 over-expression cassette is constructed in a genome of the strain, the nucleic acid sequence of the strain is shown as SEQ ID NO.1, and simultaneously, a sec63 gene which is expressed by a cellulose inducible promoter Pegl2, namely sec63 over-expression cassette is contained, and the nucleic acid sequence of the strain is shown as SEQ ID NO. 2; wherein xyr gene is integrated into hph locus, upstream of xyr gene is promoter Pcdna1, downstream is xyr1 native terminator, and resistance gene ptrA is located between upstream homology arm and promoter Pcdna 1; the upstream of the sec63 gene is the promoter Pcdna1, and the downstream is the terminator of the sec63 origin.
The construction method of the Trichoderma reesei engineering strain with synchronously improved cellulase expression and secretion capacity comprises the following steps:
(1) Using Trichoderma reesei QEB4 genome as a template, and amplifying a nucleotide sequence of a constitutive promoter Pcdna1 by using a primer pair Cdna1-F/Cdna 1-R; the method comprises the steps of using Trichoderma reesei QEB4 genome as a template to amplify xyr genes and terminator regions thereof, using primer pairs Hph-UF/Hph-UR and Hph-DF/Hph-DR to amplify upstream and downstream homology arms of the Hph genes respectively, and then fusing the upstream homology arms, resistance genes prtA, pcdna1 and xyr1 genes, the terminator and the downstream homology arms thereof in sequence to prepare an expression cassette, wherein the expression cassette is named xyr1 overexpression cassette, and the nucleic acid sequence of the expression cassette is shown as SEQ ID NO. 1; wherein the primer nucleotide sequence is as follows:
Cdna1-F：TTCGCCTAACCAGCATAA；
Cdna1-R：GATCAATCCAACAACTTCTCTC；
Hph-UF：GCTGTTCTCCAAGGCGTCA；
Hph-UR：AACAAAGATGCAAGAGCGGGGAGCCGAGAGGGTAGTAATG；
Hph-DF：AGAAAGGCATTTAGCAAGAAGG；
Hph-DR：TTCAGGGCGAAGCTGTCC；
(2) Preparing a Trichoderma reesei QEB protoplast by taking Trichoderma reesei QEB4 as an initial strain, then converting the xyr1 overexpression cassette constructed in the step (1) into the Trichoderma reesei QEB4 protoplast, and screening and verifying that the correct strain is named as Trichoderma reesei cellulase high expression strain QCDX;
(3) Using Trichoderma reesei QEB4 genome as a template, amplifying a nucleotide sequence of a cellulose-inducible promoter Pegl2 by using a primer pair Egl2-F/Egl2-R, amplifying a Sec63 gene and a terminator region thereof by using a primer pair Sec63-F/Sec63-R, and then fusing resistance genes hph, pegl2, sec63 genes and the terminator region thereof in sequence to prepare an expression cassette, wherein the expression cassette is named as a Sec63 over-expression cassette, and the nucleic acid sequence of the expression cassette is shown as SEQ ID NO. 2; wherein the primer nucleotide sequence is as follows:
Egl2-F：AAACACCTCGCTCCAGTGC；
Egl2-R：TGTCGATGACGGGGAGATAT；
Sec63-F：CTCCCCGTCATCGACAGCCAAGATGAGCTCAGACTACTC；
Sec63-R：TTCTGCTATTGCCAAGTTGAAAGCAGACGGGCTGTCATTG；
(4) Preparing protoplast of Trichoderma reesei cellulase high expression strain QCDX, transforming the sec63 overexpression cassette constructed in the step (3) into protoplast of Trichoderma reesei QCDX, screening and verifying to verify that the correct strain is named as Trichoderma reesei engineering strain QCDS with synchronously improved cellulase expression and secretion capacity.
The invention relates to application of Trichoderma reesei engineering strain with synchronously improved cellulase expression and secretion capacity in fermentation production of cellulase.
Wherein: the fermentation conditions in the production of the cellulase by fermentation are 28+/-1 ℃ and 180+/-20 r/min; wherein, the formula of the fermentation medium is as follows in g/L: microcrystalline cellulose 20-40, caCl 2 1-1.5，MgSO 4 ·7H 2 O 0.5-0.8，Na 2 HPO 4 2-5，KH 2 PO 4 3-5，(NH 4 ) 2 SO 4 2-4，CaCO 3 0.5-1.0 part, urea 0.1-0.5 part, corn steep liquor 10-20 parts, feSO 4 ·7H 2 O 0-0.02，MnSO 4 ·H 2 O 0-0.005，ZnSO 4 ·7H 2 O 0-0.01，CoCl 2 ·2H 2 O 0-0.02，pH 5.0-6.0。
Further preferred isThe implementation modes are as follows: the fermentation condition in the production of cellulase by fermentation is 28 ℃ and 180r/min; wherein, the formula of the fermentation medium is as follows in g/L: microcrystalline cellulose 35,CaCl2 1.0,MgSO4.7H 2 O 0.6，Na 2 HPO 4 4，KH 2 PO 4 3，(NH 4 ) 2 SO 4 4，CaCO 3 1, urea 0.3, corn steep liquor 20, feSO 4 ·7H 2 O 0.015，MnSO 4 ·H 2 O 0.001，ZnSO 4 ·7H 2 O 0.0015，CoCl 2 ·2H 2 O 0.006，pH 5.5。
The invention relates to an application of a fermentation product cellulase liquid of a Trichoderma reesei engineering strain with synchronously improved cellulase expression and secretion capacity in improving glucose release amount after saccharification of hydrolyzed biomass materials.
Wherein the biomass material is preferably corn stover or bagasse.
Wherein, the components (unit: g/100 ml) of the corn straw are: 62.6% of cellulose, 2.4% of hemicellulose, 17.7% of lignin and 6.8% of other components.
Wherein, the components (unit: g/100 ml) of the bagasse are: 70% of cellulose, 4.4% of hemicellulose, 5.1% of lignin and 20.5% of other components.
The invention discloses a Trichoderma reesei engineering strain with synchronously improved cellulase expression and secretion capacity, a construction method and application thereof. According to the invention, the Trichoderma reesei engineering strain QCDS with synchronously improved cellulase expression and secretion capacity is obtained by synchronously over-expressing the transcription activator Xyr and the key secretion element Sec63, and experiments prove that the strain has stronger cellulase expression and secretion capacity than the original strain, and the cellulase expression and secretion capacity of the strain is obviously improved. The cellulase activity of the QCDS of the engineering strain is 27IU/ml, is improved by 1.75 times compared with that of the original strain, and is obviously higher than that of a strain (such as a QES3 strain) constructed by adopting a single over-expression strategy, so that the enzyme production effect of 1+1 & gt2 is realized; in addition, when the cellulase system produced by the Trichoderma reesei engineering bacteria QCDs is used for treating biomass materials (corn stover or bagasse), compared with a starting strain, the yield of glucose is remarkably improved (the yield of glucose is respectively improved by 62.6 percent and 44.6 percent). The cellulase of the engineering strain provided by the invention has high yield and low production cost, and the enzyme system can be effectively applied to the degradation of corn stalks and other lignocellulose materials, and has good industrial development and application values.
Drawings
FIG. 1 construction and verification of Trichoderma reesei cellulase high expression strain QCDX.
Wherein: a is a schematic diagram of QCDX construction; b is xyr gene transcription level analysis of QCDX; QEB4 it is the starting strain.
FIG. 2 analysis of the cellulase gene expression level of Trichoderma reesei cellulase high expression strain QCDX.
FIG. 3 construction and verification of Trichoderma reesei engineering strain QCDs with synchronously improved cellulase expression and secretion capacity.
Wherein: a is a schematic diagram of QCDS construction; b is sec63 gene transcript level analysis of QCDs; QCDX is the starting strain.
FIG. 4 shows the results of cellulase activity measurement of QCDs of Trichoderma reesei engineering strain with synchronously improved cellulase expression and secretion capacity.
FIG. 5 saccharification assay results of Trichoderma reesei engineering strain QCDs with synchronously improved cellulase expression and secretion capacity.
Wherein: a is saccharification measurement by taking corn straw as a substrate; b is saccharification measurement with bagasse as substrate.
Detailed Description
The present invention will be described in detail with reference to the following drawings and examples. The following examples are only preferred embodiments of the present invention, and it should be noted that the following descriptions are merely for explaining the present invention, and are not limiting in any way, and any simple modification, equivalent variation and modification of the embodiments according to the technical principles of the present invention are within the scope of the technical solutions of the present invention.
The present invention uses techniques and methods conventional in the fields of genetic engineering and molecular biology. Those skilled in the art may utilize other conventional techniques, methods and reagents in the art based on the embodiments provided herein and are not limited to the specific examples of the invention.
Materials, strains, plasmids, reagents, etc., used in the examples of the present invention, unless otherwise specified, were obtained commercially.
In the examples which follow, the strain Trichoderma reesei QEB in question is disclosed in Qian, Y, zhong, L, gao, J, sun, N, wang, Y, sun, G, qu, Y, & Zhong, Y (2017) Production of highly efficient cellulase mixtures by genetically exploiting the potentials of Trichoderma reesei endogenous cellulases for hydrolysis of corncob residues.Microal cell manufacturers, 16 (1), 207.https:// doi.org/10.1186/s12934-017-0825-3, the construction of which is described in detail in this document.
Example 1. Construction of xyr1 and sec63 overexpression cassettes.
Firstly, amplifying a constitutive promoter Pcdna1 by using genomic DNA of Trichoderma reesei QEB4 as a template and using a primer pair Cdna1-F/Cdna1-R, amplifying xyr1 genes and terminator regions thereof by using a primer pair Xyr-F/Xyr 1-R, and amplifying upstream and downstream homology arms of Hph genes by using primer pairs Hph-UF/Hph-UR and Hph-DF/Hph-DR; and amplifying the ptrA expression cassette from the T-ptrA plasmid using the primer pair ptrA-F1/ptrA-R1. Then fusing the upstream homology arm of hph gene, the resistance genes prtA, pcdna1 and xyr1 gene and the downstream homology arm of terminator and hph gene, wherein the fusion PCR program is as follows: buffer enzyme 25. Mu. L, dNTP 1. Mu. L, phata enzyme 1. Mu.L, fragment 5. Mu.g total and ddH 2 O makes up 50. Mu.L; the fusion procedure is: pre-denaturing for 5min at 95 ℃, denaturing for 20s at 94 ℃, annealing for 20s at 60 ℃ and extending for 5min at 72 ℃ for 10 cycles, and extending for 5min at 72 ℃ to obtain an expression cassette which is named xyr1 over-expression cassette, and the nucleic acid sequence of the expression cassette is shown as SEQ ID NO. 1; the schematic diagram of the expression cassette is shown in FIG. 1A.
Using Trichoderma reesei QEB4 genome as a template, amplifying cellulose-induced promoter Pegl2 by using a primer pair Egl2-F/Egl2-R, amplifying Sec63 gene and terminator region thereof by using a primer pair Sec63-F/Sec63-R, amplifying Hph expression cassette by using a primer pair Hph-F1/Hph-R1 by using a T-Hph plasmid as a template, and then fusing resistance genes ptrA, pegl2, sec63 gene and terminator thereof in sequence to obtain an expression cassette, wherein the expression cassette is named as a Sec63 over-expression cassette, and the nucleic acid sequence of the expression cassette is shown as SEQ ID NO. 2; the schematic diagram of the expression cassette is shown in FIG. 3A.
The specific nucleotide sequences of the primer pairs are as follows:
Cdna1-F：CAGACAATGATGGTAGCAGC
Cdna1-R：GATCAATCCAACAACTTCTCTC
Hph-UF：GCTGTTCTCCAAGGCGTCA
Hph-UR：AACAAAGATGCAAGAGCGGGGAGCCGAGAGGGTAGTAATG
Hph-DF：AGAAAGGCATTTAGCAAGAAGG
Hph-DR：TTCAGGGCGAAGCTGTCC
Xyr1-F：ATATCTCCCCGTCATCGACAATGTTGTCCAATCCTCTCCGT
Xyr1-R：CCTTCTTGCTAAATGCCTTTCTCTGCACGCATCATAGAATCG
PtrA-F：CCGCTCTTGCATCTTTGTT
PtrA-R：TGAACCGATTGCTGCGATCCCCAGGCTTTACACTTTAT
Egl2-F：AAACACCTCGCTCCAGTGC
Egl2-R：TGTCGATGACGGGGAGATAT
Sec63-F：CTCCCCGTCATCGACAGCCAAGATGAGCTCAGACTACTC
Sec63-R：TTCTGCTATTGCCAAGTTGAAAGCAGACGGGCTGTCATTG
Hph-F1：CGACGTTAACTGATATTGAA
Hph-R1：CAACCCAGGGCTGGTGACGG。
EXAMPLE 2 construction of Trichoderma reesei QCDX and QCDS strains
Genetic transformation of Trichoderma reesei QEB4 was performed using PEG/CaCl 2 In the method of the mediated protoplast transformation, the pta gene is used as a selection marker.
The purified xyr1 overexpression cassette is transformed into Trichoderma reesei QEB4 protoplast to construct Trichoderma reesei cellulase high expression strain QCDX. Wherein the PEG/CaCl 2 Specific methods of mediated protoplast transformation are as follows:
(1) Preparation of Trichoderma reesei QEB4 protoplasts:
fresh Trichoderma reesei QEB spores (within 2 weeks) were prepared and coated on 4-8 glassine PDA plates, each coated with 120. Mu.L of 10% strength 8 individual/mL spore suspension. Culturing at 28deg.C for 13.5 hr, lightly washing mycelium from cellophane to cell wall lysate (0.15 g lyase is dissolved in 15mL solution I) after mycelium grows to proper length, mixing, standing at 28deg.C, and lysing for 90min; filtering the lysate by using four layers of mirror wiping paper, and collecting filtrate by using a 50mL centrifuge tube; centrifuging the filtrate at 4deg.C and 2,500rpm for 15min, and discarding supernatant; the pellet was gently resuspended in solution II, centrifuged again at 2,500rpm at 4℃for 15min and the supernatant discarded; 200-1000. Mu.L of solution II was added to resuspend the pellet, which was placed on ice for subsequent experiments. The whole process of preparing protoplast cells is carried out on ice and the tips are cut off.
Wherein the PDA culture medium comprises the following components: 250g of potato, boiling in water for 2h, filtering with 8 layers of gauze, adding 20g of glucose into the filtrate, supplementing water to 1L, naturally adding 2% of agar powder, and sterilizing at 115 ℃ for 30min;
solution I above: 1.2M sorbitol, 0.1M KH 2 PO 4 Sterilizing at 115 deg.c for 30min at pH 5.6;
solution II above: 1M sorbitol, 50mM CaCl 2 .2H 2 O,10mM Tris-HCl, pH 7.5, sterilized at 115℃for 30min.
(2) Transformation of Trichoderma reesei QEB4 Strain with xyr1 overexpression cassette
Mixing a xyr1 over-expression cassette, a precooled PEG solution and QEB4 protoplast according to the volume ratio of 1:5:24, carrying out ice bath for 20min, adding 2mL of preheated PEG solution into the mixed solution, carrying out water bath at 37 ℃ for 3min, finally adding 4mL of solution II, and carrying out gentle mixing; the above solution was added to 50mL of a transformation upper medium containing 0.4. Mu.g/mL of pyrithione hydrobromide (purchased from Sigma Co.), and after mixing, poured into a pre-coagulated transformation lower medium plate, and after cooling and coagulating, cultured at 28℃for 4-6 days, the transformant was selected for molecular verification, and the strain which was verified to be correct was named Trichoderma reesei cellulase high expression strain QCDX.
(3) The sec63 overexpression cassette is used for transforming the Trichoderma reesei QCDX strain to obtain the Trichoderma reesei engineering strain QCDS with synchronously improved cellulase expression and secretion capacity:
firstly, preparing protoplast of Trichoderma reesei cellulase high expression strain QCDX by referring to the method of the step (1), and mixing a sec63 overexpression box, a precooled PEG solution and the QCDX protoplast according to the weight ratio of 1:5:24, ice-bathing for 20min, adding 2mL of preheated PEG solution into the mixed solution, water-bathing at 37 ℃ for 3min, and finally adding 4mL of solution II, and gently mixing; then, the above solution was added to 50mL of a transformation upper medium containing 300. Mu.g/mL hygromycin B (purchased from Roche Co.), and after mixing, poured into a pre-coagulated transformation lower medium plate, cultured at 30℃for 3-5 days, cooled and coagulated, cultured at 28℃for 4-6 days, and the transformant was selected for molecular verification, and the strain with the correct verification was named as Trichoderma reesei engineering strain QCDS with synchronously improved cellulase expression and secretion ability.
Wherein the PEG culture medium is as follows: 25% PEG 6000, 50mM CaCl 2 .2H 2 O，10mM Tris-HCl，pH 7.48。
Transformation upper medium (g/L) above: glucose 10, mgSO 4 ·7H 2 O 1，KH 2 PO 4 8，(NH 4 ) 2 SO 4 4，C 6 H 5 Na 3 O 7 3, sorbitol 182.18, agarose 6;
transformation lower medium (g/L) above: glucose 10, mgSO 4 ·7H 2 O 1，KH 2 PO 4 8，(NH 4 ) 2 SO 4 4，C 6 H 5 Na 3 O 7 3, agar powder 20; the culture medium is sterilized at 115 deg.C for 30min.
Construction of comparative example strain Trichoderma reesei cellulase high secreting strain QES 3:
the construction method is similar to that of the QCDS of example 2, except that: the constructed sec63 overexpression cassette was transformed into Trichoderma reesei QEB and screened under conditions of 0.4. Mu.g/mL of pyrithione hydrobromide, all other things being equal. The correct strain was identified as Trichoderma reesei cellulase high secreting strain QES3.
EXAMPLE 3 analysis of transcriptional level of xyr Gene and cellulase Gene of QCDX and sec63 Gene of QCDS
The cellulase high-expression strain QCDX obtained in the example 2 and the original strain QEB are mixed according to the proportion of 10 8 Respectively inoculating each/mL into 50mL (250 mL triangular flask) of seed culture medium, shaking and culturing for 40 hours, respectively inoculating 10mL of each seed culture medium into fermentation culture medium, shaking and culturing at 28 ℃ and 180rpm for 72 hours, filtering to collect mycelium, extracting RNA, and carrying out RT-qPCR analysis, wherein the actin gene is used as an internal reference gene. Fig. 1B shows a significant increase in the transcript of xyr1 in qdx, a 47.2-fold increase compared to the starting strain, indicating successful integration of the xyr1 overexpression cassette into the genome. FIG. 2 shows that the transcription of the cellulase genes (cbh 1, egl1, bgl 1) in QCDX is significantly increased by 60%, 30% and 140% compared with the original strain. Further, it was shown that high expression of cellulase was achieved in QCDX.
The Trichoderma reesei engineering strain QCDS and the cellulase high-expression strain QCDX with synchronously improved cellulase expression and secretion capability obtained in the example 2 are fermented and cultured according to the steps, mycelia are collected and RNA is extracted through suction filtration in 72h, and RT-qPCR analysis is carried out. The results are shown in FIG. 3B, which shows a significant increase in the transcription of sec63 in QCDS, 64-fold increase compared to its parent QCDX, indicating successful integration of the sec63 overexpression cassette into the genome.
The comparative example strain, namely the cellulase high expression strain QES3 and the parent strain QEB thereof were fermented and cultured in the above-described steps, mycelia were collected by suction filtration at 72h and RNA was extracted, and RT-qPCR analysis was performed. The transcription amount of sec63 in QES3 was 62-fold increased over the original strain, indicating successful integration of the sec63 overexpression cassette into the genome of QES3 strain.
Wherein, the seed culture medium is (g/L): glucose 15, peptone 5, urea 0.3, caCl 2 1.4，MgSO 4 ·7H 2 O0.6，KH 2 PO 4 15，(NH 4 ) 2 SO 4 Sterilizing at 115 deg.c for 30min.
Wherein the fermentation medium is (g/L): microcrystalline cellulose 35,CaCl2 1.0,MgSO4.7H2O 0.6, na 2 HPO 4 4，KH 2 PO 4 3，(NH 4 ) 2 SO 4 4，CaCO 3 1, urea 0.3, corn steep liquor 20, feSO 4 ·7H 2 O 0.015，MnSO 4 ·H 2 O 0.001，ZnSO 4 ·7H 2 O 0.0015，CoCl 2 ·2H 2 O0.006, pH 5.5. Sterilizing at 115 deg.C for 30min.
Wherein, the primers used for RT-qPCR are as follows:
Actin-qF：CCCAAGTCCAACCGTGAGA
Actin-qR：CAATGGCGTGAGGAAGAGC
Xyr1-qF：TCTTCTACGGCGTCTATCTCC
Xyr1-qR：GTGTGCCCTAACAATGGTCTC
Cbh1-qF：GCGGCATGGTTCTGGTCA
Cbh1-qR：TCGTTTGTCGGGTAGGTGGA
Egl1-qF：CGGCTACAAAAGCTACTACG
Egl1-qR：CTGGTACTTGCGGGTGAT
Bgl1-qF：AGTGACAGCTTCAGCGAG
Bgl1-qR：GGAGAGGCGTGAGTAGTTG
Sec63-qF：TCCCGCCTATTGACGAGC
Sec63-qR：CGAGACAGGCTTTCCATCAG。
EXAMPLE 4 cellulase Activity assay of Trichoderma reesei engineering Strain QCDs with synchronous increase in cellulase expression and secretion ability
The engineering strain QCDS, QCDX, QES3 obtained in example 2 and the starting strain QEB4 (10 8 Respectively inoculating the strain per mL into 50mL (250 mL triangular flask) of seed culture medium, culturing at 28 ℃ for 40 hours at 180rpm, respectively transferring 10mL of bacterial liquid into 100mL of fermentation culture medium for 7d, taking fermentation liquid, centrifuging, taking supernatant, and measuring cellulase activity.
The filter paper enzyme activity was determined according to the light industry standard QB 2583-2003 of the people's republic of China.
The method for measuring the activity of the filter paper comprises the following steps:
A1X 6cm (50.+ -.1 mg) filter paper was folded and placed at the bottom of the test tube, and 1.5mL of pH 4.8 citric acid buffer and 0.5mL of a crude enzyme solution appropriately diluted were added and mixed well. Adding 3mL of DNS after water bath at 50 ℃ for 60min, stirring by vortex, mixing uniformly, boiling for 10min, adding distilled water to a volume of 25mL, shaking uniformly, and measuring an OD value at 540 nm. The blank control is to add DNS and then enzyme solution.
The result is shown in FIG. 4, which shows that the cellulase activity of QCDX is 17.8IU/mL, which is improved by 81.6% compared with the original strain QEB (9.8 IU/mL), and further shows that the cellulase yield of Trichoderma reesei can be improved by enhancing the expression of the cellulase gene by using the promoter Pcdna1 to overexpress xyr gene; the cellulase activity of QES3 is 15.5IU/mL, which is improved by 58.1% compared with the original strain, and further shows that the cellulase secretion capacity of Trichoderma reesei can be improved by using the gene sec63 of the key secretion element coding gene of the over-expressed Pegl2 promoter; the cellulase activity of the engineering strain QCDS is 27IU/mL, which is improved by 1.75 times compared with the original strain QEB, and is respectively improved by 51.7 percent and 74.2 percent compared with the single modified strain. Compared with the independent modification of regulatory factors or secretion elements, the method can obviously improve the activity of the Trichoderma reesei cellulase by simultaneously enhancing the expression and secretion capacity of the cellulase.
Example 5 application of cellulase system produced by Trichoderma reesei engineering Strain QCDs with synchronously improved cellulase expression and secretion capabilities in hydrolyzing biomass Material
The cellulase solutions prepared by the engineering strains QCDS and QCDX, QES3 and QEB4 obtained in the example 4 are respectively applied to saccharification experiments of actual corn stalks.
The reaction system is 30mL, the saccharification substrates are respectively acid treated corn stalk and bagasse, the substrate concentration is 10%, the cellulase liquid (the addition amount of the cellulase is 10FPU/g substrate) prepared by QCDS and QCDX, QES3 and QEB of various engineering strains is supplemented with 30mL of 0.1M sodium acetate buffer solution with pH of 4.8, the temperature is 50 ℃ and the rpm is 150, after saccharification is finished, the saccharification liquid is taken, centrifuged, the supernatant is taken, and glucose measurement is carried out by using an SBA-40C biosensor.
Wherein, the components (unit: g/100 ml) of the corn straw are: 62.6% of cellulose, 2.4% of hemicellulose, 17.7% of lignin and 6.8% of other components.
Wherein, the components (unit: g/100 ml) of the bagasse are: 70% of cellulose, 4.4% of hemicellulose, 5.1% of lignin and 20.5% of other components.
As shown in FIG. 5, the glucose release amount of the enzyme solution of QCDX on hydrolyzed corn stover and bagasse is respectively improved by 14.5% and 10.0% compared with that of the original strain QEB (26.2 mg/mL and 21.4 mg/mL); the enzyme solution of QES3 has no obvious effect on improving the glucose release amount of hydrolyzed corn stalks and bagasse; the glucose release amount (42.6 mg/mL and 30.9 mg/mL) of the engineering bacteria QCDS after enzyme liquid hydrolysis is obviously improved, and compared with the original strain QEB4, the glucose yield is respectively improved by 62.6% and 44.6%. Compared with the independent modification of regulatory factors or secretion elements, the cellulase system generated by the method through simultaneously enhancing the expression and secretion capabilities of the cellulase can be effectively applied to the degradation of lignocellulose materials, and the effect of 1+1 & gt2 is achieved.
Sequence listing
<110> university of Shandong
<120> Trichoderma reesei engineering strain with synchronously improved cellulase expression and secretion capacity, construction and application thereof
<141> 2022-05-15
<160> 2
<170> SIPOSequenceListing 1.0
<210> 1
<211> 2950
<212> DNA
<213> artificial sequence
Nucleotide sequence of <221> xyr1 overexpression cassette
<400> 1
atgttgtcca atcctctccg tcgctattct gcctaccccg acatctcctc ggcgtcattt 60
gacccgaact accatggctc acagtcgcat ctccactcga tcaacgtcaa cacattcggc 120
aacagccacc cctatcccat gcagcacctc gcacagcatg cggagctttc gagttcacgc 180
atgataaggg ccagtccggt gcagccaaag cagcgccagg gctctcttat tgctgccagg 240
aagaattcaa cgggtactgc tgggcccatt cggcggagga tcagtcgcgc ttgtgaccag 300
tgcaaccagc ttcgtaccaa gtgcgatggc ttacacccat gtgcccattg tataggtatg 360
tcccttttcc tctacacagt gatgctgcgc tcaagcacat gtactgatcg atcttgttta 420
gaattcggcc ttggatgcga atatgtccga gagagaaaga agcgtggcaa agcttcgcgc 480
aaggatattg ctgcccagca agccgcggcg gctgcagcac aacactccgg ccaggtccag 540
gatggtccag aggatcaaca tcgcaaactc tcacgccagc aaagcgaatc ttcgcgtggc 600
agcgctgagc ttgcccagcc tgcccacgac ccgcctcatg gccacattga gggctctgtc 660
agctccttca gcgacaatgg cctttcccag catgctgcca tgggcggcat ggatggcctg 720
gaagatcacc atggccacgt cggagttgat cctgccctgg gccgaactca gctggaagcg 780
tcatcagcaa tgggcctggg cgcatacggt gaagtccacc ccggctatga gagccccggc 840
atgaatggcc atgtgatggt gcccccgtcg tatggcgcgc agaccaccat ggccgggtat 900
tccggtatct cgtatgctgc gcaagccccg agtccggcta cgtatagcag cgacggtaac 960
tttcgactca ccggtcacat ccatgattac ccgctggcaa atgggagctc gccctcatgg 1020
ggagtctcgc tggcctcgcc ttcgaaccag ttccagcttc agctctcgca gcccatcttc 1080
aagcaaagcg atttgcgata tcctgtgctt gagcctctgc tgcctcacct gggaaacatc 1140
ctccccgtgt ctttggcgtg cgatctgatt gacctgtact tctcctcgtc ttcatcagca 1200
cagatgcacc caatgtcccc atacgttctg ggcttcgtct tccggaagcg ctccttcttg 1260
caccccacga acccacgaag gtgccagccc gcgctgcttg cgagcatgct gtgggtggcg 1320
gcacagacta gcgaagcgtc cttcttgacg agcctgccgt cggcgaggag caaggtctgc 1380
cagaagctgc tcgagctgac cgttgggctt cttcagcccc tgatccacac cggcaccaac 1440
agcccgtctc ccaagactag ccccgtcgtc ggtgctgctg ccctgggagt tcttggggtg 1500
gccatgccgg gctcgctgaa catggattca ctggccggcg aaacgggtgc ttttggggcc 1560
atagggagcc ttgacgacgt catcacctat gtgcacctcg ccacggtcgt ctcggccagc 1620
gagtacaagg gcgccagcct gcggtggtgg ggtgcggcat ggtctctcgc cagagagctc 1680
aagcttggcc gtgagctgcc gcctggcaat ccacctgcca accaggagga cggcgagggc 1740
cttagcgaag acgtggatga gcacgacttg aacagaaaca acactcgctt cgtgacggaa 1800
gaggagcgcg aagagcgacg gcgagcatgg tggctcgttt acatcgtcga caggcacctg 1860
gcgctctgct acaaccgccc cttgtttctt ctggacagcg agtgcagcga cttgtaccac 1920
ccgatggacg acatcaagtg gcaggcaggc aaatttcgca gccacgatgc agggaactcc 1980
agcatcaaca tcgatagctc catgacggac gagtttggcg atagtccccg ggcggctcgc 2040
ggcgcacact acgagtgccg cggtcgtagc atttttggct acttcttgtc cttgatgaca 2100
atcctgggcg agattgtcga tgtccaccat gctaaaagcc acccccggtt cggcgttgga 2160
ttccgctccg cgcgggattg ggacgagcag gttgctgaaa tcacccgaca cctggacatg 2220
tatgaggaga gcctcaagag gttcgtggcc aagcatctgc cattgtcctc aaaggacaag 2280
gagcagcatg agatgcacga cagtggagcg gtaacagaca tgcaatctcc actctcggtg 2340
cggaccaacg cgtccagccg catgacggag agcgagatcc aggccagcat cgtggtggct 2400
tacagcaccc atgtgatgca tgtcctccac atcctccttg cggataagtg ggatcccatc 2460
aaccttctag acgacgacga cttgtggatc tcgtcggaag gattcgtgac ggcgacgagc 2520
cacgcggtat cggctgccga agctattagc cagattctcg agtttgaccc tggcctggag 2580
tttatgccat tcttctacgg cgtctatctc ctgcagggtt ccttcctcct cctgctcatc 2640
gccgacaagc tgcaggccga agcgtctcca agcgtcatca aggcttgcga gaccattgtt 2700
agggcacacg aagcttgcgt tgtgacgctg agcacagagt atcaggtaag ccctatcagt 2760
tcaaacgtct atcttgctgt gaatcaaaga ctgacttgga catcagcgca actttagcaa 2820
ggttatgcga agcgcgctgg ctctgattcg gggccgtgtg ccggaagatt tagctgagca 2880
gcagcagcga cgacgcgagc ttcttgcact ataccgatgg actggtaacg gaaccggtct 2940
ggccctctaa 2950
<210> 2
<211> 2835
<212> DNA
<213> artificial sequence
Nucleotide sequence of <221> sec63 overexpression cassette
<400> 2
atgagctcag actactcgta cgacgaacag gtatgttgga catgttcgct gttcccttcc 60
ttttcccggt gcggcatggc gtggcgtggg tgggcttgag catctcgagc atcatggctg 120
gccatggggc tgatgtttgg tggttaacct gtttcttttc tctctactac agggccagtt 180
tttccccttc ttcatcctga ccgtcaccgg cctggtcacc cttcccttga catacagcct 240
cttccggaag agcaccgaca acgatgcgct tgcgccgcgc atctcgtcgg attacaccat 300
caagcatggc gacgttgtag cgtcgctgcg ggcggcgcag aagaggaagc agcgcaagat 360
caagcgggcc atcttcgtcg tcctggggtg ggctctcatg gcgggcatgg tgtatctgat 420
cgtgacgaca caaaagatca ttcctaagat ttggaatcca tatgatatct tgggaatttc 480
agaggtaagc acgatgagga acaggcaggg acgggtggcg cggagaccga gagctaacat 540
tcgaaccaaa cgcagtcggc taccgaaaaa caaatcaagt ctcactacaa gaggctgtcc 600
gtcaaattcc accccgacaa ggtccgaccc gatccctcca agaacgagac gctggagatg 660
ctcaacgacc gatacgttga gctcaccaaa gcataccaag ccctcacgga cgaagaagta 720
cgaaacaact atatccaata cggtcacccc gatggcaagc agagcttcag catcggcatt 780
gcgctgcctc agttcatcat cgcagagggc aacggcaaat acctgattct gctctacact 840
gggctcatgg gcattctgct gccttatctg gtcggctcat ggtggtacgg aaccaagcgg 900
atgtcgaagg agggcgtctt gatggaaagc gccaaccgcc tgttcagaca ctacaacgag 960
gaaatcgacg aaggtggcat cattaccgcc ctcagcaccg gcaaggaatt cgaaaacatt 1020
ctcaagggag accaggccga atccgggctg tccaaggtcg agtctcgcat cacggccccc 1080
ggggaaaccg caccatttgc ctgtggcttc tctgtcaagg acaaggagaa gcttgaggat 1140
ctggacagcg gcgtgcggcg caaggtgctt gccttgctgt gggcgtacct cggccgtgtc 1200
gagctcgacg accctgcgct gaccaaggcc aagtacgagg tcggcgcgat tgcccggaca 1260
ctgaaccagt ccttcgccgc gattgcgttg gcatttggca gcattggccc catcgcaggg 1320
tccttcaagg cgaaccagca tctcatccag gctctctccc ccaagtcttc ccctctgctc 1380
cagctcccgt acatcaccga caaggttgcc gcggctattg aaggcgactc gaagattcac 1440
ctgaccgtgc agcaattcat ggaccttccc gacgccgaac gaagacgact tgctgttggc 1500
aaggatctcc tcaccgaaga gcagtacaac gaggccatca aggtcggcaa gcagctccct 1560
tacttccgcg ttgccaaggc attcttcaag gtgaccggcg aaaaggtcat cattccttca 1620
tctctggtta ccctggtcat caagggccgc ttcatccccc ccggcaccga gtcgatcccg 1680
cctattgacg agctgtccct ggaggacatt gaccccgccg aagacgatct ggatgcgcta 1740
atgggacgca agaagaagac gatcaagggc cctgatggaa agcctgtctc ggttgaagag 1800
aactctgttt tgccacccct gacctttgcc cctcactacg ctcgcgaaca ctctcccaag 1860
tggtacgcgt tcctcagcga ttccaagcaa gacaagatgg cggtgccccc cttcacattt 1920
gacaagtttg accagcccat ctttgatgag gagggcaagc ccacgttcaa catgcagact 1980
ctcaaggccc agttcgccgc tcccccgcaa cccggccact acaccttctg catgcacgtc 2040
atctgcgatt cctacgtcgg ttttgatacc aagatggagg ttaccctcgt cgtcgaagat 2100
gccagtaagg cggcccagat ggatgccgag gatgatatca gcgagcccga agaaggtaag 2160
acagccgttc actgcctcaa gaattcaatt caacgctaac atgtgattgc agactccatt 2220
gctggacaga tgcgagcgct aaagactgga caacctgttg gccagagcac caagcccaag 2280
cggaaacagg agagctccga tgaagagtcg ggcacagacg aggaagagga tgacacgagc 2340
gacaccaaca ctgacacgga agacgagagc tgaaagccct ccctggcgct gatggaaaat 2400
acgtcaagga gcatgtttta ttagactgga aagggaaaac caacacgaac cacaaagcca 2460
agtattcttg gcgacgtttt gagaaaagaa agaaagagaa gagaaaaaaa acaggagaaa 2520
atttggctta agcaacctgc gtacttgcat agtgaagcgc aagctgattt gcgttctgcg 2580
cgatactggg gaagccacag gcaacacgag ggaactgatt ggctcgggag gccttgccgg 2640
catggagttt tgtcttttat gatttttttt ttgtttgttt gttttttcca gcggcttatg 2700
ggacctgggt cgtgttgggt tgttgagtct tatattttgt attacctagt ttatcccccc 2760
ttttttctgt tgtggtttcg taacgtagat tcatgatggt ggtattggaa ctacacattg 2820
ctattgatgg ggggg 2835

Claims (7)

1. A Trichoderma reesei engineering strain with synchronously improved cellulase expression and secretion capability is characterized in that: the strain is named as QCDS, the strain takes Trichoderma reesei QEB4 as an initial strain, a xyr gene which is expressed by a constitutive promoter Pcdna1, namely xyr1 over-expression cassette is constructed in a genome of the strain, the nucleic acid sequence of the strain is shown as SEQ ID NO.1, and simultaneously, a sec63 gene which is expressed by a cellulose inducible promoter Pegl2, namely sec63 over-expression cassette is contained, and the nucleic acid sequence of the strain is shown as SEQ ID NO. 2; wherein xyr gene is integrated into hph locus, upstream of xyr gene is promoter Pcdna1, downstream is xyr1 native terminator, and resistance gene ptrA is located between upstream homology arm and promoter Pcdna 1; the upstream of the sec63 gene is the promoter Pegl2, and the downstream is the terminator of the sec63 origin.
2. The construction method of Trichoderma reesei engineering strain with synchronously improved cellulase expression and secretion capacity, which comprises the following steps:
(1) Using Trichoderma reesei QEB4 genome as a template, and amplifying a nucleotide sequence of a constitutive promoter Pcdna1 by using a primer pair Cdna1-F/Cdna 1-R; the method comprises the steps of using Trichoderma reesei QEB4 genome as a template to amplify xyr genes and terminator regions thereof, using primer pairs Hph-UF/Hph-UR and Hph-DF/Hph-DR to amplify upstream and downstream homology arms of the Hph genes respectively, and then fusing the upstream homology arms, resistance genes ptrA, pcdna1 and xyr1 genes, the terminator and the downstream homology arms thereof in sequence to prepare an expression cassette, wherein the expression cassette is named xyr1 overexpression cassette, and the nucleic acid sequence of the expression cassette is shown as SEQ ID NO. 1; wherein the primer nucleotide sequence is as follows:
Cdna1-F：TTCGCCTAACCAGCATAA；
Cdna1-R：GATCAATCCAACAACTTCTCTC；
Hph-UF：GCTGTTCTCCAAGGCGTCA；
Hph-UR：AACAAAGATGCAAGAGCGGGGAGCCGAGAGGGTAGTAATG；
Hph-DF：AGAAAGGCATTTAGCAAGAAGG；
Hph-DR：TTCAGGGCGAAGCTGTCC；
(2) Preparing a Trichoderma reesei QEB protoplast by taking Trichoderma reesei QEB4 as an initial strain, then converting the xyr1 overexpression cassette constructed in the step (1) into the Trichoderma reesei QEB4 protoplast, and screening and verifying that the correct strain is named as Trichoderma reesei cellulase high expression strain QCDX;
(3) Using Trichoderma reesei QEB4 genome as a template, amplifying a nucleotide sequence of a cellulose-inducible promoter Pegl2 by using a primer pair Egl2-F/Egl2-R, amplifying a Sec63 gene and a terminator region thereof by using a primer pair Sec63-F/Sec63-R, and then fusing resistance genes hph, pegl2, sec63 genes and the terminator region thereof in sequence to prepare an expression cassette, wherein the expression cassette is named as a Sec63 over-expression cassette, and the nucleic acid sequence of the expression cassette is shown as SEQ ID NO. 2; wherein the primer nucleotide sequence is as follows:
Egl2-F：AAACACCTCGCTCCAGTGC；
Egl2-R：TGTCGATGACGGGGAGATAT；
Sec63-F：CTCCCCGTCATCGACAGCCAAGATGAGCTCAGACTACTC；
Sec63-R：TTCTGCTATTGCCAAGTTGAAAGCAGACGGGCTGTCATTG；
(4) Preparing protoplast of Trichoderma reesei cellulase high expression strain QCDX, transforming the sec63 over expression cassette constructed in the step (3) into protoplast of Trichoderma reesei QCDX, screening, verifying, and verifying that the correct strain is named Trichoderma reesei engineering strain QCDS with synchronously improved cellulase expression and secretion capacity.
3. Use of the trichoderma reesei engineering strain with synchronously improved cellulase expression and secretion capacity according to claim 1 in the fermentative production of cellulase.
4. A use according to claim 3, characterized in that: the fermentation conditions in the production of the cellulase by fermentation are 28+/-1 ℃ and 180+/-20 r/min; wherein, the formula of the fermentation medium is as follows in g/L: microcrystalline cellulose 20-40, caCl 2 1-1.5，MgSO 4 ·7H 2 O 0.5-0.8，Na 2 HPO 4 2-5，KH 2 PO 4 3-5，(NH 4 ) 2 SO 4 2-4，CaCO 3 0.5-1.0 part, urea 0.1-0.5 part, corn steep liquor 10-20 parts, feSO 4 ·7H 2 O 0-0.02，MnSO 4 ·H 2 O 0-0.005，ZnSO 4 ·7H 2 O 0-0.01，CoCl 2 ·2H 2 O 0-0.02，pH 5.0-6.0。
5. The use according to claim 4, characterized in that: the fermentation condition in the production of cellulase by fermentation is 28 ℃ and 180r/min; wherein, the formula of the fermentation medium is as follows in g/L: microcrystalline cellulose 35, caCl 2 1.0，MgSO 4 ·7H 2 O 0.6，Na 2 HPO 4 4，KH 2 PO 4 3，(NH 4 ) 2 SO 4 4，CaCO 3 1, urea 0.3, corn steep liquor 20, feSO 4 ·7H 2 O 0.015，MnSO 4 ·H 2 O 0.001，ZnSO 4 ·7H 2 O 0.0015，CoCl 2 ·2H 2 O 0.006，pH 5.5。
6. The use of the fermentation product cellulase liquid of trichoderma reesei engineering strain with synchronously improved cellulase expression and secretion capacity according to claim 1 for improving glucose release amount after saccharification of hydrolyzed biomass material.
7. The use according to claim 6, wherein the biomass material is corn stover or bagasse.
CN202210581356.3A 2022-05-26 2022-05-26 Trichoderma reesei engineering strain with synchronously improved cellulase expression and secretion capacity and construction and application thereof Active CN114806903B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202210581356.3A CN114806903B (en) 2022-05-26 2022-05-26 Trichoderma reesei engineering strain with synchronously improved cellulase expression and secretion capacity and construction and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202210581356.3A CN114806903B (en) 2022-05-26 2022-05-26 Trichoderma reesei engineering strain with synchronously improved cellulase expression and secretion capacity and construction and application thereof

Publications (2)

Publication Number Publication Date
CN114806903A CN114806903A (en) 2022-07-29
CN114806903B true CN114806903B (en) 2023-08-04

Family

ID=82517703

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202210581356.3A Active CN114806903B (en) 2022-05-26 2022-05-26 Trichoderma reesei engineering strain with synchronously improved cellulase expression and secretion capacity and construction and application thereof

Country Status (1)

Country Link
CN (1) CN114806903B (en)

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN113913443A (en) * 2021-12-06 2022-01-11 山东大学 Method for improving cellulose hydrolase activity of trichoderma reesei by using cellulose-inducible promoter

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103917653A (en) * 2011-07-21 2014-07-09 加利福尼亚大学董事会 Transcription factors for the production of cellulose degrading enzymes

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN113913443A (en) * 2021-12-06 2022-01-11 山东大学 Method for improving cellulose hydrolase activity of trichoderma reesei by using cellulose-inducible promoter

Also Published As

Publication number Publication date
CN114806903A (en) 2022-07-29

Similar Documents

Publication Publication Date Title
CN106978360B (en) High-yield cellulase trichoderma reesei recombinant strain and application thereof
CN105802854B (en) Cellulase high-yield strain and application thereof
US11377674B2 (en) Recombinant strain expressing phospholipase D and application thereof
CN112961788B (en) Method for high-yield xylanase in Trichoderma reesei and application thereof
CN113913443B (en) Method for extracting Gao Lishi trichoderma cellulose hydrolase activity by using cellulose inducible promoter
CN112899177B (en) Recombinant yarrowia lipolytica expressing myrosinase TGG4 and application thereof
CN114921487B (en) Pichia pastoris construction method capable of efficiently expressing feeding low-temperature alpha-amylase
CN114561303B (en) Trichoderma reesei engineering strain secreting high-performance cellulase and application thereof
CN113106114A (en) Factor for regulating and controlling trichoderma reesei protein expression efficiency, regulating and controlling method and application
CN103409458A (en) Ti plasmid aspergillus niger gene replacement expression vector and application thereof
CN114806903B (en) Trichoderma reesei engineering strain with synchronously improved cellulase expression and secretion capacity and construction and application thereof
CN110004070B (en) Xylanase-producing Aspergillus niger genetically engineered bacterium and construction method and application thereof
CN109134630B (en) Functional protein POX03016 and coding gene and application thereof
CN108588060A (en) A kind of recombination oxalate decarboxylase expressed with filamentous fungal host cell
CN113980938B (en) Method for obtaining high-yield high-stability heterologous beta-glucosidase
CN104561082B (en) One plant of yeast Candida jeffriesii that can utilize xylose expression system
CN116640792A (en) Method for improving xylanase yield in Trichoderma reesei and application thereof
CN108102934B (en) Aspergillus niger strain capable of producing pectin lyase at high yield
CN116200279A (en) Trichoderma reesei recombinant strain, preparation method and application thereof
CN113174391B (en) Application of Trtam1 gene in promotion of efficient nitrogen source utilization of trichoderma reesei and cellulase induced expression
CN113943662A (en) Trichoderma reesei strain for heterologous expression of xylanase/cellulase CbXyn10c gene and application thereof
CN109536395A (en) It is a kind of it is high expression &#39;beta &#39;-mannase pichia pastoris engineered strain and application
CN108949579B (en) Thermoascus thermophilus gene expression system
CN114250155A (en) Trichoderma reesei engineering bacterium capable of highly producing cellulase under condition of taking glucose as carbon source and construction method and application thereof
CN114875059B (en) Construction and application of novel trichoderma reesei heterologous protein expression system

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant