CN114805276B - Isochromene compound and preparation method and application thereof - Google Patents
Isochromene compound and preparation method and application thereof Download PDFInfo
- Publication number
- CN114805276B CN114805276B CN202210244625.7A CN202210244625A CN114805276B CN 114805276 B CN114805276 B CN 114805276B CN 202210244625 A CN202210244625 A CN 202210244625A CN 114805276 B CN114805276 B CN 114805276B
- Authority
- CN
- China
- Prior art keywords
- compound
- isochromene
- eluent
- methanol
- silica gel
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07D—HETEROCYCLIC COMPOUNDS
- C07D311/00—Heterocyclic compounds containing six-membered rings having one oxygen atom as the only hetero atom, condensed with other rings
- C07D311/02—Heterocyclic compounds containing six-membered rings having one oxygen atom as the only hetero atom, condensed with other rings ortho- or peri-condensed with carbocyclic rings or ring systems
- C07D311/76—Benzo[c]pyrans
-
- A—HUMAN NECESSITIES
- A24—TOBACCO; CIGARS; CIGARETTES; SIMULATED SMOKING DEVICES; SMOKERS' REQUISITES
- A24B—MANUFACTURE OR PREPARATION OF TOBACCO FOR SMOKING OR CHEWING; TOBACCO; SNUFF
- A24B15/00—Chemical features or treatment of tobacco; Tobacco substitutes, e.g. in liquid form
- A24B15/18—Treatment of tobacco products or tobacco substitutes
- A24B15/28—Treatment of tobacco products or tobacco substitutes by chemical substances
- A24B15/30—Treatment of tobacco products or tobacco substitutes by chemical substances by organic substances
- A24B15/36—Treatment of tobacco products or tobacco substitutes by chemical substances by organic substances containing a heterocyclic ring
- A24B15/40—Treatment of tobacco products or tobacco substitutes by chemical substances by organic substances containing a heterocyclic ring having only oxygen or sulfur as hetero atoms
- A24B15/403—Treatment of tobacco products or tobacco substitutes by chemical substances by organic substances containing a heterocyclic ring having only oxygen or sulfur as hetero atoms having only oxygen as hetero atoms
-
- A—HUMAN NECESSITIES
- A24—TOBACCO; CIGARS; CIGARETTES; SIMULATED SMOKING DEVICES; SMOKERS' REQUISITES
- A24B—MANUFACTURE OR PREPARATION OF TOBACCO FOR SMOKING OR CHEWING; TOBACCO; SNUFF
- A24B3/00—Preparing tobacco in the factory
- A24B3/12—Steaming, curing, or flavouring tobacco
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/02—Separating microorganisms from their culture media
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/14—Fungi; Culture media therefor
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P17/00—Preparation of heterocyclic carbon compounds with only O, N, S, Se or Te as ring hetero atoms
- C12P17/02—Oxygen as only ring hetero atoms
- C12P17/06—Oxygen as only ring hetero atoms containing a six-membered hetero ring, e.g. fluorescein
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Abstract
The invention discloses an isochromene compound, which has the following structure:
the method comprises the steps of carrying out a first treatment on the surface of the The molecular formula of the isochromene compound is as follows: c (C) 14 H 18 O 3 The compound was designated 5-methoxy-3-methyl-7- (-3-hydroxypropyl) -1H isochromene. The invention also discloses a preparation method of the isochromene compound and application of the isochromene compound in improving smoking quality of cigarettes.
Description
Technical Field
The invention belongs to the technical field of natural product chemistry, and particularly relates to an isochromene compound, and a preparation method and application thereof.
Background
The tobacco is rich in symbiotic microorganisms, and the microorganisms play an important role in key links such as tobacco planting, tobacco processing and the like. Such as: in the tobacco planting process, microorganisms play very important roles in improving soil components, decomposing harmful components in soil, resisting diseases of tobacco plants and the like; in the tobacco leaf processing process, the function of the tobacco source microorganism determines that the tobacco source microorganism can change the chemical composition of tobacco to a certain extent, so as to change the taste quality of the tobacco. In addition, the compounds separated and identified in tobacco endogenous fungi have different pharmacological effects, such as antibiosis, antioxidation, anti-tumor, tobacco mosaic virus resistance and the like. Therefore, the research on the metabolic products of the endophytic fungi in tobacco is enhanced, and the method has important scientific significance for discovering the metabolic products of the new skeleton type with remarkable activity.
Chromene compounds have been attracting attention by a wide range of researchers because of their wide range of physiological and pharmacological activities. Such as Vitamin E (Vitamin E), which is a class of fat-soluble chromene compounds, the structure of which comprises four tocopherols and four tocotrienols, is an excellent antioxidant. When vitamin E is deficient, free radicals generated in the metabolic process of human body can cause peroxidation of biomembrane lipid to destroy the structure and function of cell membranes to form lipofuscin; but also denature proteins, inactivate enzymes and hormones, reduce immunity, and promote metabolism disorder, and promote aging or hemolysis of organism. In recent years, research shows that the chromene compound also has the effects of inhibiting acetylcholinesterase and butyrylcholinesterase, treating neurodegenerative diseases such as Parkinson's disease, alzheimer's disease, huntington's disease and the like, reducing gout, treating hyperuricemia, chronic kidney disease, hypertension, atherosclerosis and the like.
The invention aims to provide a novel 1H-isochromene compound separated from a fungus fermentation product of aspergillus versicolor (Aspergillus versicolor) endogenous to cigar tobacco leaves, which has a light ester fragrance. The compound of the invention can be added into cigarette filters to increase the richness of the tobacco fragrance.
Disclosure of Invention
The invention separates and identifies the aspergillus versicolor strain culture solution from cigar tobacco leaves to obtain a novel isochromene compound with ester fragrance, and the compound has no report.
The percentages used in the present invention are mass percentages unless otherwise indicated.
The first aspect of the invention provides an isochromene compound, wherein the molecular formula of the compound is as follows: c (C) 14 H 18 O 3 It has the following structure:
the compound was a pale yellow gum, named: 5-methoxy-3-methyl-7- (-3-hydroxypropyl) -1H isochromene, with the English name: 5-methoxy-3-methyl-7- (3-hydropropyl) -1H-isochromene.
The second aspect of the present invention provides a method for preparing the isochromene compound according to the first aspect, which specifically comprises the following steps:
A. isolation and identification of strains:
isolation of aspergillus versicolor (Aspergillus versicolor): putting 75% (V/V) ethanol sterilized tobacco rootstock into a sterile mortar for grinding, transferring into a sterile plastic tube after grinding, centrifuging at 1000-3000 rpm for 2-10 min, sucking 1-100 microlitres of supernatant, coating on a BL flat plate, inverting in an incubator, culturing in darkness at 25-30 ℃ for 2-10 days, repeatedly picking single colony for purifying culture until a single endophyte colony is obtained, numbering and preserving strains, and determining aspergillus versicolor (Aspergillus versicolor) by ITS sequencing (Genbank Accession number MT549144, GCGGGCTGCCTCCGGGCGCCCAACCTCCCACCCGTGAATACCTAACACTGTTGCTTCGGCGGGGAACCCCCTCGGGGGCGAGCCGCCGGGGACTACTGAACTTCATGCCTGAGAGTGATGCAGTCTGAGTCTGAATATAAAATCAGTCAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAACTGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGCATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCATCAAGCCCGGCTTGTGTGTTGGGTCGTCGTCCCCCCCGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGTGTCCGGTCCTCGAGCGTATGGGGCTTTGTCACCCGCTCGACTAGGGCCGGCCGGGCGCCAGCCGACGTCTCCAACCATTTTTCTTCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAA), wherein single colony and microscopic morphology photographs are shown in the attached figure 1;
B. aspergillus versicolor (Aspergillus versicolor) strain culture
Inoculating the aspergillus versicolor strain separated in the step A on potato dextrose agar culture medium at room temperature, culturing for 7-10 days at 25-30 ℃, inoculating in 50-500 mL triangular flasks, wherein each triangular flask contains 10-100 mL potato dextrose culture medium, and performing shake culture for 5-10 days at 25-30 ℃ to obtain the liquid fermentation strain. The aspergillus versicolor strain YATS1111 is preserved in China general microbiological culture collection center (CGMCCN omicron. 19910) on 6-8 th year 2020.
C. Strain amplified fermentation
And B, carrying out large-scale fermentation on the liquid fermentation seeds obtained by culturing in the step B, wherein the large-scale fermentation is carried out in 100-1000 Feng Bahe bottles with the volume of 0.5-2.0L, and each bottle contains 40-600 g of solid matrix (wheat bran/wheat/corn ratio is 1:3:5) and 50-600 mL of nutrient solution. The nutrient solution comprises the following components: 2.5% of glucose, 0.10% of peptone, 0.6% of potassium nitrate, 0.2% of ammonium dihydrogen phosphate, 0.2% of magnesium sulfate heptahydrate, 1% of compound amino acid, the balance of water and the pH value of a nutrient solution is 6.8. After the solid matrix and the nutrient solution are sterilized under high pressure, 1.0-5.0 mL of the liquid fermentation seed obtained by the culture in the step B is inoculated in each bottle, and the fermentation seed is cultured for 15-45 days at 25-30 ℃ to obtain the aspergillus versicolor fermentation product.
D. Extracting extract:
ultrasonically extracting the aspergillus versicolor ferment obtained in the step C with 90-99wt% ethanol for 2-5 times, each time for 30-50 min, combining the extracting solutions, filtering and concentrating to a small volume, then adding a mixed solution of ethyl acetate and water (ethyl acetate: water=1:1-1:2, volume ratio), fully and uniformly stirring, standing and layering, separating an ethyl acetate phase, concentrating the ethyl acetate phase into an extract under reduced pressure, and obtaining an extraction product for column chromatography separation.
E. Silica gel column chromatography:
loading the extract obtained in the step D into a column by using 200-300 mesh silica gel dry method, and performing silica gel column chromatography; gradient elution is carried out on chloroform-methanol solutions with volume ratios of 10:0, 9:1,8:2,7:3,6:4 and 5:5 respectively, parts with the same polarity are combined, and eluent of each part is collected and concentrated; wherein the mass ratio of the silica gel to the extract is 2-5; collecting an eluent obtained when the chloroform-methanol solution with the volume ratio of 8:2 is used for eluting, wherein the eluent is called a first eluent; concentrating the first eluent, continuing to separate by using a silica gel chromatographic column, performing gradient elution by using a series of chloroform-acetone solutions with volume ratios of 9:1,8:2,7:3,6:4 and 5:5 in sequence, and collecting eluent obtained when the chloroform-acetone solution with the volume ratio of 7:3 is used for eluting, wherein the eluent is called second eluent.
F. High performance liquid chromatography separation
And E, evaporating the solvent of the second eluent finally obtained in the step E, replacing the solvent with methanol, and introducing into a high performance liquid chromatography for separation and purification, wherein the high performance liquid chromatography is carried out by adopting a ZorbaxPREPEREPT GF chromatographic column with the flow rate of 21.2mm multiplied by 250mm and 5 mu m, the flow rate is 20mL/min, the mobile phase is 46wt% of methanol aqueous solution, the detection wavelength of an ultraviolet detector is 332nm, 200 mu L is injected each time, the eluent corresponding to the chromatographic peak retention time of 30.8min after each injection is collected and called a third eluent, and the solvent of the third eluent is removed to obtain the 1H-isochromene compound crude product.
G. Gel column chromatography purification
And D, dissolving the crude product of the isochromene compound obtained in the step F with pure methanol again, and performing sephadex column chromatography separation by taking the methanol as a mobile phase to obtain the pure product of the isochromene compound.
Preferably, in the step D, the concentration of ethanol is 95wt%.
Preferably, in the step E, before the extract is roughly separated by silica gel column chromatography, methanol is used for dissolving, and 80-120 meshes of silica gel with the weight ratio of 1.5-2.5 is used for mixing.
H. Structural identification of compounds
The structure of the 1H-isochromene compound prepared by the method is identified by the following method:
appearance observation finds that: the compound of the invention is a pale yellow jelly; the ultraviolet-visible absorption spectrum shows that the compound has maximum absorption at 210, 265 and 332nm, which proves that the compound has an aromatic ring structure; infrared spectra (potassium bromide tablets) showed that the compound had hydroxyl groups (3396 cm) -1 ) And aromatic rings (1612, 1548, 1466 cm) -1 ) A characteristic functional group; high resolution mass spectrometry (hresis) gives an excimer ion peak 257.1150[ m+na ]] + The molecular formula of the compound can be determined to be C 14 H 18 O 3 The unsaturation was 6.
Bonding of 1 H and 13 c and HSQC NMR data showing that the compound included a 1,2,3, 5-tetrasubstituted benzene ring (C-5-C-10; H-6 and H-8), a 3-hydroxypropyl group (C-12-C-14; H) 2 -12～H 2 -14), a set of double bonds (C-3 and C-4; h-4), one oxymethylene group (C-1; h 2 -1) a methyl group (C-11; h 3 -11), a methoxy group (delta) C 55.8s；δ H 3.74 s). The unsaturation 5 of benzene ring and double bond should also have a ring in the compound to support 6 unsaturations of the compound. From its nuclear magnetic resonance signature, it is inferred that benzene ring, double bond and oxymethylene should form an isochromene of a benzosix-membered ring, and that this can be inferred by H 2 The HMBC correlation of-1 with C-3, C-8, C-9, C-10, H-8 with C-1, H-4 with C-5, C-9, C-10 (FIG. 4) was confirmed; the compounds of the present invention can thus be identified as being of the isochromene backbone type.
After the parent backbone of the compound is determined, the remaining substituent (3-hydroxypropyl, methyl, and methoxy) positions can be determined by further analysis of its HMBC correlation (fig. 4). According to H 2 -12 and C-6, C-7 and C-8,H 2 -13 is associated with HMBC for C-7, confirming that the 3-hydroxypropyl substitution is at the C-7 position. According to H 3 -11 is associated with HMBC of C-3 and C-4, H-4 with C-11, methyl substitution can be confirmedAt the C-3 position; according to methoxy hydrogen (delta) H 3.74 s) was associated with HMBC for C-5, confirming that the methoxy substitution was at the 5-position. Thus, the structure of the compound can be confirmed. The compound is named as 5-methoxy-3-methyl-7- (-3-hydroxypropyl) -1H isochromene, and the English name is: 5-methoxy-3-methyl-7- (3-hydropropyl) -1H-isochromene. .
TABLE 1 Compounds 1 H NMR 13 C NMR data (CDCl) 3 )
Infrared, ultraviolet and mass spectral data for the compounds: UV (methanol), lambda max (log ε) 210 (3.94), 265 (3.72), 332 (3.60) nm; IR (potassium bromide tablet) v max 3396、3043、2932、2870、1635、1612、1548、1466、1382、1248、1156、1072、827cm -1 ； 1 H and 13 c NMR data (CDCl) 3 500 and 125 MHz), table 1; ESIMS (Positive ion mode) m/z 257[ M+Na ]] + The method comprises the steps of carrying out a first treatment on the surface of the HRESIMS (positive ion mode) m/z 257.1150[ M+Na] + (calculated 257.1154, C) 14 H 18 NaO 3 )。
According to a third aspect of the invention, there is provided the use of the isochromene compound of the first aspect for improving smoking quality of cigarettes.
Preferably, the isochromene compound is used for enriching aroma and providing ester aroma in cigarette smoking.
The beneficial effects of the invention are as follows:
1. the compound is separated from fermentation products of the aspergillus versicolor strain in tobacco, and because endophytic fungi are easy to realize batch fermentation production, the raw materials of the compound are easy to obtain; the extraction method of the compound is simple, the compound is easy to separate and obtain, and the industrialized preparation is easy to realize.
2. The 1H-isochromene compound obtained by the invention has the characteristics of elegant ester fragrance, is safe to use when being added into a filter tip, has good style coordination with the product, and can not cause obvious change of the style of cigarettes. Has good application prospect in improving the smoking quality of cigarettes.
3. The isochromene compound has a simple molecular structure, is easy to realize artificial synthesis, and can be used for subsequent industrialization through artificial synthesis.
4. The preparation method adopts a preparation method combining conventional column chromatography and high performance liquid chromatography, the operation flow of compound preparation is simple, the purity of the obtained compound is high, and the quality and purity of the compound in subsequent industrial production are ensured.
Drawings
FIG. 1 is a schematic diagram of Aspergillus versicolor; a is colony morphology; b is microscopic in morphology.
FIG. 2 is a nuclear magnetic resonance carbon spectrum of the isochromene compound.
FIG. 3 shows the nuclear magnetic resonance hydrogen spectrum of the isochromene compound.
Fig. 4 is a main HMBC-related graph of the isochromene compounds.
Detailed Description
The present invention will be further illustrated by the following examples, but is not limited to the examples. Experimental methods, in which specific conditions are not specified in examples, are generally available commercially according to conventional conditions as well as those described in handbooks, or according to general-purpose equipment, materials, reagents, etc. used under conditions suggested by manufacturers, unless otherwise specified. The starting materials required in the examples below are all commercially available.
The raw materials used in the invention are not affected by the type of the culture medium, and the invention is further described below by using an aspergillus versicolor strain culture medium which is separated and identified from cigar tobacco leaves derived from Yunnan:
example 1
The liquid fermentation seeds obtained by culture are subjected to scale fermentation, the scale fermentation is carried out in 100 Feng Bahe bottles of 1.0L, each bottle contains 280g of solid matrix (wheat bran/wheat/corn ratio is 1:3:5) and 280mL of nutrient solution, 5.0mL of the liquid fermentation seeds obtained by culture are inoculated in each bottle, and the aspergillus versicolor fermentation product is obtained by culture at 25-30 ℃ for 30 days. Ultrasonic extracting the fermentation product with 95wt% ethanol for 3 times for 30min each time; mixing the extractive solutions, filtering, concentrating to small volume, adding ethyl acetate and water mixture (ethyl acetate: water=1:1-1:2, volume ratio of 1:1 in this embodiment), stirring, standing for layering, separating ethyl acetate phase, and concentrating under reduced pressure to obtain extract 1.6kg. Mixing the extract with 3.0kg of 80-120 mesh (80 mesh in the embodiment), performing silica gel column chromatography with 8.0kg of 200 mesh silica gel column, performing gradient elution with chloroform-methanol with volume ratio of 10:0, 9:1,8:2,7:3,6:4 and 5:5, performing TLC monitoring, combining the same parts to obtain 6 parts, concentrating chloroform-methanol elution part with volume ratio of 8:2, performing silica gel column chromatography separation again, eluting with chloroform-acetone solution with volume ratio of 9:1,8:2,7:3,6:4 and 1:1 respectively, collecting eluent of 7:3 part, evaporating eluent to dryness, dissolving with methanol, preparing high performance liquid chromatography with An Jielun by using 46wt% methanol aqueous solution as mobile phase, preparing column with Zorbax pH T GF column (21.2×250mm,5 μm) as stationary phase, detecting wavelength of ultraviolet detector of 332nm, performing chromatography for each time, collecting 200 μm peak, and performing dry chromatography for 30 times to obtain crude product; the crude product is dissolved by pure methanol again, and then the pure methanol is taken as a mobile phase, and the pure product of the novel compound is obtained by Sephadex LH-20 gel column chromatography separation.
Example 2
The liquid fermentation seeds obtained by culture are subjected to large-scale fermentation, the large-scale fermentation is carried out in 50 2.5L Feng Bahe bottles, each bottle contains 500g of solid matrix and 500mL of nutrient solution, 10mL of the liquid fermentation seeds obtained by culture are inoculated in each bottle, and the aspergillus versicolor fermentation product is obtained by culturing for 30 days at 25-30 ℃. Ultrasonic extracting the fermentation product with 95wt% ethanol for 3 times for 30min each time; mixing the extracting solutions, filtering the extracting solutions, concentrating to small volume, adding a mixed solution of ethyl acetate and water (ethyl acetate: water=1:1-1:2, volume ratio, 1:2 in the embodiment), fully and uniformly stirring, standing for layering, separating ethyl acetate phase, and concentrating the ethyl acetate phase under reduced pressure to obtain extract 824g. Mixing the extract with 1.6kg of 200 mesh silica gel, performing silica gel column chromatography with 5.0kg of 200 mesh silica gel column, performing gradient elution with chloroform-methanol with volume ratio of 10:0, 9:1,8:2,7:3,6:4 and 5:5, performing TLC monitoring to combine the same parts to obtain 6 parts, concentrating chloroform-methanol elution with volume ratio of 8:2, performing silica gel column chromatography separation again, eluting with chloroform-acetone solution with volume ratio of 9:1,8:2,7:3,6:4 and 1:1 respectively, collecting eluent of 7:3 parts, evaporating eluent to dryness, dissolving with methanol, performing high performance liquid chromatography separation with An Jielun, preparing column with 46wt% methanol aqueous solution as mobile phase with Zorbapbook GF column (21.2×250mm,5 μm) as stationary phase, detecting wavelength of ultraviolet detector of 332nm, performing sample injection of 200 μl each time, collecting chromatographic peak for 30.8min, and evaporating crude product for multiple times to obtain the accumulated dry compound; dissolving the crude product with pure methanol again, and separating with Sephadex LH-20 gel column chromatography with pure methanol as mobile phase to obtain the new compound pure product.
Example 3
The structure of the isochromene compound prepared in example 1 was identified by the following method:
the compound of the invention is a pale yellow jelly; the ultraviolet-visible absorption spectrum shows that the compound has maximum absorption at 210, 265 and 332nm, which proves that the compound has an aromatic ring structure; infrared spectra (potassium bromide tablets) showed that the compound had hydroxyl groups (3396 cm) -1 ) And aromatic rings (1612, 1548, 1466 cm) -1 ) A characteristic functional group; high resolution mass spectrometry (hresis) gives an excimer ion peak 257.1150[ m+na ]] + The molecular formula of the compound can be determined to be C 14 H 18 O 3 The unsaturation was 6.
Bonding of 1 H and 13 c and HSQC NMR data showing that the compound included a 1,2,3, 5-tetrasubstituted benzene ring (C-5-C-10; H-6 and H-8), a 3-hydroxypropyl group (C-12-C-14; H) 2 -12～H 2 -14), a set of double bonds (C-3 and C-4; h-4), one oxymethylene group (C-1; h 2 -1) a methyl group (C-11; h 3 -11), a methoxy group (delta) C 55.8s；δ H 3.74 s). Unsaturation 5 to remove benzene rings and double bonds, there should also be a ring in the compoundTo support 6 unsaturations of the compound. From its nuclear magnetic resonance signature, it is inferred that benzene ring, double bond and oxymethylene should form an isochromene of a benzosix-membered ring, and that this can be inferred by H 2 The HMBC correlation of-1 with C-3, C-8, C-9, C-10, H-8 with C-1, H-4 with C-5, C-9, C-10 (FIG. 4) was confirmed; the compounds of the present invention can thus be identified as being of the isochromene backbone type.
After the parent backbone of the compound is determined, the remaining substituent (3-hydroxypropyl, methyl, and methoxy) positions can be determined by further analysis of its HMBC correlation (fig. 4). According to H 2 -12 and C-6, C-7 and C-8,H 2 -13 is associated with HMBC for C-7, confirming that the 3-hydroxypropyl substitution is at the C-7 position. According to H 3 -11 is associated with HMBC of C-3 and C-4, H-4 is associated with C-11, the methyl substitution at the C-3 position can be confirmed; according to methoxy hydrogen (delta) H 3.74 s) was associated with HMBC for C-5, confirming that the methoxy substitution was at the 5-position. Thus, the structure of the compound can be confirmed. The compound is named as 5-methoxy-3-methyl-7- (-3-hydroxypropyl) -1H isochromene, and the English name is: 5-methoxy-3-methyl-7- (3-hydropropyl) -1H-isochromene.
Example 4
The compound prepared in example 2 was taken as a reddish brown gum. The measurement method was the same as in example 3, and the compound prepared in example 2 was confirmed to be 1H-isochromene compound-5-methoxy-3-methyl-7- (-3-hydroxypropyl) -1H-isochromene.
Application example 1
Taking any isochromene compound prepared in the examples 1-2 for a cigarette filter tip adding experiment, wherein the experiment conditions are as follows:
in view of the fact that glyceryl triacetate is the most commonly used plasticizer for cigarette filter formation, and that the compounds of the present invention are soluble in glyceryl triacetate, the addition of the compounds of the present invention to the filter during the cigarette filter formation is technically easy to achieve without adding additional steps in the production process. The compounds of the invention are therefore added to the filter by dissolution in glycerol triacetate.
The cigarette used for adding is a cigarette sample with A brand, and the chromone compound is prepared into 0.2mg/mL, 0.5mg/mL and 1.0mg/mL solutions by using glycerol triacetate. Uniformly spraying the mixture on the filter tow according to the weight of 5% -8% of the filter tow to prepare a filter stick, rolling the filter stick into cigarettes through conventional cigarettes, carrying out sensory evaluation according to the industry standard YC/T497-2014, chinese style sensory evaluation method for cigarettes, and taking the same cigarettes without the compound as a control. The evaluation results show that: compared with the control, the cigarette filter tip added with the compound has the advantages of increased richness of the smoking aroma and elegant ester aroma.
The foregoing has shown and described the basic principles, principal features and advantages of the invention. It will be understood by those skilled in the art that the present invention is not limited to the embodiments described above, and that the above embodiments and descriptions are merely illustrative of the principles of the present invention, and various changes and modifications may be made without departing from the spirit and scope of the invention, which is defined in the appended claims. The scope of the invention is defined by the appended claims and equivalents thereof.
SEQUENCE LISTING
<110> Yunnan Zhongyan industry Limited liability company
<120> an isochromene compound, and preparation method and application thereof
<130> 2010
<160> 1
<170> PatentIn version 3.3
<210> 1
<211> 533
<212> DNA
<213> Aspergillus versicolor (Aspergillus versicolor)
<400> 1
gcgggctgcc tccgggcgcc caacctccca cccgtgaata cctaacactg ttgcttcggc 60
ggggaacccc ctcgggggcg agccgccggg gactactgaa cttcatgcct gagagtgatg 120
cagtctgagt ctgaatataa aatcagtcaa aactttcaac aatggatctc ttggttccgg 180
catcgatgaa gaacgcagcg aactgcgata agtaatgtga attgcagaat tcagtgaatc 240
atcgagtctt tgaacgcaca ttgcgccccc tggcattccg gggggcatgc ctgtccgagc 300
gtcattgctg cccatcaagc ccggcttgtg tgttgggtcg tcgtcccccc cgggggacgg 360
gcccgaaagg cagcggcggc accgtgtccg gtcctcgagc gtatggggct ttgtcacccg 420
ctcgactagg gccggccggg cgccagccga cgtctccaac catttttctt caggttgacc 480
tcggatcagg tagggatacc cgctgaactt aagcatatca ataagcggag gaa 533
Claims (6)
1. An isochromene compound characterized by having the following structure:
2. the method for producing an isochromene compound according to claim 1, comprising the steps of:
(1) Extracting extract: performing solid fermentation on aspergillus versicolor YATS1111 separated from cigar tobacco leaves, ultrasonically extracting a fermentation product by using 90-99wt% of ethanol, filtering, concentrating, adding a mixed solution of ethyl acetate and water, fully stirring and uniformly mixing, standing and layering, and separating an ethyl acetate phase; concentrating the ethyl acetate phase under reduced pressure to obtain extract; the aspergillus versicolor strain YATS1111 is preserved in China general microbiological culture Collection center (CGMCC) with the preservation number of CGMCC No.19910;
in the mixed solution of ethyl acetate and water, the volume ratio of the ethyl acetate to the water is 1:1-1:2;
(2) Silica gel column chromatography: filling the extract obtained in the step (1) into a column by using 200-300 mesh silica gel dry method; the mass ratio of the silica gel to the extract is 2-5; gradient elution is carried out on chloroform-methanol solutions with volume ratios of 10:0, 9:1,8:2,7:3,6:4 and 5:5 respectively, parts with the same polarity are combined, and eluent of each part is collected and concentrated; collecting an eluent obtained when the chloroform-methanol solution with the volume ratio of 8:2 is used for eluting, and the eluent is called a first eluent; concentrating the first eluent, continuing to separate by using a silica gel chromatographic column again, performing gradient elution by using chloroform-acetone solutions with volume ratios of 9:1,8:2,7:3,6:4 and 5:5 in sequence, and collecting eluent obtained when the chloroform-acetone solution with the volume ratio of 7:3 is used for eluting, wherein the eluent is called second eluent;
(3) High performance liquid chromatography separation: evaporating the second eluent obtained in the step (2) to remove the solvent, replacing the solvent with methanol, and introducing into a high performance liquid chromatography for separation and purification, wherein the high performance liquid chromatography separation and purification adopts a ZorbaxPRESET GF chromatographic column with the flow rate of 20mL/min and the mobile phase of 46wt% of methanol aqueous solution and the detection wavelength of 332nm; collecting eluent corresponding to 200 mu L of sample injection every time and keeping chromatographic peak retention time of 30.8min after sample injection every time, namely third eluent, and removing solvent from the third eluent to obtain the crude product of the isochromene compound;
(4) Dissolving the crude product of the isochromene compound in the step (3) with methanol again, and performing sephadex column chromatography separation by taking methanol as a mobile phase to obtain the pure product of the isochromene compound.
3. The method of claim 2, wherein the step of solid fermentation of aspergillus versicolor YATS1111 in step (1) comprises: inoculating the separated aspergillus versicolor strain on a potato dextrose agar culture medium at room temperature, culturing for 7-10 days at 25-30 ℃, inoculating in a triangular flask, and culturing for 5-10 days at 25-30 ℃ in a shaking way to obtain liquid fermentation seeds; each triangular flask contains 10-100 mL of potato dextrose culture medium;
carrying out scale fermentation on the liquid fermentation seeds, wherein the scale fermentation is carried out in 100-1000 Feng Bahe bottles with the volume of 0.5-2.0L, and each bottle contains 400-600 g of solid matrix and 60-400 mL of nutrient solution; the nutrient solution comprises the following components: 2.5wt% of glucose, 0.10wt% of peptone, 0.6wt% of potassium nitrate, 0.2wt% of monoammonium phosphate, 0.2wt% of magnesium sulfate heptahydrate, 1wt% of compound amino acid, and the balance of water;
the solid matrix comprises wheat bran, wheat and corn in a ratio of 1:3:5.
4. The process according to claim 2, wherein the concentration of ethanol in step (1) is 95wt%.
5. The preparation method according to claim 2, wherein in the step (2), the extract is mixed with 80-120 mesh silica gel in an amount of 1.5-2.5 times by weight after being dissolved in methanol before being roughly separated by silica gel column chromatography.
6. Use of the isochromene compounds according to claim 1 for improving smoking quality of cigarettes, wherein the isochromene compounds are used for enriching aroma and providing ester aroma in smoking of cigarettes.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210244625.7A CN114805276B (en) | 2022-03-14 | 2022-03-14 | Isochromene compound and preparation method and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210244625.7A CN114805276B (en) | 2022-03-14 | 2022-03-14 | Isochromene compound and preparation method and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN114805276A CN114805276A (en) | 2022-07-29 |
| CN114805276B true CN114805276B (en) | 2023-07-14 |
Family
ID=82529841
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202210244625.7A Active CN114805276B (en) | 2022-03-14 | 2022-03-14 | Isochromene compound and preparation method and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN114805276B (en) |
Family Cites Families (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105481818B (en) * | 2015-11-20 | 2018-10-26 | 云南中烟工业有限责任公司 | A kind of flavouring humectation isocoumarin class compound and its preparation method and application |
| US10863758B2 (en) * | 2016-07-29 | 2020-12-15 | Bedoukian Research, Inc. | Fragrance and flavor compositions containing isomeric alkadienyl esters |
| US10077414B2 (en) * | 2016-07-29 | 2018-09-18 | Bedoukian Research, Inc. | Fragrance compositions containing isomeric alkoxynonenols |
| CN106565649B (en) * | 2016-10-18 | 2018-09-28 | 云南中烟工业有限责任公司 | A kind of benzo lactone compound, preparation method and the application in cigarette filter flavoring |
-
2022
- 2022-03-14 CN CN202210244625.7A patent/CN114805276B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN114805276A (en) | 2022-07-29 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN114409660B (en) | CPA type indole alkaloid compound and preparation method and application thereof | |
| CN114456102A (en) | Indole alkaloid compound and preparation method and application thereof | |
| WO2013155868A1 (en) | Method for increasing yield of total flavonoids in ganoderma lucidum mycelium | |
| CN107586721B (en) | Benzophenone compound with antioxidant activity and preparation method and application thereof | |
| CN107893033B (en) | Aspergillus fumigatus SQH4 and application thereof in preparation of taxifolin by biotransformation method | |
| CN114805276B (en) | Isochromene compound and preparation method and application thereof | |
| CN102226152B (en) | Cylindrocarpon didymium and method for preparing ginsenoside Rh2 by using same | |
| CN115286561B (en) | Indole alkaloid compound in gene editing tobacco, and preparation method and application thereof | |
| CN114409661B (en) | Indole alkaloid compound and preparation method and application thereof | |
| CN114920723B (en) | Chromene compound with antioxidant activity and preparation method and application thereof | |
| CN114982763A (en) | New use of geldanamycin and its analogue | |
| CN102337308A (en) | Method for converting bergenin into special nitrogenous derivative by using penicillium | |
| CN108441427B (en) | Arthriospora fungi and pyridone alkaloid compound produced by same | |
| CN110229131B (en) | Benzopyrone derivative derived from cerasus humilis endophytic fungi as well as preparation method and application thereof | |
| CN109503613B (en) | Gryllus chinensis bipolaris staurosporine I and preparation method and application thereof, and Gryllus chinensis bipolaris staurosporine J and preparation method and application thereof | |
| CN109180593B (en) | Phenolic oxazine alkaloid secondary metabolite and application thereof | |
| CN107686492A (en) | A kind of method of rhodioside in extraction purification zymotic fluid using macroporous absorbent resin | |
| CN102329829B (en) | Method for converting daidzein into 8-hydroxydaidzein by utilizing penicillium | |
| CN115583953B (en) | Quinazolinone alkaloid compound, and preparation method and application thereof | |
| CN115557960B (en) | Isopentenyl indole alkaloid compound and preparation method and application thereof | |
| JP3719689B2 (en) | Novel substance triprostatin, process for producing the same, cell cycle inhibitor and antitumor agent | |
| CN117510441B (en) | Ketone compound penlactone A with plant pathogen resisting activity and preparation method thereof | |
| CN114605247B (en) | Diterpenoid derivative, preparation method thereof, analgesic, and ethyl acetate extract of fermentation product of Pleurotus cornucopiae | |
| CN108660169A (en) | A method of fermentation prepares spine spore bacteriums antibiotic | |
| CN113278545B (en) | Streptomyces mutant and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |