CN114763554B - Gene for regulating grain type and application thereof - Google Patents

Abstract

The application provides a gene for regulating and controlling grain type and application thereof. The inventor discovers that GSQ6 gene has regulation and control effects on grain length, quality and the like of crops based on researches of methods such as genetics, molecular biology and the like, and can obviously improve the quality of crops by up-regulating the expression of the gene in crops, and obtain crops with long grain length, low chalkiness, high quality or large numbers of palea siliceous cells. The application provides a new idea for improving cereal crops.

Description

Gene for regulating grain type and application thereof

Technical Field

The application belongs to the fields of botanic and molecular biology, and particularly relates to a gene for regulating and controlling grain types and application thereof.

Background

With the increasing population and the worsening of the global ecological environment, food shortage has become an increasingly serious worldwide problem, and traditional genetic breeding methods have failed to meet this demand. About 50% of the world population is on rice as the main diet, and by 2025, the demand for rice will increase by 50%. China is a large country for rice production and consumption, and rice plays an important role in guaranteeing the safety of Chinese grains. Cultivated rice is divided into two major subspecies: japonica rice and indica rice. Asian cultivated rice is domesticated from common wild rice through long-term artificial selection. Research shows that japonica rice is firstly domesticated by a small part of wild rice in south China, while indica rice is further hybridized by the domesticated japonica rice and some local wild rice, so that the japonica rice is diffused from China to regions such as east Asia, south Asia and the like. According to the planting area and other agronomic characters of japonica rice, the japonica rice is divided into tropical japonica rice and temperate japonica rice subtypes. During these processes, many agronomic traits, such as reduced fall, change from creeping to vertical growth, seed coat color, etc. At the same time, during the evolution of the years, many cultivars have been further improved on their genetic basis in order to adapt to the climatic environment of the locus or to increase yield. Typical indica rice is long grain, and the grains of warm-belt japonica rice are short round; tropical japonica rice (also known as Java rice) is large grain, large spike, increased grain number per spike, and wider leaf of sword compared to temperate japonica rice.

Along with the improvement of the living standard of people, the requirements on rice quality are not only suitable for taste, but also attractive in appearance, and particularly prominent in the international market. The length, width, length/width and thousand grain weight of rice directly determine the length, width, length/width and grain weight of rice, and these traits are just important parts of the quality and dietary preferences of the constituent rice.

In rice, the currently cloned GW5 is a major gene with wide control grain, has a nuclear localization signal and an arginine enrichment domain, has no homology with any protein with known functions, and further research discovers that GW5 controls rice seed grain type by participating in ubiquitin proteasome pathway. At the same time, tissue sections have been observed to show that the increase in grain width is mainly due to the increase in the number of epidermal cells in the palea, resulting in an increase in the palea. On chromosome 5 of rice, there is a GS5 in addition to GW5, and GS5 has an effect on the filling rate, grain width and thousand kernel weight of kernels. GS5 encodes a serine carboxypeptidase (serine carboxypeptidase) as a positive regulator of grain type affecting thousand kernel weight of rice. GS3 is a major gene controlling grain length in indica rice, the GS3 gene encodes 232 amino acids, a region and a domain with 4 known functions, wherein the most important domain is a transmembrane region composed of amino acids 97-117, and a cysteine-rich region with a C-terminal similar to the VWFC motif. GW2 is a main gene for controlling grain width, and research discovers that the GW2 gene codes a polypeptide containing 425 amino acid residues, contains a protein sequence similar to zinc finger protein, has E3 ubiquitin ligase activity, participates in a protein path for degrading and promoting cell division, and the grain width is increased due to GW2 deletion. GW8 is an important gene which can affect the quality and yield of rice at the same time, is a positive control factor for controlling the size of rice seeds, and can promote cell division and increase the weight of rice grains. Thousand kernel weight gene TGW6 codes an IAA-glucose hydrolase gene (input-3-acetic acid-glucose hydrolase activity), and TGW6 not only directly controls the length of endosperm, but also indirectly participates in the transportation of carbohydrate from a source to a warehouse, and finally influences the length of kernels and thousand kernel weight by regulating the number of cells. GLW7 controlling large grains increases thousand grain weight by increasing grain length and grain thickness.

Although some rice varieties with improved grain shapes have been developed in the art, as the level of demand increases, development of new plant varieties with further improved quality remains a need in the art.

Disclosure of Invention

The application aims to provide a gene for regulating and controlling grain types and application thereof.

In a first aspect of the application, there is provided a method of regulating grain type of a cereal crop comprising: regulating expression or activity of GSQ6 protein in plants.

In a preferred embodiment, the GSQ6 protein comprises homologues thereof.

In another preferred embodiment, the modulation is increasing grain length, decreasing chalkiness, improving quality, or increasing lemma siliceous cell number; the method comprises the following steps: up-regulating the expression or activity of GSQ6 protein in plants.

In another preferred embodiment, said up-regulating GSQ6 protein expression or activity in a plant comprises: overexpression of GSQ6 protein in plants; or, the expression or activity of the GSQ6 protein is improved by controlling with an up-regulating molecule which interacts with the GSQ6 protein.

In another aspect of the application there is provided the use of a GSQ6 protein or upregulating molecule thereof for modulating grain type.

In a preferred embodiment, the modulator molecule is an up-regulator molecule and the use of the GSQ6 protein or up-regulator molecule thereof comprises a polypeptide selected from the group consisting of: increasing grain length, reducing chalkiness, improving quality, or increasing the number of lemma cells.

In another preferred embodiment, the up-regulating molecule comprises: an expression cassette or expression construct (including an expression vector) that overexpresses the GSQ6 protein; or, an expression cassette or expression construct that increases the translation efficiency of the GSQ6 protein; or an up-regulating molecule that interacts with the GSQ6 protein, thereby increasing its expression or activity.

In another preferred embodiment, the cereal crop is a plant expressing a GSQ6 protein or a homolog thereof; preferably, the cereal crop comprises a grass; preferably, the cereal crop comprises a plant selected from (but not limited to): rice, barley, wheat, oat, rye, corn, sorghum, brachypodium distachyon.

In another preferred embodiment, the cereal crop is a plant in which the GSQ6 protein is relatively low expressed (e.g., significantly lower than the expression level of the gene in the plant) or not expressed, by increasing the expression or activity of the GSQ6 protein, increasing grain length, reducing chalkiness, improving quality, or increasing the number of palea siliceous cells.

In another preferred embodiment, the amino acid sequence of the GSQ6 polypeptide is selected from the group consisting of: (i) a polypeptide having the amino acid sequence shown in SEQ ID NO. 2; (ii) A polypeptide which is formed by substitution, deletion or addition of one or more (such as 1-20, 1-10, 1-5, 1-3) amino acid residues of the amino acid sequence shown as SEQ ID NO. 2, has the polypeptide function of (i) and is derived from (i); (iii) A polypeptide with the homology of more than or equal to 85 percent (preferably more than or equal to 90 percent, more than or equal to 95 percent, more than or equal to 98 percent or more than or equal to 99 percent) of the amino acid sequence shown in SEQ ID NO. 2 and the regulatory character function; (iv) A tag sequence or an enzyme cleavage site sequence is added to the N-terminus or the C-terminus of the polypeptide having the amino acid sequence shown in SEQ ID NO. 2, or a signal peptide sequence is added to the N-terminus of the polypeptide; or (v) an active fragment of a polypeptide of the amino acid sequence shown in SEQ ID NO. 2.

In another aspect of the application there is provided the use of a GSQ6 protein or gene encoding the same as a molecular marker for identifying grain type of cereal crops.

In another aspect of the application there is provided a method of screening for substances (potential substances) that increase grain length and decrease chalkiness in cereal crop kernels comprising: (1) Adding a candidate substance to a system expressing a GSQ6 protein; (2) The system is examined and the expression or activity of GSQ6 protein therein is observed, and if its expression or activity is increased (significantly, e.g., by 10%, 20%, 40%, 60%, 80%, 90% or more), it is indicated that the candidate substance is a substance that increases grain length of cereal crop grains and reduces chalkiness.

In a preferred embodiment, the method further comprises: a control group without the candidate substance added is set, thereby clearly distinguishing the difference between the GSQ6 protein expression or activity in the test group and the control group.

In another preferred embodiment, the candidate substance includes (but is not limited to): regulatory molecules designed for the GSQ6 protein or its encoding gene or its upstream or downstream proteins or genes (e.g., such as modulators, small molecule compound gene editing constructs, etc.).

In another preferred embodiment, the high expression or activity means that the expression or activity is statistically increased, such as by 2%, 5%, 10%, 20%, 40%, 60%, 80%, 90% or more, compared to the average value of the expression or activity of the same species or plant species.

In another preferred embodiment, the low expression or activity means that the expression or activity is statistically reduced, such as by 2%, 5%, 10%, 20%, 40%, 60%, 80%, 90% or less, compared to the average value of the expression or activity of the same species or plant species.

In another aspect of the application there is provided a method of directionally selecting or identifying cereal crops having long grain length, low chalkiness or a high number of lemonade cells comprising: identifying the expression or activity of the GSQ6 protein in the test plant, and if the expression or activity of the GSQ6 protein in the test plant is higher than or equal to the average value of the expression or activity of the GSQ6 protein in the plant (control plant), then the test plant is a cereal crop with long grain length and low chalkiness.

In a preferred embodiment, the term "high"/"high quality (or good)"/cell number "multiple" means statistically significant high, such as 2%, 5%, 10%, 20%, 40%, 60%, 80%, 90% or more, as compared to the amount of the same or similar plant species.

In another preferred embodiment, the grain length "long" refers to a statistically significant length, such as 2%, 5%, 10%, 20%, 40%, 60%, 80%, 90% or less, as compared to the amount of the same species or plant species.

In another aspect of the application there is provided a plant cell, tissue or organ comprising an up-regulating molecule of an exogenous GSQ6 protein, said up-regulating molecule comprising a polypeptide selected from the group consisting of: an expression cassette or expression construct (including an expression vector) that overexpresses the GSQ6 protein; or an expression cassette or expression construct that increases the translation efficiency of the GSQ6 protein; or an up-regulating molecule that interacts with the GSQ6 protein, thereby increasing its expression or activity.

In a preferred embodiment, the plant cell, tissue or organ is not reproductive.

Other aspects of the application will be apparent to those skilled in the art in view of the disclosure herein.

Drawings

FIG. 1, GWAS analysis of the site of GSQ 6. GSQ is Os06g0265400.

Figure 2, grain type of transgenic plants. Wild Type (WT); GSQ6 gene editing, making gene frame shift mutation (CR); material complementation experiment GSQ6 (CP) of transgenosis grain genotype; GSQ6 Overexpression (OX).

FIG. 3, grain length of transgenic plants. Wild Type (WT); GSQ6 gene editing, making gene frame shift mutation (CR); material complementation experiment GSQ6 (CP) of transgenosis grain genotype; GSQ6 Overexpression (OX).

FIG. 4, cell number of transgenic plants. Wild type (NIP); GSQ6 gene editing, making gene frame shift mutation (CR); material complementation experiment GSQ6 (CP) of transgenosis grain genotype; GSQ6 Overexpression (OX).

a. Scanning seed glumes by an electron microscope. (lemma bar=100 um),

b. the total number of cells was compared laterally (n=8).

FIG. 5, expression of GSQ6 in different tissues. P1 to P20 are different times of the spike, and the numbers indicate the length (cm) of the spike.

FIG. 6 is a schematic diagram of a backbone vector for constructing a gene editing vector.

FIG. 7 shows a sequence diagram of the mutation site of target 1 after gene editing.

FIG. 8 shows a sequence diagram of the mutation site of target 2 after gene editing.

Schematic diagrams of main elements of the overexpression vectors of fig. 9, GSQ 6.

FIG. 10, schematic representation of the major elements of an expression vector for the establishment of GSQ6 complementing plants.

Detailed Description

The application discovers that GSQ6 gene has regulation and control effects on grain length, quality and the like of crops based on researches of methods such as genetics, molecular biology and the like, and can remarkably improve the quality of crops by up-regulating the expression of the gene in crops, and crops with long grain length, low chalkiness, high quality or large number of palea siliceous cells can be obtained. The application provides a new idea for improving cereal crops.

GSQ6

The application identifies a novel gene for regulating and controlling plant seed traits, which is GSQ6 gene. GSQ6 is a transcription factor, localized in the nucleus, and regulates granulocyte size and quality by regulating the number and size of cells. The GSQ6 gene is highly expressed in the ear.

The inventors found that the GSQ6 gene regulates grain length and chalkiness; the plant seed material with a large aspect ratio has low chalkiness and good quality; in contrast, plant seed materials with low aspect ratios have high chalkiness and poor quality.

As used herein, the term "GSQ6 gene or GSQ6 protein (polypeptide)" refers to a gene or a polypeptide having substantially the same domain and substantially the same function, which is homologous to a gene or polypeptide derived from rice, derived from the GSQ6 gene or GSQ6 protein.

In the present application, the GSQ6 proteins also include fragments, derivatives and analogues thereof. As used herein, the terms "fragment," "derivative" and "analog" refer to a fragment of a protein that retains substantially the same biological function or activity of the polypeptide, and may be (i) a protein that has one or more conservative or non-conservative amino acid residues (preferably conservative amino acid residues) substituted, which may or may not be encoded by the genetic code, or (ii) a protein that has a substituent group in one or more amino acid residues, or (iii) a protein that has an additional amino acid sequence fused to the protein sequence, and the like. Such fragments, derivatives and analogs are within the purview of one skilled in the art in view of the definitions herein. The bioactive fragments of the GSQ6 protein can be used in the present application.

In the present application, the term "GSQ6 protein" refers to a protein having a sequence represented by SEQ ID NO. 2, which has the activity of increasing grain length, reducing chalkiness, improving quality, or increasing the number of lemnification cells of the palea, and also includes variants of the SEQ ID NO. 2 sequence having the same function as these polypeptides. These variants include (but are not limited to): deletion, insertion and/or substitution of several (usually 1 to 50, preferably 1 to 30, more preferably 1 to 20, most preferably 1 to 10, still more preferably 1 to 8, 1 to 5) amino acids, and addition or deletion of one or several (usually 20 or less, preferably 10 or less, more preferably 5 or less) amino acids at the C-terminus and/or the N-terminus. For example, in the art, substitution with amino acids of similar or similar properties does not generally alter the function of the protein. As another example, the addition or deletion of one or more amino acids at the C-terminus and/or N-terminus generally does not alter the function of the protein.

In the present application, the term "GSQ6" also includes homologues thereof. It will be appreciated that although GSQ6 obtained from rice of a specific species is preferred in the present application, other proteins having high homology (e.g., 80% or more homology to the polypeptide sequence shown in SEQ ID NO: 2; more preferably 85% or more homology to the same homology of 90%,95%,98% or 99%) as the polypeptide of the GSQ6 protein and having the same function as the polypeptide of the GSQ6 protein of rice are also included in the present application. Methods and tools for aligning sequence identity are also well known in the art, such as BLAST. "homology" refers to the level of similarity (i.e., sequence similarity or identity) between two or more nucleic acids or polypeptides in terms of percentage of positional identity.

Polypeptides derived from other species than rice that have higher homology to the polypeptide sequence of SEQ ID NO. 2 or that exert the same or similar effect in the same or similar regulatory pathways are also encompassed by the present application.

The application also includes polynucleotides (genes) encoding the polypeptides, either naturally occurring genes from crops or degenerate sequences thereof.

Vectors comprising the coding sequences and host cells genetically engineered with the vectors or polypeptide coding sequences are also included in the application. Methods well known to those skilled in the art can be used to construct vectors containing suitable expression.

The host cell is typically a plant cell. The transformed plants can be transformed by agrobacterium transformation or gene gun transformation, such as leaf disc method, young embryo transformation method, etc.; preferred is the Agrobacterium method. Plants can be regenerated from the transformed plant cells, tissues or organs by conventional methods to obtain plants with altered traits relative to the wild type.

As used herein, the term "crop" refers to plants having economic value in agriculture and industry such as grain, cotton, oil, etc., which economic value may be manifested on the seed, fruit, root, stem, leaf, etc., of the plant. Crops include, but are not limited to: dicotyledonous or monocotyledonous plants. Preferred monocotyledonous plants are plants of the Gramineae family, more preferably rice, wheat, barley, maize, sorghum, etc.

In the present application, the crop plants include plants expressing GSQ 6; preferably a cereal crop. Preferably, the cereal crop is grain bearing. The "cereal crop" may be a gramineous plant or a miscanthus plant (crop). Preferably, the gramineous plant is rice, barley, wheat, oat, rye, maize, sorghum and the like. Miscanthus plant refers to the presence of needle-like plants on the seed coat.

With respect to "control plants," selection of appropriate control plants is a routine part of an experimental design and may include corresponding wild-type plants or corresponding transgenic plants without the gene of interest. The control plants are generally of the same plant species or even varieties which are identical to or belong to the same class as the plants to be evaluated. The control plant may also be an individual who has lost the transgenic plant due to isolation. Control plants as used herein refer not only to whole plants, but also to plant parts, including seeds and seed parts.

As used herein, the term "kernel" refers to the fruit or seed of a plant, also known as a spike in crops such as rice, maize, wheat, barley, and the like.

Application of

Therefore, the inventor successfully identifies a novel regulatory gene GSQ6 closely related to grain type and grain quality, and provides an excellent target gene for plant property improvement. The gene is a forward regulation gene, can increase plant seeds, and has good quality; over-expression of the polypeptide increases grain length of grains, reduces chalkiness, improves quality, or increases the number of lemma siliceous cells.

In the work of the present inventors, the regulation of grain length by overexpression, complementation and downregulation of GSQ6 gene was studied. As a result, it was found that when GSQ6 was edited by CRISPR, the kernels were significantly shorter; when GSQ6 with long grain genotype is transformed into Japanese sunny through agrobacterium transformation, grain length is obviously increased; when GSQ6 is overexpressed by the Ubiquitin promoter, the grain size of the transgenic plants is also significantly longer compared to the control. The series of transgenic experiments prove that the over-expression and complementation experiments of the GSQ6 gene can increase the grain length of grains.

In further studies, the inventors found that the number of lemma siliceous cells was significantly reduced in plants targeted to GSQ6 via CRISPR and that the number of cells of the lemma siliceous cells was significantly increased in over-expressed and complemental plants, indicating that seed changes were due to changes in the number of lemma siliceous cells.

Meanwhile, the inventor also discovers that the plants with large grain length-width ratio have low chalkiness and good quality; in contrast, materials with low aspect ratios have high chalkiness and poor quality.

Based on the new findings of the present inventors, a method of improving a plant is provided, the method comprising: upregulating GSQ6 expression or activity in the plant; wherein the improved trait comprises a trait selected from the group consisting of: increasing grain length, reducing chalkiness, improving quality, or increasing the number of lemma cells.

It will be appreciated that following the experimental data and regulatory mechanisms provided herein, various methods well known to those skilled in the art may be employed to modulate the expression of GSQ6, and are encompassed by the present application.

In the present application, substances that up-regulate the expression or activity of GSQ6 in plants include accelerators, agonists, activators, upregulators. The terms "up-regulate", "increase", "promote" include "up-regulate", "promote" or "up-regulate", "increase", "promote" of protein activity. Any substance that increases the activity of the GSQ6 protein, increases the stability of the GSQ6 gene or a protein encoded thereby, upregulates the expression of the GSQ6 gene, increases the effective duration of the GSQ6 protein may be used in the present application as a substance useful for upregulating the GSQ6 gene or a protein encoded thereby. They may be chemical compounds, chemical small molecules, biological molecules. The biomolecules may be nucleic acid-level (including DNA, RNA) or protein-level.

As another embodiment of the present application, there is also provided a method of up-regulating expression of GSQ6 gene or encoded protein thereof in a plant, the method comprising: transferring the expression construct or vector of GSQ6 into plant tissue, organ or tissue to obtain plant tissue, organ or seed of the encoding polynucleotide transferred into GSQ 6; and regenerating the plant tissue, organ or seed obtained into which the exogenous GSQ6 encoding polynucleotide has been transferred.

Other methods for increasing the expression of the GSQ6 gene or its homologue are well known in the art. For example, expression of the GSQ6 gene or its homologous gene may be enhanced by driving with a strong promoter. Or by enhancing expression of the GSQ6 gene by an enhancer such as the rice wall gene first intron, the action gene first intron, etc. Strong promoters suitable for use in the methods of the application include, but are not limited to: 35S promoter, ubi promoter of rice and corn, etc.

The methods may be carried out using any suitable conventional means, including reagents, temperature, pressure conditions, and the like.

After the function of the GSQ6 gene is known, the GSQ6 gene can be used as a molecular marker to perform directional screening of plants. Substances or potential substances that directionally regulate plant grain traits, quality by modulating this mechanism can also be screened based on this new discovery. GSQ6 or its encoded protein can also be used as a tracking marker for the offspring of genetically transformed plants.

Accordingly, the present application provides a method of directionally selecting or identifying plants, the method comprising: identification of GSQ6 gene expression or activity in test plants: if the GSQ6 protein of the test plant is high in expression or activity, the test plant is cereal crops with long grain length, low chalkiness and high quality.

When evaluating plants to be tested, whether the expression or mRNA amount in the plants to be tested is higher than the average value of the plants can be known by measuring the expression or mRNA amount of GSQ6, and if the expression or mRNA amount is remarkably high, the plants to be tested have improved properties.

The present application provides a method of screening substances (potential substances) which increase grain length, reduce chalkiness and improve quality of cereal crop grains, the method comprising: adding a candidate substance to a system comprising or expressing GSQ 6; detecting the expression or activity of GSQ6 in said system; if the candidate substance up-regulates the expression or activity of GSQ6, the candidate substance is a substance for increasing the grain length of cereal crop grains, reducing chalkiness and improving quality.

Methods for screening for substances that act on a target site, either on a protein or on a gene or on a specific region thereof, are well known to those skilled in the art and can be used in the present application. The candidate substance may be selected from: peptides, polymeric peptides, peptidomimetics, non-peptide compounds, carbohydrates, lipids, antibodies or antibody fragments, ligands, small organic molecules, small inorganic molecules, nucleic acid sequences, and the like. Depending on the kind of substance to be screened, it is clear to the person skilled in the art how to select a suitable screening method.

The detection of the interaction between proteins can be performed by a variety of techniques known to those skilled in the art, such as GST sedimentation (GST-Pull Down), two-molecule fluorescent complementation assay, yeast two-hybrid system or co-immunoprecipitation technique.

Through large-scale screening, a substance which specifically acts on GSQ6 and has a regulating effect on the grain size or grain quality of plants, preferably a substance which increases the grain length of grains, reduces chalkiness, improves quality, or increases the number of siliceous cells of the palea can be obtained.

The application will be further illustrated with reference to specific examples. It is to be understood that these examples are illustrative of the present application and are not intended to limit the scope of the present application. The experimental procedures, which do not address the specific conditions in the examples below, are generally carried out according to conventional conditions such as those described in J.Sam Brookfield et al, molecular cloning guidelines, third edition, scientific Press, 2002, or according to the manufacturer's recommendations.

Materials and methods

1. Plant material and particle shape observation method thereof

For 328 parts of japonica rice material, about 36 plants per part. After harvesting the seeds, the grain length of the rice was measured and analyzed by GWAS. The plumpness of the seeds can influence the grain length and grain width, and after the seeds are fully mature, single plants are harvested for grain type investigation. About 100 seeds are randomly taken from each single plant, and a scanner is used for particle scanning after the awns are removed. The obtained scanned image was used to calculate the length and width of each seed using "seed rice appearance quality detection software" and calculate the average value.

2. Scanning electron microscope for observing seed surface

(1) Sampling: taking mature seeds, performing ultrasonic treatment in water for 10 minutes, and drying at 42 ℃ for three days.

(2) Loading: and (5) pasting the sample. The double-sided adhesive tape is adhered to a copper table, and the side surface of the sample is slightly clamped by forceps, so that the observation surface is firmly adhered to the adhesive tape.

(3) Coating: and (5) vacuum metal spraying and film plating are carried out after the sample is adhered.

(4) And (3) observation: after the sample preparation, observation was performed using a JSM-6360LV type scanning electron microscope of Shimadzu.

3. Real-time quantitative PCR

Fresh plant tissue or tissue frozen at-80℃was extracted with Trizol Reagent. DNA in the total RNA sample was digested with DNase and then SuperScript from Invitrogen ^TM II Reverse Transcriptase is reverse transcribed into cDNA first strand, and is further the template for real-time quantitative PCR.

Quantitative PCR was performed by Takara CorpThe Premix Ex taq kit was performed on a Applied Biosystems 7500real time PCR instrument. Specific gene primers are designed according to the gene sequence, and rice gene eEF-1 alpha (GenBank accession number AK 061464) is selected as an internal reference.

4. CRISPR editing (CR) of GSQ6

Targeting knockout sequence for GSQ 6:

target 1: CGTAGCGGTGGTGGGCATGG (SEQ ID NO: 4), the primers were designed as follows:

GSQ6-U3-gRNA-F：ggcaCGTAGCGGTGGTGGGCATGG(SEQ ID NO:5)；

GSQ6-U3-gRNA-R：aaacCCATGCCCACCACCGCTACG(SEQ ID NO:6)；

target 2: TTCATTGCAACTGGAGGCTC (SEQ ID NO: 7), primers were designed as follows,

Sl6-U6a-gRNA-F：gccgTTCATTGCAACTGGAGGCTC(SEQ ID NO:8)；

Sl6-U3a-gRNA-R：aaacGAGCCTCCAGTTGCAATGAA(SEQ ID NO:9)。

the basic backbone for constructing the gene editing vector is as shown in FIG. 6, and targets 1 and 2 are inserted into the same plasmid, co-transformed, and edited to obtain the CR).

And (3) transforming rice Japanese sunny materials. The sequence after editing of target 1 was identified to be deleted for one base (FIG. 7). Target 2 the edited sequence was 1 base insert (FIG. 8)

5. Overexpression plants of GSQ6 (OX)

GSQ6 was cloned into pCambia1300 vector using the Ubiquitin promoter from maize, nos terminator from E.coli, kpnI and AscI; the vector construction scheme is shown in FIG. 9. Converted Japanese-sunny material.

6. GSQ6 Complementation Plants (CP)

The genomic sequence of GSQ6 was cloned into pCAMBIA2300 vector, and the vector construction scheme is shown in FIG. 10. Converting Japanese sun.

Example 1 identification of GSQ6 Gene

In this example, the grain length and thousand grain weight of a japonica rice population were analyzed in combination with a whole Genome association analysis (Genome-Wide Association Study, GWAS) method to identify genes capable of altering rice yield traits.

The inventors collected 382 parts of japonica rice material (including 341 parts of temperate japonica rice and 40 parts of tropical japonica rice) from around the world, measured grain length and thousand grain weight, analyzed and identified a new trait related gene of chromosome six by a genome association method, and found that the gene was related to grain length by analysis (FIG. 1), and named GSQ6 gene by the inventors.

The cDNA sequence, amino acid sequence and genomic sequence of GSQ6 gene are as follows:

cDNA sequence (SEQ ID NO: 1):

ATGGCGGCGCACCAGGGGATGGCGGCGGCGACGGCGGCGGACCGGTTCTGCCTGCCGAGGATGGCGGCGGCGGCGGCGGCCGCCTCGCAGGTGGAGAACTGGGGCGACTCCGGCGTCATCGTCAGCAGCCCGTTCACCGACGACACCTCCACCGACCTCGACGACAGCGCCGACAAGCACCACCTCCACGCTCTAGTGGGCGGCGGCGATGGCGGCGACGACGCCGGCGAGCAGCGAGGCGCGGATTCCTCCGCCGTGTCCAAGGAAAGAAGAGGGGATCAGAAGATGCAGCGGAGGCTTGCGCAGAATCGCGAGGCGGCGCGGAAGAGCCGGATGAGGAAGAAGGCATACATTCAGCAGTTGGAGAGCAGCAGGTCCAAGCTGATGCACCTTGAGCAGGAGCTCCAAAGGGCAAGACAGCAGGGAATCTTCATTGCAACTGGAGGCTCCGGCGATCACGGGCACTCGATCGGAGGAAATGGTACGTTGGCGTTCGACCTTGAGTACGCGCGGTGGCTGGACGAGCACCAGCGGCACATCAACGACCTGCGGGTGGCGCTGAACGCGCAGATGAGCGACGACGAGCTGTGCGAGCTCGTCGACGCCGTGATGATGCACTACGACCAGGTGTTCCGCCTCAAGAGCTTCGCCACCAAGTCCGACGTGTTCCACGTCCTCTCCGGCATGTGGATGAGCCCCGCCGAGCGCTTCTTCATGTGGCTCGGCGGCTTCCGCTCGTCGGAGCTCCTCAAGGTTCTTGCCAGCCATCTTGAGCCGCTGACGGATCAGCAGCTGATGGGCATCTGCAACCTGCAGCAGTCGTCGCAGCAGGCCGAGGACGCGCTGTCGCAGGGGATGGAGGCGCTGCAGCAGACGCTGGGGGACACGTTGGTGTCGGCGGCCGCCACCGTGGTCAGCGGCGGCGGCGGCGCCGACAACGTCACCAACTACATGGGACAGATGGCCATCGCCATGGCCAAGCTCACCACGCTGGAGAACTTCCTCCGTCAGGCTGATCTGCTGAGGCATCAGACGCTGCAGCAGATGCACCGGATCCTGACCACGAGGCAAGCGGCGCGGGCGCTGCTCGTCATCAGCGACTACTTCTCGCGGCTCCGGGCGCTGAGCTCGCTGTGGCTGGCGCGGCCGAGGGACTAG

amino acid sequence (SEQ ID NO: 2):

MAAHQGMAAATAADRFCLPRMAAAAAAASQVENWGDSGVIVSSPFTDDTSTDLDDSADKHHLHALVGGGDGGDDAGEQRGADSSAVSKERRGDQKMQRRLAQNREAARKSRMRKKAYIQQLESSRSKLMHLEQELQRARQQGIFIATGGSGDHGHSIGGNGTLAFDLEYARWLDEHQRHINDLRVALNAQMSDDELCELVDAVMMHYDQVFRLKSFATKSDVFHVLSGMWMSPAERFFMWLGGFRSSELLKVLASHLEPLTDQQLMGICNLQQSSQQAEDALSQGMEALQQTLGDTLVSAAATVVSGGGGADNVTNYMGQMAIAMAKLTTLENFLRQADLLRHQTLQQMHRILTTRQAARALLVISDYFSRLRALSSLWLARPRD

GSQ6 genome sequence comprising a promoter region (positions 1 to 1505),underline lineIs a protein coding region (SEQ ID NO: 1):

example 2 overexpression, complementary expression and Down-Regulation of the GSQ6 Gene

Rice japan itself is a short grain genotype, so when GSQ6 is edited (down-regulated expression) by CRISPR (CR), the grain becomes significantly shorter as shown in fig. 2 to 3.

When GSQ6 of long grain genotype was transformed into Nipponbare by Agrobacterium transformation, grain length was significantly increased (CP), as shown in FIGS. 2 to 3.

In agreement with this, when GSQ6 was overexpressed by the Ubiquitin promoter, the grain type (OX) of the transgenic plants was also significantly longer compared to the control, as shown in fig. 2-3.

Therefore, transgenic experiments prove that the over-expression and complementary expression of the GSQ6 gene can increase the grain length of plant grains.

Chalky is a white opaque part of the rice endosperm, resulting from the change in light transmittance caused by the presence of voids between the endosperm grains. The inventor compares and discovers that the plants with large aspect ratio of seeds have low chalkiness and good quality; in contrast, materials with low aspect ratios have high chalkiness and poor quality.

Example 3 modification of granulocytes by GSQ6 by controlling cell number

The glumes of rice seeds are divided into palea and lemma, and the size of the glumes is an important factor affecting grain size. The glume's epidermis is composed of siliceous cells, has epidermis fur, is regularly arranged on the surface of seeds, and plays a role in protecting the seeds.

The present inventors have further studied on the basis of the characteristic that GSQ6 promotes grain length. Taking Japanese sunny and GSQ6, editing plants, GSQ6 complementary plants CP and over-expressed mature seeds by CRISPR, and observing the number and the size of the lemma cells of the palea by using a scanning electron microscope.

The results indicate that the number of lemma cells was significantly reduced in plants targeted for editing GSQ6 via CRISPR, and the number of cells of the over-expressed and complementary plant lemma cells was significantly increased (fig. 4a,4 b).

These results suggest that the seed changes are due to changes in the number of lemma-like cells.

Example 4 high expression of GSQ6 mainly in ear development

The present inventors studied the expression of GSQ6 gene in different tissues of Japanese sunny day using qPCR as shown in FIG. 5.

The results show that GSQ6 has very low expression level in both roots and leaves, and higher expression level in young ears, and gradually decreases as the ears grow up.

All documents mentioned in this disclosure are incorporated by reference in this disclosure as if each were individually incorporated by reference. Further, it will be appreciated that various changes and modifications may be made by those skilled in the art after reading the above teachings, and such equivalents are intended to fall within the scope of the application as defined in the appended claims.

Sequence listing

<110> molecular plant science Excellent innovation center of China academy of sciences

<120> a gene for controlling grain type and use thereof

<130> 20A638

<160> 9

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1158

<212> DNA

<213> Rice (Oryza sativa L)

<400> 1

atggcggcgc accaggggat ggcggcggcg acggcggcgg accggttctg cctgccgagg 60

atggcggcgg cggcggcggc cgcctcgcag gtggagaact ggggcgactc cggcgtcatc 120

gtcagcagcc cgttcaccga cgacacctcc accgacctcg acgacagcgc cgacaagcac 180

cacctccacg ctctagtggg cggcggcgat ggcggcgacg acgccggcga gcagcgaggc 240

gcggattcct ccgccgtgtc caaggaaaga agaggggatc agaagatgca gcggaggctt 300

gcgcagaatc gcgaggcggc gcggaagagc cggatgagga agaaggcata cattcagcag 360

ttggagagca gcaggtccaa gctgatgcac cttgagcagg agctccaaag ggcaagacag 420

cagggaatct tcattgcaac tggaggctcc ggcgatcacg ggcactcgat cggaggaaat 480

ggtacgttgg cgttcgacct tgagtacgcg cggtggctgg acgagcacca gcggcacatc 540

aacgacctgc gggtggcgct gaacgcgcag atgagcgacg acgagctgtg cgagctcgtc 600

gacgccgtga tgatgcacta cgaccaggtg ttccgcctca agagcttcgc caccaagtcc 660

gacgtgttcc acgtcctctc cggcatgtgg atgagccccg ccgagcgctt cttcatgtgg 720

ctcggcggct tccgctcgtc ggagctcctc aaggttcttg ccagccatct tgagccgctg 780

acggatcagc agctgatggg catctgcaac ctgcagcagt cgtcgcagca ggccgaggac 840

gcgctgtcgc aggggatgga ggcgctgcag cagacgctgg gggacacgtt ggtgtcggcg 900

gccgccaccg tggtcagcgg cggcggcggc gccgacaacg tcaccaacta catgggacag 960

atggccatcg ccatggccaa gctcaccacg ctggagaact tcctccgtca ggctgatctg 1020

ctgaggcatc agacgctgca gcagatgcac cggatcctga ccacgaggca agcggcgcgg 1080

gcgctgctcg tcatcagcga ctacttctcg cggctccggg cgctgagctc gctgtggctg 1140

gcgcggccga gggactag 1158

<210> 2

<211> 385

<212> PRT

<213> Rice (Oryza sativa L)

<400> 2

Met Ala Ala His Gln Gly Met Ala Ala Ala Thr Ala Ala Asp Arg Phe

1 5 10 15

Cys Leu Pro Arg Met Ala Ala Ala Ala Ala Ala Ala Ser Gln Val Glu

20 25 30

Asn Trp Gly Asp Ser Gly Val Ile Val Ser Ser Pro Phe Thr Asp Asp

35 40 45

Thr Ser Thr Asp Leu Asp Asp Ser Ala Asp Lys His His Leu His Ala

50 55 60

Leu Val Gly Gly Gly Asp Gly Gly Asp Asp Ala Gly Glu Gln Arg Gly

65 70 75 80

Ala Asp Ser Ser Ala Val Ser Lys Glu Arg Arg Gly Asp Gln Lys Met

85 90 95

Gln Arg Arg Leu Ala Gln Asn Arg Glu Ala Ala Arg Lys Ser Arg Met

100 105 110

Arg Lys Lys Ala Tyr Ile Gln Gln Leu Glu Ser Ser Arg Ser Lys Leu

115 120 125

Met His Leu Glu Gln Glu Leu Gln Arg Ala Arg Gln Gln Gly Ile Phe

130 135 140

Ile Ala Thr Gly Gly Ser Gly Asp His Gly His Ser Ile Gly Gly Asn

145 150 155 160

Gly Thr Leu Ala Phe Asp Leu Glu Tyr Ala Arg Trp Leu Asp Glu His

165 170 175

Gln Arg His Ile Asn Asp Leu Arg Val Ala Leu Asn Ala Gln Met Ser

180 185 190

Asp Asp Glu Leu Cys Glu Leu Val Asp Ala Val Met Met His Tyr Asp

195 200 205

Gln Val Phe Arg Leu Lys Ser Phe Ala Thr Lys Ser Asp Val Phe His

210 215 220

Val Leu Ser Gly Met Trp Met Ser Pro Ala Glu Arg Phe Phe Met Trp

225 230 235 240

Leu Gly Gly Phe Arg Ser Ser Glu Leu Leu Lys Val Leu Ala Ser His

245 250 255

Leu Glu Pro Leu Thr Asp Gln Gln Leu Met Gly Ile Cys Asn Leu Gln

260 265 270

Gln Ser Ser Gln Gln Ala Glu Asp Ala Leu Ser Gln Gly Met Glu Ala

275 280 285

Leu Gln Gln Thr Leu Gly Asp Thr Leu Val Ser Ala Ala Ala Thr Val

290 295 300

Val Ser Gly Gly Gly Gly Ala Asp Asn Val Thr Asn Tyr Met Gly Gln

305 310 315 320

Met Ala Ile Ala Met Ala Lys Leu Thr Thr Leu Glu Asn Phe Leu Arg

325 330 335

Gln Ala Asp Leu Leu Arg His Gln Thr Leu Gln Gln Met His Arg Ile

340 345 350

Leu Thr Thr Arg Gln Ala Ala Arg Ala Leu Leu Val Ile Ser Asp Tyr

355 360 365

Phe Ser Arg Leu Arg Ala Leu Ser Ser Leu Trp Leu Ala Arg Pro Arg

370 375 380

Asp

385

<210> 3

<211> 3701

<212> DNA

<213> Rice (Oryza sativa L)

<400> 3

cacagcaccc gtgagcaacc ggctactcct actctataat taatgagggt agagtatctg 60

aagtgtcccc ccccccccgc acttttgtcc tgttcgcggt cacgcctcta cgtagtacta 120

cctaggtgta ggtatgtttg aggaggagtg gattggggag attgggaata tacgtaaaac 180

gaggtgagtc attagcgtat gattaattaa gtattaaata ttttaaattt taaaaataga 240

ttaatatgac tttttaaagt aactttacta tagaaaattt ttataaaaaa cgtttagtag 300

tttggaaagc gtgcgcacgg aaaacgaggt gctttctcac cctatatcac acacacgaac 360

gcagctttac tgtatagacc ctctagtcaa agagcaactg aagttgcaac accaacctcc 420

gaccctggac caaacaacaa tatggctacc acatcactag agggatgatg aagatgaacc 480

atcaaaaaac ctgcacaggc tgcagggtcc cctactccac aatccacaac gctcagttca 540

aggttcctcc aggctttttc ccctgtcacg gcctctctcg tcgtcgtcgc ttgcgtagct 600

ctgtaggagt acgcaagcac actcgaatac tacaccacca ccatcggttg attgacattt 660

gaccctgatt gacgcctctg cgactgcact gatcgatcga tctctgacat gcaccgatcg 720

acacgtccgg atcatgatat cttttccctc tcttcttgca tcgtctgatg aatccacaat 780

attcatatcc ttgctataaa gcgcggctgc aagcgtacgc tgctgtcgct gtcgccattg 840

ttcttcatct tcgtcgtcgt cgtcgtcgtc gtcgtcctcg ccgcttgcag tcgctgctgc 900

cgccgccgtc gccgccgatg caccaccatc cgtcacacgt ctttactact aggtactgta 960

gtgttgtagc agtgcgtgtc gtcttgcgac gagctttgtg ttggaccacg acgccatgct 1020

tggctgtaag ctctagcttg gcatcgcgct aacccctttt ttgttggctt gcgcggcggc 1080

gtcacgcccg tggcggtgct actgttcagc tgcagggcgg aggagcagca gctgggtggc 1140

atcggcacag ctggatacca catcggagat ggcgccatct tccctcctca tcatcttctt 1200

cctcctcccg acctcccgct cctccgcact agtaactcac gccactgtct cttccactgt 1260

tgcattccaa gaactgctcc tttgtttgat tcttgctgca ttttgttttt tgtttttttt 1320

ttgaaaaggt ccgaatccga gctccaagtc gtcgagcaac ctcaccgccg gaggacacct 1380

tccgccgctc gccgtcgccg ccgccgccgc cgccgcggtg agtttggttc tttcttcttg 1440

ctgattgatt gattcttcgg ctgatgcaat gcgaccagca gcagcatggc gtagcggtgg 1500

tgggcatggc ggcgcaccag gggatggcgg cggcgacggc ggcggaccgg ttctgcctgc 1560

cgaggatggc ggcggcggcg gcggccgcct cgcaggtgga gaactggggc gactccggcg 1620

tcatcgtcag cagcccgttc accgacgaca cctccaccga cctcgacgac agcgccgaca 1680

agcaccacct ccacgctcta gtggtgccac tgccaccagc tacctcctct cgccgccgtc 1740

tttcttggct ggctccactc gtgtaatgcg gtttctcgtg ctactcccag ggcggcggcg 1800

atggcggcga cgacgccggc gagcagcgag gcgcggattc ctccgccgtg tccaaggaaa 1860

gaagagggga tcagaaggtg cagtcatttt gtgtcagagg ggaaacggaa tctgatctca 1920

tgagtgatca atttggttgt gttcattctg aatatgattt gtccccgaat ttgtgtgcag 1980

atgcagcgga ggcttgcgca gaatcgcgag gcggcgcgga agagccggat gaggaagaag 2040

gtgatcgtct gaacctatac attatcgatc attcattcga ttaatgggac aattacaata 2100

tctgttaaat atactagagc attaattgct tcggaatcaa tgttgactgc tgctgccgtt 2160

gctgcaatgt tctgggagta gatgctctgc tgttacttgc atctttgttt tgtggttatt 2220

gatgatgact aaagacattg cgaattgctg tttgtcgtag gcatacattc agcagttgga 2280

gagcagcagg tccaagctga tgcaccttga gcaggagctc caaagggcaa gacagcaggt 2340

gagccctgca ttgttcagca tacttatcaa atcgccttgc agaatctaat gtttgaagtc 2400

tgaacagctc agtaacaaat acgcaaatgc aattgacgac tatcctttac agggaatctt 2460

cattgcaact ggaggctccg gcgatcacgg gcactcgatc ggaggaaatg gtggtgtttt 2520

ccacttgctt gatttctctg atctgtcatg gcatctgcgc aaacatcgca attctgattc 2580

tgtgttgtgt tgtgtttgct tctgcaggta cgttggcgtt cgaccttgag tacgcgcggt 2640

ggctggacga gcaccagcgg cacatcaacg acctgcgggt ggcgctgaac gcgcagatga 2700

gcgacgacga gctgtgcgag ctcgtcgacg ccgtgatgat gcactacgac caggtgttcc 2760

gcctcaagag cttcgccacc aagtccgacg tgttccacgt cctctccggc atgtggatga 2820

gccccgccga gcgcttcttc atgtggctcg gcggcttccg ctcgtcggag ctcctcaagg 2880

ttttgacacg atcgagtgat cacccaccca attcagcaac aagcaaagaa tctgaagcta 2940

ccattgaccg ccattgttga tgatgttgtt tgtgcaggtt cttgccagcc atcttgagcc 3000

gctgacggat cagcagctga tgggcatctg caacctgcag cagtcgtcgc agcaggccga 3060

ggacgcgctg tcgcagggga tggaggcgct gcagcagacg ctgggggaca cgttggtgtc 3120

ggcggccgcc accgtggtca gcggcggcgg cggcgccgac aacgtcacca actacatggg 3180

acagatggcc atcgccatgg ccaagctcac cacgctggag aacttcctcc gtcaggtaat 3240

tgaagcttcg gaaaaacatc gacggcgagg cgaactgaat tgctcattac cacagcgtga 3300

tgcgatgatt gattgtgtgt aggctgatct gctgaggcat cagacgctgc agcagatgca 3360

ccggatcctg accacgaggc aagcggcgcg ggcgctgctc gtcatcagcg actacttctc 3420

gcggctccgg gcgctgagct cgctgtggct ggcgcggccg agggactaga ctgactaaag 3480

aggatcaata tcatttgcct gagttctgag ttctgacgat ggatggaggt gaacctgttt 3540

tttgattgct gaatcctgag agagcgttaa ctgcgatcgg cattgtaaaa tcagttgctt 3600

tggtgatgaa gcagtagtag taggagaata ttttagattg ggctcttggg cctgtaacgt 3660

gttgtagtgt tagcgtagta agaactaatc cgcgtacaat g 3701

<210> 4

<211> 20

<212> DNA

<213> Rice (Oryza sativa L)

<400> 4

cgtagcggtg gtgggcatgg 20

<210> 5

<211> 24

<212> DNA

<213> Primer (Primer)

<400> 5

ggcacgtagc ggtggtgggc atgg 24

<210> 6

<211> 24

<212> DNA

<213> Primer (Primer)

<400> 6

aaacccatgc ccaccaccgc tacg 24

<210> 7

<211> 20

<212> DNA

<213> Rice (Oryza sativa L)

<400> 7

ttcattgcaa ctggaggctc 20

<210> 8

<211> 24

<212> DNA

<213> Primer (Primer)

<400> 8

gccgttcatt gcaactggag gctc 24

<210> 9

<211> 24

<212> DNA

<213> Primer (Primer)

<400> 9

aaacgagcct ccagttgcaa tgaa 24

Claims (7)

1. A method of regulating grain traits in cereal crops comprising: upregulating GSQ6 protein expression or activity in crops;

the GSQ6 protein is selected from the group consisting of: (i) a protein with an amino acid sequence shown as SEQ ID NO. 2; (ii) A tag sequence or an enzyme cutting site sequence is added at the N end or the C end of the protein with the amino acid sequence shown as SEQ ID NO. 2, or a signal peptide sequence is added at the N end of the protein;

the regulation of cereal crop grain characteristics is to increase grain length of grains, reduce chalkiness, improve quality, or increase the number of palea siliceous cells;

the cereal crop is rice.

2. The method of claim 1, wherein up-regulating GSQ6 protein expression or activity in a crop plant comprises: the GSQ6 protein is over expressed in crops, thereby improving the expression or activity of the GSQ6 protein.

3. The use of GSQ6 protein or its up-regulating molecule for regulating grain crop seed character; the regulating cereal crop seed character is selected from: increasing grain length, reducing chalkiness, improving quality, or increasing the number of lemma cells;

the up-regulating molecule comprises: an expression cassette or expression construct that overexpresses the GSQ6 protein, or an expression cassette or expression construct that increases the translation efficiency of the GSQ6 protein; the cereal crop is rice; the GSQ6 protein is selected from the group consisting of: (i) a protein with an amino acid sequence shown as SEQ ID NO. 2; (ii) The protein is formed by adding a tag sequence or an enzyme cutting site sequence at the N end or the C end of the protein with the amino acid sequence shown as SEQ ID NO. 2 or adding a signal peptide sequence at the N end.

4. The use according to claim 3, wherein the expression construct is an expression vector.

5. The use of a GSQ6 protein or a gene encoding the same as a molecular marker for the identification of cereal crop seed shapes; the GSQ6 protein is selected from the group consisting of: (i) a protein with an amino acid sequence shown as SEQ ID NO. 2; (ii) A tag sequence or an enzyme cutting site sequence is added at the N end or the C end of the protein with the amino acid sequence shown as SEQ ID NO. 2, or a signal peptide sequence is added at the N end of the protein; the cereal crop is rice.

6. A method of screening for substances that increase grain length and decrease chalkiness in cereal crop kernels comprising:

(1) Adding a candidate substance to a system expressing a GSQ6 protein;

(2) Detecting the system, observing the expression or activity of GSQ6 protein, if the expression or activity is improved, the candidate substance is a substance for increasing the grain length of cereal crop grains and reducing chalkiness;

the GSQ6 protein is selected from the group consisting of: (i) a protein with an amino acid sequence shown as SEQ ID NO. 2; (ii) A tag sequence or an enzyme cutting site sequence is added at the N end or the C end of the protein with the amino acid sequence shown as SEQ ID NO. 2, or a signal peptide sequence is added at the N end of the protein; the cereal crop is rice.

7. A method for directionally selecting or identifying cereal crops having long grain length, low chalkiness, or a high number of lemonade cells comprising: identifying the expression or activity of GSQ6 protein in the tested crop, if the expression or activity of GSQ6 protein in the tested crop is higher than or equal to the average value of the expression or activity of GSQ6 protein in the crop, the tested crop is cereal crop with long grain length and low chalkiness;

the GSQ6 protein is selected from the group consisting of: (i) a protein with an amino acid sequence shown as SEQ ID NO. 2; (ii) A tag sequence or an enzyme cutting site sequence is added at the N end or the C end of the protein with the amino acid sequence shown as SEQ ID NO. 2, or a signal peptide sequence is added at the N end of the protein; the cereal crop is rice.