CN114805276A

CN114805276A - Isochromene compound and preparation method and application thereof

Info

Publication number: CN114805276A
Application number: CN202210244625.7A
Authority: CN
Inventors: 肖冬; 张伟; 阴耕云; 朱玲超; 师建全; 樊瑛; 张贵平; 王晋; 王凯; 王明锋
Original assignee: China Tobacco Yunnan Industrial Co Ltd
Current assignee: China Tobacco Yunnan Industrial Co Ltd
Priority date: 2022-03-14
Filing date: 2022-03-14
Publication date: 2022-07-29
Anticipated expiration: 2042-03-14
Also published as: CN114805276B

Abstract

The invention discloses an isochromene compound, which has the following structure:

the molecular formula of the isochromene compounds is as follows: c ₁₄ H ₁₈ O ₃ The compound is named as 5-methoxy-3-methyl-7- (-3-hydroxypropyl) -1H isochromene. The invention also discloses a preparation method of the isochromene compounds and application of the isochromene compounds in improving the smoking quality of cigarettes.

Description

Isochromene compound and preparation method and application thereof

Technical Field

The invention belongs to the technical field of natural product chemistry, and particularly relates to an isochromene compound and a preparation method and application thereof.

Background

The tobacco is rich in symbiotic microorganisms, and the microorganisms play an important role in key links such as tobacco planting, tobacco processing and the like. Such as: in the tobacco planting process, the microorganisms play a very important role in the aspects of soil component improvement, decomposition of harmful components in soil, disease resistance of tobacco plants and the like; in the tobacco processing process, the function of the tobacco-derived microorganisms determines that the tobacco-derived microorganisms can change the chemical composition of tobacco to a certain extent, and further change the smoking quality of the tobacco. In addition, the compounds separated and identified from the tobacco endogenous fungi have different pharmacological effects, such as antibiosis, antioxidation, antitumor, tobacco mosaic virus resistance and the like. Therefore, the research of strengthening the tobacco endophytic fungi metabolite has important scientific significance for finding new skeleton type metabolites with remarkable activity.

Chromene compounds are concerned by researchers because of their wide physiological and pharmacological activities. For example, vitamin e (vitamin e), a class of fat-soluble chromene compounds, whose structure includes four tocopherols and four tocotrienols, is an excellent antioxidant. When vitamin E is deficient, free radicals generated in the metabolic process of a human body can cause the peroxidation of biomembrane lipid and destroy the structure and the function of a cell membrane to form lipofuscin; and can denature protein, inactivate enzyme and hormone, reduce immunity, prevent metabolism disorder, and promote aging or hemolysis. Research in recent years shows that the chromene compound also has various effects of inhibiting acetylcholinesterase and butyrylcholinesterase, treating neurodegenerative diseases such as Parkinson's disease, Alzheimer's disease, Huntington's disease and the like, reducing gout, treating hyperuricemia, chronic kidney disease, hypertension, atherosclerosis and the like.

The invention aims to provide a novel 1H-isochromene compound separated from an endogenous Aspergillus versicolor (Aspergillus versicolor) fungus fermentation product of cigar tobacco leaves, and the compound has a light and elegant ester fragrance. The compound of the invention is added into cigarette filters, so that the richness of cigarette fragrance can be increased.

Disclosure of Invention

The invention separates and identifies the culture solution of the aspergillus versicolor strain in the cigar tobacco leaf to obtain a novel isochromene compound with ester fragrance, and the compound has not been reported yet.

All percentages used in the present invention are mass percentages unless otherwise indicated.

In a first aspect, the present invention provides an isochromene compound of the formula: c ₁₄ H ₁₈ O ₃ Which has the following structure:

the compound was a pale yellow gum, designated: 5-methoxy-3-methyl-7- (-3-hydroxypropyl) -1H isochromene, the English name is: 5-methoxy-3-methyl-7- (3-hydroxypyropy) -1H-isochromene.

The second aspect of the present invention provides the method for preparing an isochromene compound according to the first aspect, specifically comprising the steps of:

A. and (3) strain separation and identification:

isolation of Aspergillus versicolor (Aspergillus versicolor): putting 75% (V/V) ethanol-sterilized tobacco roots into a sterile mortar for grinding, transferring the ground tobacco roots into a sterile plastic tube, centrifuging at 1000-3000 rpm for 2-10 min, sucking 1-100 microliters of supernatant, coating the supernatant on a BL (BL) flat plate, inverting the ground tobacco roots in an incubator, performing dark culture at 25-30 ℃ for 2-10 days, repeatedly selecting a single colony, performing purification culture until a single endophytic fungus colony is obtained, numbering and preserving strains, determining the strain to be Aspergillus versicolor (Aspergillus versicolor) by ITS sequencing (Genbank Accession number MT549144, GCGGGCTGCCTCCGGGCGCCCAACCTCCCACCCGTGAATACCTAACACTGTTGCTTCGGCGGGGAACCCCCTCGGGGGCGAGCCGCCGGGGACTACTGAACTTCATGCCTGAGAGTGATGCAGTCTGAGTCTGAATATAAAATCAGTCAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAACTGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGCATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCATCAAGCCCGGCTTGTGTGTTGGGTCGTCGTCCCCCCCGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGTGTCCGGTCCTCGAGCGTATGGGGCTTTGTCACCCGCTCGACTAGGGCCGGCCGGGCGCCAGCCGACGTCTCCAACCATTTTTCTTCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAA), wherein the single colony and the micro-morphological picture of the Aspergillus versicolor are shown in the attached figure 1;

B. aspergillus versicolor strain culture

Inoculating the aspergillus versicolor strain separated in the step A on a potato glucose agar culture medium at room temperature, culturing for 7-10 days at 25-30 ℃, then inoculating in 50-500 mL triangular bottles, wherein each triangular bottle contains 10-100 mL of potato glucose culture medium, and placing at 25-30 ℃ for shake culture for 5-10 days to obtain a liquid fermentation strain. The aspergillus versicolor strain YATS1111 is preserved in China general microbiological culture collection center on 6-8.2020, with the preservation number of CGMCC No. 19910.

C. Amplifying fermentation of strain

And C, performing large-scale fermentation on the liquid fermentation seeds obtained by the culture in the step B, wherein the large-scale fermentation is performed in 100-1000 von Bashel bottles of 0.5-2.0L, and each bottle contains 40-600 g of solid matrix (the ratio of wheat bran to wheat to corn is 1:3:5) and 50-600 mL of nutrient solution. The nutrient solution comprises the following components: 2.5 percent of glucose, 0.10 percent of peptone, 0.6 percent of potassium nitrate, 0.2 percent of ammonium dihydrogen phosphate, 0.2 percent of magnesium sulfate heptahydrate, 1 percent of compound amino acid and the balance of water, wherein the pH value of the nutrient solution is 6.8. And (3) after the solid matrix and the nutrient solution are subjected to high-pressure sterilization, inoculating 1.0-5.0 mL of liquid fermentation seeds obtained by the culture in the step (B) into each bottle, and culturing at 25-30 ℃ for 15-45 days to obtain the aspergillus versicolor fermented product.

D. Extracting the extractum:

and C, ultrasonically extracting the aspergillus versicolor fermented product obtained by fermentation in the step C for 2-5 times by using 90-99 wt% of ethanol, extracting for 30-50 min each time, combining the extracting solutions, filtering and concentrating to a small volume, then adding a mixed solution of ethyl acetate and water (the volume ratio of ethyl acetate to water is 1:1-1: 2) into the concentrated solution, fully and uniformly stirring, standing for layering, separating out an ethyl acetate phase, carrying out decompression and concentration on the ethyl acetate phase to obtain an extract, and carrying out column chromatography separation on the extracted product.

E. Silica gel column chromatography:

d, filling the extract obtained in the step D into a column by using a 200-300-mesh silica gel dry method, and performing silica gel column chromatography; gradient eluting with chloroform-methanol solution at volume ratio of 10:0, 9:1,8:2,7:3,6:4, and 5:5 respectively, mixing the parts with the same polarity, collecting eluate of each part, and concentrating; wherein the mass ratio of the silica gel to the extract is 2-5; collecting an eluent obtained when chloroform-methanol solution with the volume ratio of 8:2 is used for elution, and calling the eluent as a first eluent; concentrating the first eluent, separating with silica gel chromatographic column, gradient eluting with a series of chloroform-acetone solutions at volume ratio of 9:1,8:2,7:3,6:4 and 5:5, collecting eluate obtained by eluting with chloroform-acetone solution at volume ratio of 7:3, and making into second eluent.

F. High performance liquid chromatography separation

And D, evaporating the solvent of the second eluent finally obtained in the step E, replacing the solvent of the second eluent with methanol, introducing into a high performance liquid chromatography for separation and purification, wherein the high performance liquid chromatography is to adopt a Zorba xPrepHT GF chromatographic column with the size of 21.2mm multiplied by 250mm and the size of 5 mu m, the flow rate is 20mL/min, the mobile phase is 46 wt% of methanol aqueous solution, the detection wavelength of an ultraviolet detector is 332nm, 200 mu L of sample injection is carried out each time, the eluent corresponding to the chromatographic peak retention time of 30.8min after sample injection is collected each time is called as a third eluent, and the third eluent is subjected to solvent removal to obtain the crude product of the 1H-isochromene compound.

G. Purifying by gel column chromatography

And D, dissolving the crude isochromene compound obtained in the step F by using pure methanol again, and performing sephadex column chromatography separation by using the methanol as a mobile phase to obtain the pure isochromene compound.

Preferably, in the step D, the concentration of the ethanol is 95 wt%.

Preferably, in the step E, before the extract is roughly separated by silica gel column chromatography, the extract is dissolved by methanol and then mixed with 80-120 mesh silica gel with the weight ratio of 1.5-2.5 times.

H. Structural identification of compounds

The structure of the 1H-isochromene compounds prepared by the above method is identified by the following method:

the appearance observation shows that: the compounds of the invention are pale yellow gums; the ultraviolet-visible absorption spectrum shows that the compound has maximum absorption at 210 nm, 265 nm and 332nm, and the existence of an aromatic ring structure in the compound is proved; infrared spectroscopy (Potassium bromide pellets) showed the presence of hydroxyl groups (3396 cm) in the compound ^-1 ) And aromatic rings (1612, 1548, 1466 cm) ^-1 ) A characteristic functional group; high resolution mass spectrometry (HRESIMS) gave an excimer ion peak 257.1150[ M + Na ]] ⁺ It can be confirmed that the compound has the formula C ₁₄ H ₁₈ O ₃ The unsaturation degree was 6.

Bonding of ¹ H and ¹³ NMR data of C and HSQC show that the compound comprises a 1,2,3, 5-tetra-substituted benzene ring (C-5-C-10; H-6 and H-8) and a 3-hydroxypropyl (C)-12～C-14；H ₂ -12～H ₂ -14), a set of double bonds (C-3 and C-4; h-4), one oxymethylene group (C-1; h ₂ -1), one methyl group (C-11; h ₃ -11), one methoxy group (δ) _C 55.8s；δ _H 3.74 s). In addition to the 5 degree of unsaturation on the benzene ring and the double bond, there should also be one ring in the compound to support the 6 degrees of unsaturation of the compound. It is deduced from the NMR signal characteristics that the benzene ring, the double bond and the oxomethylene group should form an isochromene of a benzo-six-membered ring, and the inference can be made by H ₂ The correlation of 1 with C-3, C-8, C-9, C-10, H-8 with C-1, H-4 with C-5, C-9, C-10 HMBC was confirmed (FIG. 4); the compounds of the invention can therefore be identified as an isochromene backbone type.

After the parent backbone of the compound was determined, the positions of the remaining substituents (3-hydroxypropyl, methyl and methoxy) were determined by further analysis of their HMBC associations (fig. 4). According to H ₂ 12 with C-6, C-7 and C-8, H ₂ 13 in relation to HMBC at C-7, it was confirmed that the 3-hydroxypropyl substitution was at the C-7 position. According to H ₃ 11 in relation to HMBC at C-3 and C-4, H-4 in relation to C-11, the methyl substitution at C-3 can be confirmed; according to methoxy hydrogen (. delta.) _H 3.74s) was associated with HMBC at C-5, confirming the methoxy substitution at position 5. Thus, the structure of the compound can be confirmed. The compound is named as 5-methoxy-3-methyl-7- (-3-hydroxypropyl) -1H isochromene, and English name is as follows: 5-methoxy-3-methyl-7- (3-hydroxypyropy) -1H-isochromene. .

TABLE 1 preparation of the compounds ¹ H NMR and ¹³ c NMR data (CDCl) ₃ )

Infrared, ultraviolet and mass spectral data of compounds: UV (methanol), lambda _max (log ε)210(3.94), 265(3.72), 332(3.60) nm; IR (Potassium bromide tablet) v _max 3396、3043、2932、2870、1635、1612、1548、1466、1382、1248、1156、1072、827cm ^-1 ； ¹ H and ¹³ c NMR data (CDCl) ₃ 500 and 125MHz), table 1; ESIMS (Positive)Ion mode) M/z 257[ M + Na ]] ⁺ (ii) a HRESIMS (Positive ion mode) M/z 257.1150[ M + Na [)] ⁺ (calculated 257.1154, C ₁₄ H ₁₈ NaO ₃ )。

In a third aspect, the invention provides the use of the isochromene compounds of the first aspect for improving the smoking quality of a cigarette.

Preferably, the isochromene compounds are used for enriching aroma and providing ester aroma in cigarette smoking.

The invention has the following beneficial effects:

1. the compound is obtained by separating from a fermentation product of an aspergillus versicolor strain in tobacco, and the compound is easy to obtain raw materials because mass fermentation production of endophytic fungi is easy to realize; the extraction method of the compound is simple, the compound is easy to separate and obtain, and the industrial preparation is easy to realize.

2. The 1H-isochromene compound obtained by the invention has the characteristics of elegant ester fragrance, is safe to use when being added into a filter tip, has good style harmony with the product per se, and cannot cause obvious change to the style of cigarettes. Has good application prospect in improving the smoking quality of the cigarettes.

3. The isochromene compound of the invention has simple molecular structure, is easy to realize artificial synthesis, and can realize subsequent industrialization by artificial synthesis.

4. The preparation method provided by the invention adopts a preparation method combining conventional column chromatography and high performance liquid chromatography, the preparation operation flow of the compound is simple, the purity of the obtained compound is high, and the quality and purity of the compound in subsequent industrial production can be guaranteed.

Drawings

FIG. 1 is a schematic view of Aspergillus versicolor; a is colony morphology; b is microscopic morphology.

FIG. 2 is a nuclear magnetic resonance carbon spectrum of the isochromene compound.

FIG. 3 is a nuclear magnetic resonance hydrogen spectrum of the isochromene compound.

FIG. 4 is the main HMBC correlation of the isochromene compounds.

Detailed Description

The present invention is further illustrated by the following examples, but is not limited to these examples. The experimental methods in which specific conditions are not specified in examples are generally commercially available under the conventional conditions and the conditions described in the manual, or under the general-purpose equipment, materials, reagents and the like used under the conditions recommended by the manufacturer, unless otherwise specified. The starting materials required in the following examples are all commercially available.

The raw materials used in the invention are not affected by the type of the culture medium, and the invention is further explained by the culture medium of the aspergillus versicolor strain separated and identified from the cigar tobacco leaves in Yunnan:

example 1

And (3) performing large-scale fermentation on the liquid fermentation seeds obtained by culture in 100 von Bashel bottles of 1.0L, wherein each bottle contains 280g of solid matrix (the ratio of wheat bran to wheat to corn is 1:3:5) and 280mL of nutrient solution, inoculating 5.0mL of liquid fermentation seeds obtained by culture in each bottle, and culturing at 25-30 ℃ for 30 days to obtain the aspergillus versicolor fermentation product. Ultrasonically extracting the fermentation product with 95 wt% ethanol for 3 times, each time for 30 min; mixing extractive solutions, filtering, concentrating to small volume, adding mixed solution of ethyl acetate and water (ethyl acetate: water: 1:2, volume ratio, in this example 1:1), stirring, standing for layering, separating ethyl acetate phase, and concentrating under reduced pressure to obtain extract 1.6 kg. Mixing the extract with 3.0kg of 80-120 mesh (80 mesh in the embodiment), loading into a 200 mesh silica gel column with 8.0kg of silica gel, performing silica gel column chromatography, performing gradient elution with chloroform-methanol at volume ratio of 10:0, 9:1,8:2,7:3,6:4 and 5:5, monitoring by TLC, combining the same parts to obtain 6 parts, concentrating the chloroform-methanol elution part at volume ratio of 8:2, performing silica gel column chromatography again, eluting with chloroform-acetone solution at volume ratio of 9:1,8:2,7:3,6:4 and 1:1, collecting the eluate of 7:3 part, evaporating the eluate, dissolving with methanol, preparing high performance liquid chromatography with Agilent 1100, preparing a high performance liquid chromatography with 46 wt% methanol water solution as mobile phase, preparing a Zorbax ParepHT column (21.2 x 250mm,5 μm) as stationary phase, the flow rate is 20mL/min, the wavelength detected by an ultraviolet detector is 332nm, 200 mu L of sample is injected each time, a chromatographic peak of 30.8min is collected, and a crude compound can be obtained by evaporation after multiple accumulation; and dissolving the obtained crude product by using pure methanol again, taking the pure methanol as a mobile phase, and separating by using Sephadex LH-20 gel column chromatography to obtain a pure product of the novel compound.

Example 2

And (3) performing large-scale fermentation on the liquid fermentation seeds obtained by culture in 50 von Bashel bottles of 2.5L, wherein each bottle contains 500g of solid matrix and 500mL of nutrient solution, inoculating 10mL of liquid fermentation seeds obtained by culture in each bottle, and culturing at 25-30 ℃ for 30 days to obtain the aspergillus versicolor fermented product. Ultrasonically extracting the fermentation product with 95 wt% ethanol for 3 times, each time for 30 min; mixing the extractive solutions, filtering, concentrating to small volume, adding mixed solution of ethyl acetate and water (ethyl acetate: water at volume ratio of 1:1-1:2, in this example 1:2), stirring, standing for layering, separating ethyl acetate phase, and concentrating under reduced pressure to obtain extract 824 g. Mixing the extract with 1.6kg of 200-mesh silica gel, loading the extract into a column with 5.0kg of 200-mesh silica gel, performing silica gel column chromatography, performing gradient elution with chloroform-methanol at volume ratio of 10:0, 9:1,8:2,7:3,6:4 and 5:5, monitoring by TLC, combining the same parts to obtain 6 parts, concentrating the chloroform-methanol elution part at volume ratio of 8:2, performing silica gel column chromatography again, eluting with chloroform-acetone solution at volume ratio of 9:1,8:2,7:3,6:4 and 1:1, collecting eluate at 7:3, evaporating the eluate, dissolving with methanol, preparing high performance liquid chromatography with Agilent 1100, using 46 wt% methanol water solution as mobile phase, preparing column with ZorbaxPrepHT GF (21.2 × 250mm,5 μm) as stationary phase at flow rate of 20mL/min, detecting wavelength of 332nm with ultraviolet detector, introducing 200 μ L each time, collecting 30.8min chromatographic peak, accumulating for multiple times, and evaporating to obtain crude compound; dissolving the obtained crude product with pure methanol again, taking the pure methanol as a mobile phase, and carrying out Sephadex LH-20 gel column chromatography separation to obtain the pure product of the new compound.

Example 3

The structure of the isochromene compound prepared in example 1 was identified by the following method:

the compounds of the invention are pale yellow gums; the ultraviolet-visible absorption spectrum shows that the compound has maximum absorption at 210 nm, 265 nm and 332nm, and the existence of an aromatic ring structure in the compound is proved; infrared spectroscopy (Potassium bromide pellets) showed the presence of hydroxyl groups (3396 cm) in the compound ^-1 ) And aromatic rings (1612, 1548, 1466 cm) ^-1 ) A characteristic functional group; high resolution mass spectrometry (HRESIMS) gave an excimer ion peak 257.1150[ M + Na ]] ⁺ Determining the formula of the compound as C ₁₄ H ₁₈ O ₃ The unsaturation degree was 6.

Bonding of ¹ H and ¹³ NMR data of C and HSQC show that the compound comprises a 1,2,3, 5-tetra-substituted benzene ring (C-5-C-10; H-6 and H-8), and a 3-hydroxypropyl (C-12-C-14; H-12) ₂ -12～H ₂ -14), a set of double bonds (C-3 and C-4; h-4), one oxymethylene group (C-1; h ₂ -1), one methyl group (C-11; h ₃ -11), one methoxy group (δ) _C 55.8s；δ _H 3.74 s). In addition to the 5 degree of unsaturation on the benzene ring and the double bond, there should also be one ring in the compound to support the 6 degrees of unsaturation of the compound. It is deduced from the NMR signal characteristics that the benzene ring, the double bond and the oxomethylene group should form an isochromene of a benzo-six-membered ring, and the inference can be made by H ₂ The correlation of 1 with C-3, C-8, C-9, C-10, H-8 with C-1, H-4 with C-5, C-9, C-10 HMBC was confirmed (FIG. 4); the compounds of the invention can therefore be identified as an isochromene backbone type.

After the parent backbone of the compound was determined, the positions of the remaining substituents (3-hydroxypropyl, methyl and methoxy) were determined by further analysis of their HMBC associations (fig. 4). According to H ₂ 12 with C-6, C-7 and C-8, H ₂ 13 in relation to HMBC at C-7, it was confirmed that the 3-hydroxypropyl substitution was at the C-7 position. According to H ₃ 11 in relation to HMBC at C-3 and C-4, H-4 in relation to C-11, the methyl substitution at C-3 can be confirmed; according to methoxy hydrogen (. delta.) _H 3.74s) was associated with HMBC at C-5, confirming the methoxy substitution at position 5. Thus, the structure of the compound can be confirmed. The compound is named as 5-methoxy-3-methyl-7- (-3-hydroxypropyl) -1H isochromene and English nameComprises the following steps: 5-methoxy-3-methyl-7- (3-hydroxypyropy) -1H-isochromene.

Example 4

The compound prepared in example 2 was taken as a red-brown gum. The determination method was the same as in example 3, and it was confirmed that the compound prepared in example 2 was 5-methoxy-3-methyl-7- (-3-hydroxypropyl) -1H isochromene, which is a 1H-isochromene compound.

Application example 1

Any of the isochromene compounds prepared in examples 1-2 was subjected to a cigarette filter addition experiment under the following test conditions:

considering that the triacetin is the most commonly used plasticizer for cigarette filter forming, and the compound is dissolved in the triacetin, the compound is added into the filter through the triacetin in the cigarette filter forming process, so that the process is easy to realize, and no additional step is added in the production process. The compound of the invention is therefore added to the filter by dissolving in triacetin.

The cigarettes for adding are A-brand cigarette samples, and the chromone compounds are prepared into solutions of 0.2mg/mL, 0.5mg/mL and 1.0mg/mL by using glycerol triacetate. Uniformly spraying the mixture on filter tow according to 5-8% of the weight of the filter tow to prepare a filter stick, then rolling and connecting the filter stick into a cigarette through a conventional cigarette, carrying out sensory evaluation according to an industry standard YC/T497 and 2014, a Chinese style sensory evaluation method of cigarettes, and taking the same cigarette without the compound as a reference. The evaluation and analysis result shows that: compared with the contrast, the cigarette added with the compound has the advantages that the smoking fragrance richness of the cigarette is increased, and the cigarette has the elegant ester fragrance characteristic.

The foregoing shows and describes the general principles, essential features, and advantages of the invention. It will be understood by those skilled in the art that the present invention is not limited to the embodiments described above, which are described in the specification and illustrated only to illustrate the principle of the present invention, but that various changes and modifications may be made therein without departing from the spirit and scope of the present invention, which fall within the scope of the invention as claimed. The scope of the invention is defined by the appended claims and equivalents thereof.

SEQUENCE LISTING

<110> tobacco industry Limited liability company in Yunnan

<120> isochromene compound and preparation method and application thereof

<130> 2010

<160> 1

<170> PatentIn version 3.3

<210> 1

<211> 533

<212> DNA

<213> Aspergillus versicolor (Aspergillus versicolor)

<400> 1

gcgggctgcc tccgggcgcc caacctccca cccgtgaata cctaacactg ttgcttcggc 60

ggggaacccc ctcgggggcg agccgccggg gactactgaa cttcatgcct gagagtgatg 120

cagtctgagt ctgaatataa aatcagtcaa aactttcaac aatggatctc ttggttccgg 180

catcgatgaa gaacgcagcg aactgcgata agtaatgtga attgcagaat tcagtgaatc 240

atcgagtctt tgaacgcaca ttgcgccccc tggcattccg gggggcatgc ctgtccgagc 300

gtcattgctg cccatcaagc ccggcttgtg tgttgggtcg tcgtcccccc cgggggacgg 360

gcccgaaagg cagcggcggc accgtgtccg gtcctcgagc gtatggggct ttgtcacccg 420

ctcgactagg gccggccggg cgccagccga cgtctccaac catttttctt caggttgacc 480

tcggatcagg tagggatacc cgctgaactt aagcatatca ataagcggag gaa 533

Claims

1. An isochromene compound having the structure:

2. the process for producing an isochromene compound according to claim 1, comprising the steps of:

(1) extracting the extractum: carrying out solid fermentation on aspergillus versicolor YATS1111 separated from cigar tobacco leaves, ultrasonically extracting a fermentation product by using 90-99 wt% of ethanol, filtering and concentrating, then adding a mixed solution of ethyl acetate and water, fully stirring and uniformly mixing, standing and layering to separate an ethyl acetate phase; concentrating the ethyl acetate phase under reduced pressure to obtain extract; the aspergillus versicolor strain YATS1111 is preserved in the common microorganism center of China Committee for culture Collection of microorganisms with the preservation number of CGMCC No. 19910;

in the mixed solution of ethyl acetate and water, the volume ratio of ethyl acetate to water is 1:1-1: 2;

(2) silica gel column chromatography: filling the extract obtained in the step (1) into a column by using a 200-300-mesh silica gel dry method; the mass ratio of the silica gel to the extract is 2-5; gradient eluting with chloroform-methanol solution at volume ratio of 10:0, 9:1,8:2,7:3,6:4, and 5:5 respectively, mixing the parts with the same polarity, collecting eluate of each part, and concentrating; collecting an eluent obtained when the eluent is eluted by chloroform-methanol solution with the volume ratio of 8:2, and the eluent is called as a first eluent; concentrating the first eluent, continuously separating by using a silica gel chromatographic column, performing gradient elution by using chloroform-acetone solutions with volume ratios of 9:1,8:2,7:3,6:4 and 5:5 in sequence, and collecting eluent obtained when the chloroform-acetone solutions with volume ratios of 7:3 are used for elution, wherein the eluent is called as second eluent;

(3) high performance liquid chromatography separation: evaporating the solvent of the second eluent obtained in the step (2) to dryness, replacing the solvent with methanol, introducing into a high performance liquid chromatography for separation and purification, wherein the high performance liquid chromatography is used for separation and purification by adopting a ZorbaxPrepHT GF chromatographic column with the thickness of 21.2mm multiplied by 250mm and the thickness of 5 mu m, the flow rate is 20mL/min, the mobile phase is a 46 wt% methanol aqueous solution, and the detection wavelength of an ultraviolet detector is 332 nm; injecting 200 mu L of sample each time, collecting corresponding eluent when the retention time of chromatographic peak is 30.8min after each sample injection, and obtaining the crude product of the isochromene compound after removing solvent from the third eluent;

(4) and (4) dissolving the crude isochromene compound in the step (3) by using methanol again, and performing sephadex column chromatography separation by using the methanol as a mobile phase to obtain the pure isochromene compound.

3. The method according to claim 2, wherein the step of performing solid fermentation of the aspergillus versicolor YATS1111 in the step (1) comprises the following steps: inoculating the separated aspergillus versicolor strain on a potato glucose agar culture medium at room temperature, culturing for 7-10 days at 25-30 ℃, inoculating in a triangular flask, and placing at 25-30 ℃ for shake culture for 5-10 days to obtain a liquid fermentation strain; each triangular flask contains 10-100 mL of potato glucose culture medium;

performing large-scale fermentation on the liquid fermentation seeds in 100-1000 Von Basher bottles of 0.5-2.0L, wherein each bottle contains 400-600 g of solid matrix and 60-400 mL of nutrient solution; the nutrient solution comprises the following components: 2.5 wt% of glucose, 0.10 wt% of peptone, 0.6 wt% of potassium nitrate, 0.2 wt% of ammonium dihydrogen phosphate, 0.2 wt% of magnesium sulfate heptahydrate, 1 wt% of compound amino acid and the balance of water;

the solid matrix comprises wheat bran, wheat and corn in a ratio of 1:3: 5.

4. The method according to claim 2, wherein the concentration of ethanol in the step (1) is 95 wt%.

5. The preparation method according to claim 2, wherein in the step (2), the extract is dissolved in methanol before being roughly separated by silica gel column chromatography, and then is mixed with 80-120 mesh silica gel with the weight ratio of 1.5-2.5 times.

6. Use of the isochromene-based compound of claim 1 for improving the smoking quality of a cigarette.

7. The use according to claim 6, wherein the isochromene-based compound is used to enrich the aroma, provide ester aroma in cigarette smoking.