CN114752513B - Hansenula polymorpha MP261 for inhibiting plant pathogenic bacteria and application thereof - Google Patents

Abstract

The invention discloses Hansenula polymorpha MP261 for inhibiting plant pathogenic bacteria and application thereof. The classification of the Hansenula polymorpha MP261 is named Hansenula polymorphaHanseniaspora vineaeThe culture medium is preserved in China Center for Type Culture Collection (CCTCC) with the preservation number of NO: m2022262. The Hansenula polymorpha MP261 has remarkable inhibition effect on various plant pathogenic bacteria such as Ralstonia solanacearum, phytophthora nicotianae, phytophthora capsici, botrytis cinerea, alternaria alternata, fusarium graminearum, fusarium oxysporum, and Cladosporium polymorphum. Compared with the chemical control with the most use at present, the biological control by utilizing the Hansenula polymorpha MP261 has the advantages of environmental friendliness, no toxicity and pollution, difficult generation of drug resistance and the like, and has good market application prospect.

Description

Hansenula polymorpha MP261 for inhibiting plant pathogenic bacteria and application thereof

Technical Field

The invention belongs to the technical field of microorganisms, and particularly relates to Hansenula polymorpha MP261 for vineyard for inhibiting plant pathogenic bacteria and application thereof.

Background

Plant diseases caused by fungi, oomycetes and bacteria are widely present worldwide, affecting the yield and quality of crops and cash crops. In order to control these plant diseases, people inhibit the growth of plant pathogenic bacteria by means of chemical control, agricultural control, biological control and the like. The chemical control has the characteristics of high efficiency as the most commonly used control means, but has the defects of drug resistance generated by pathogenic bacteria, environmental pollution caused by pesticide residues, harm to human health and the like.

The biological control is mainly performed by using biocontrol bacteria, biocontrol fungi, biocontrol actinomycetes and plant resistance inducers, and has the characteristics of environmental friendliness, no toxicity and no pollution. The biocontrol yeasts in biocontrol are attracting attention more and more because of the advantages of strong growth and reproduction capability, stable heredity, broad-spectrum antibacterial property, no generation of metabolic products harmful to human body, etc.

Ralstonia solanacearum is used as soil-borne plant pathogenic bacteria, and can cause bacterial wilt of plants. The host range is wide, the distribution range is wide, and the damage is serious, and the plant is called as cancer. Ralstonia solanacearum can synthesize extracellular polysaccharide under proper nutrition, and the extracellular polysaccharide is considered as an important pathogenic factor.

Phytophthora nicotianae and Phytophthora capsici are common phytophthora pathogens. Phytophthora nicotianae is widely distributed and separated from a plurality of ecological niches in five continents, can cause tobacco black shank, is a typical soil-borne rhizome disease, is frequent in the adult plant period, is few in the seedbed period, and has an average economic loss of more than 1 hundred million yuan per year, which is inferior to tobacco virus disease. The phytophthora capsici leonia caused by phytophthora capsici has extremely high propagation speed under high temperature and high humidity conditions, can cause the yield reduction and even the absolute yield of the capsicum, has wide host range and seriously threatens the yield of vegetables, melons and fruits.

Botrytis cinerea causes gray mold, a worldwide fungal plant disease. Alternaria alternata is a pathogenic fungus that can produce irreversible diseases in many important commercial crops, including potatoes, pears, citrus, tobacco, etc. Wheat scab caused by fusarium graminearum is an important disease in wheat production, which not only causes economic loss, but also causes various mycotoxins to harm human and animal health. Fusarium oxysporum can cause soil borne diseases of various crop fusarium wilts. The corynespora polymorpha can cause leaf spot disease of plants such as sesame, lotus root, cucumber and the like.

At present, chemical control means are mainly adopted for controlling plant diseases, but the long-term and large-scale use of pesticides can cause the problems of environmental pollution and drug residues. Development of biological bactericides for biological control is one of sustainable development of agriculture in China towards health.

Disclosure of Invention

The invention aims to provide Hansenula polymorpha MP261 strain for inhibiting plant pathogenic bacteria and application thereof. The invention obtains the Hansenula polymorpha MP261 strain which can strongly inhibit the growth of various plant pathogenic bacteria through screening, and the strain or volatile gas generated by the strain can be used for preparing biocontrol agents to prevent and treat plant diseases, thereby having good development prospect.

In order to achieve the aim of the invention, the invention is realized by adopting the following technical scheme:

the invention provides a Hansenula polymorpha MP261 for inhibiting plant pathogenic bacteria, which is classified and named as Hansenula polymorpha Hanseniaspora vineae, and is preserved in China Center for Type Culture Collection (CCTCC) NO: m2022262.

Further, the nucleotide sequence of 26S rDNA of Hansenula polymorpha MP261 is shown as SEQ ID No. 3.

Further, the colony of the Hansenula polymorpha MP261 is milky white, dry in surface, matt and protruding in the middle.

The invention also provides application of the Hansenula polymorpha MP261 in preparing plant pathogenic bacteria inhibitors.

Further, the plant pathogenic bacteria include Ralstonia solanacearum, phytophthora capsici, phytophthora nicotianae, botrytis cinerea, alternaria alternata, fusarium graminearum, fusarium oxysporum, and Isaria polymorpha.

Furthermore, the Hansenula polymorpha MP261 can obviously inhibit the growth of hyphae of Ralstonia solanacearum, phytophthora capsici, phytophthora nicotianae, botrytis cinerea, alternaria alternata, fusarium graminearum, fusarium oxysporum and Saccharomycetes polymorpha.

The invention also provides application of the hansenula polymorpha MP261 in preparing biocontrol bactericides for preventing and treating plant bacterial wilt and/or phytophthora and/or plant mycosis.

Further, the biocontrol microbial inoculum contains hansenula polymorpha MP261 fermentation broth and/or volatile gas generated by hansenula polymorpha MP 261.

Further, the preparation method of the Hansenula polymorpha MP261 fermentation broth comprises the following steps: inoculating the Hansenula polymorpha MP261 fermentation broth into a potato juice culture medium, and shake-culturing for 24 hours at 28 ℃ and 180rpm to obtain a fermentation broth containing Hansenula polymorpha MP 261.

Further, volatile gases generated by Hansenula polymorpha MP261 contain ethyl acetate, 3-methyl-1-butanol acetate, phenethyl alcohol and phenethyl acetate.

Furthermore, the ethyl acetate content in the volatile gas generated by the Hansenula polymorpha MP261 reaches 73.07%.

Further, the phytophthora root rot is plant phytophthora root rot caused by phytophthora nicotianae and/or phytophthora capsici; the plant bacterial wilt is plant bacterial wilt caused by bacterial wilt; the plant mycosis is caused by Botrytis cinerea, alternaria alternata, fusarium graminearum, fusarium oxysporum and Cladosporium polycephalum.

Compared with the prior art, the invention has the advantages and technical effects that:

the invention screens out a strain of Hansenula polymorpha MP261 with obvious inhibition effect on various plant pathogenic bacteria, and carries out a plate counter experiment on Ralstonia solanacearum, botrytis cinerea, phytophthora nicotianae and Phytophthora capsici; the phytophthora capsici, phytophthora nicotianae, botrytis cinerea, alternaria alternata, fusarium graminearum, fusarium oxysporum and multi-main-corynespora plate butt-joint experiments prove that the obtained vineyard hansenula polymorpha MP261 has broad-spectrum antibacterial property, and has good market application prospect in preparing biocontrol agents by using the vineyard hansenula polymorpha MP261 or volatile gases thereof.

Drawings

FIG. 1 is a plate culture of Hansenula polymorpha MP 261;

FIG. 2 is a microscopic view of Hansenula polymorpha MP261 in vineyard;

FIG. 3 is a schematic diagram of 26S rDNA sequence amplification of Hansenula polymorpha MP 261;

FIG. 4 shows the result of the growth inhibition of Hansenula polymorpha MP261 on Phytophthora capsici;

FIG. 5 is the result of the growth inhibition of Hansenula polymorpha MP261 on Phytophthora nicotianae;

FIG. 6 shows the result of inhibition of Botrytis cinerea mycelium growth by Hansenula polymorpha MP 261;

FIG. 7 shows the result of inhibiting the growth of Phytophthora capsici by volatile gas of Hansenula polymorpha MP261 in vineyard;

FIG. 8 is the result of the inhibition of phytophthora nicotianae silk growth by Hansenula polymorpha MP261 volatile gas in vineyard;

FIG. 9 shows the result of inhibiting the growth of Botrytis cinerea mycelium by volatile gas of Hansenula polymorpha MP 261;

FIG. 10 shows the results of inhibition of the growth of Alternaria alternata hyphae by Hansenula polymorpha MP261 volatile gas;

FIG. 11 shows the result of inhibition of Siraitia polymorpha MP261 volatile gas on Siberian graminearum hypha growth;

FIG. 12 shows the result of inhibiting growth of fusarium oxysporum by volatile gases of Hansenula polymorpha MP261 in vineyard;

FIG. 13 shows the result of inhibition of growth of S.polymorpha MP261 volatile gas on S.polymorpha filaments;

FIG. 14 shows the result of inhibition of Ralstonia solanacearum by Hansenula polymorpha MP 261;

FIG. 15 shows the GC-MS results of volatile gases of Hansenula polymorpha MP 261.

Detailed Description

The technical scheme of the invention is further described in detail below with reference to the attached drawings and specific embodiments.

Example 1

1. Isolation and screening of strains

Collecting different plant leaves, roots, petals and other samples from Laoshan mountain in 2019, removing lesions and necrotic parts, shearing the samples for later use, inoculating the sheared samples into YPD liquid culture medium (1%Yeast Extract,2%Peptone,2%Dextrose) containing chloramphenicol with a final concentration of 0.01%, and shake culturing at 28 ℃ and 180rpm for 2d; the culture broth was diluted with sterile water, subjected to separation by plating on YPD plates, and cultured at 28℃for 2d, followed by preliminary observation of the strain. And selecting a proper single colony, and carrying out streaking separation again to obtain the pure culture strain.

Selecting single bacterial colony of the strain, inoculating the single bacterial colony and a plurality of plant pathogenic bacteria to a potato dextrose agar (potato dextrose agar, PDA) plate (200 g of potato is washed and diced, proper water is added for boiling for 20-30 minutes, potato juice is filtered by gauze, 20 g of dextrose is added, 20 g of agar is added, the volume is fixed to 1000 ml, the natural pH value is reached), and culturing is carried out under the condition of 26-28 ℃. Through testing the inhibition condition of yeast on the growth of plant pathogenic hyphae, an MP261 strain with inhibition effect on the growth of a plurality of plant pathogenic bacteria such as phytophthora nicotianae is screened out.

As shown in FIG. 1, the plate culture photograph of strain MP261 shows that the colony is milky white, dry on the surface, matt and with middle protrusions. Figure 2 shows that the cell morphology is lemon-shaped and oval-shaped.

2. Classification and identification of MP261 Strain

PCR sequence determination was performed using 26S rDNA molecular characterization methods:

(1) 26S rDNA sequence primer

NL1：GCATATCAATAAGCGGAGGAAAAG(SEQ ID No.1)；

NL4：GGTCCGTGTTTCAAGACGG(SEQ ID No.2)；

(2) The PCR reaction system is as follows: transStart FastPfu DNA Polymerase:1 μl; 5X TransStart FastPfu Buffer. Mu.l; high Pure dNTPs (2.5 mM): 4 μl;27F:2 μl;1492R:2 μl; and (3) a template: 1 μl; ddH ₂ O：30μl；

The PCR reaction procedure was as follows: pre-denaturation at 95℃for 2min; denaturation at 95℃for 20s, annealing at 55℃for 20s, and extension at 72℃for 1min;35 cycles, renaturation at 72 ℃; the electrophoresis of the PCR products is shown in FIG. 3. And (3) recovering PCR products by using the gel, performing TA cloning, and picking single bacterial colonies and sending the single bacterial colonies to a sequencing company for sequencing.

(3) The 26S rDNA sequence of strain MP261 was sequenced as follows:

TTTTAAATTTACAAAATAGGAGGAAAAGAAACCAACCGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCACTTTCAGTGTCCGAGTTGTAATTTGTAGAAGTAGTTTTGGGGCTGGTCCTTGTCTATGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTGTGGCGAGGATCCCAGTTCTTTGTAAAACGCTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCATTTGATCAGACATGGTGTTTGGACGCCCTGCGCTCCTTGTGGGTGCAGGACACGCTTTTCACTGGGCCAACATCGGTTTTGGCAGCAGGATAAATCGTTAGGAACGTAGCTGCCCTCGGGTAGTGTTACAGCCTAGCGGAATACTGCTAGCCGGGACTGAGGACTGCGTCTTTTGACAAGGATGTTGGCATAATGGTTAAATGCCGCCCGTTTGAAAAACCCGGGCCCAAAGAA(SEQ ID No.3)。

(4) Conclusion: through NCBI database comparison, the sequence similarity of the MP261 strain to be detected and 26S rDNA (GenBank: MN 337242.1) of Hansenula polymorpha (Hanseniaspora vineae strain X11-10) strain is 99.33%; the sequence similarity with 16S rDNA (GenBank: MW 076944.1) of Hansenula polymorpha (Hanseniaspora vineae strain HN 001) strain is 99.83%; the MP261 strain is Hansenula polymorpha (Hanseniaspora vineae).

The strain MP261 strain of the hansenula polymorpha screened by the invention is subjected to strain preservation, and the preservation unit is as follows: china center for type culture Collection; address: chinese university of Wuhan; preservation date: 2022, 3 and 15 days, the preservation number of Hansenula polymorpha Hanseniaspora vineae MP and 261 is CCTCC NO: m2022262.

3. Biocontrol experiment of Hansenula polymorpha MP261 on various plant pathogenic bacteria

1. Plate counter experiment for testing inhibition effect of MP261 strain on growth of 3 plant pathogenic bacteria hyphae

The experimental method comprises the following steps: activating and culturing MP261 strain on PDA plate at 26 deg.C for 2 days; 3 plant pathogenic bacteria (phytophthora capsici, phytophthora nicotianae and botrytis cinerea) are respectively activated and cultured on a PDA flat plate at 26-28 ℃ for 3-6 days, then round bacterial cakes (with the diameter of 0.60 cm) are picked up at the edge of the activated bacterial strain hypha (the growth condition is as consistent as possible) by a puncher, then MP261 bacterial strain and the pathogenic bacterial cakes are respectively picked up to a new flat plate by an inoculating needle, blank bacterial cakes are used as contrast, then the culture dish is inverted in an incubator (at 26-28 ℃) and cultured for 3-6 days, when the blank group is full of the plates, the growth condition of the hypha is measured, and the inhibition rate of the MP261 bacterial strain on the growth of 3 plant pathogenic bacteria is calculated.

Tests show that the MP261 strain has obvious antibacterial effect on the hypha growth of 3 plant pathogenic bacteria. FIGS. 4-6 show the inhibitory effect of MP261 strain on 3 plant pathogens (Phytophthora capsici, phytophthora nicotianae, botrytis cinerea) (in the middle of the figure, the pathogenic bacteria are shown, and MP261 strain is shown around). The result shows that the MP261 strain has good inhibition effect on phytophthora capsici, phytophthora nicotianae and botrytis cinerea. Further analysis shows that the MP261 strain has 33.4 percent of hypha growth inhibition rate on phytophthora capsici; the hypha growth inhibition rate for phytophthora nicotianae is 37.2%; the mycelium growth inhibition rate for Botrytis cinerea is 35.6%.

2. Inhibition of MP261 strain volatile gases on various plant pathogens

The plant pathogenic bacteria are respectively activated and cultured on PDA plates at 26-28 ℃ for 3-6 days. MP261 strain was activated in PDA plates at 28℃for 2d, after activation the loop was inoculated to pick single colonies in 100ml potato juice medium at 28℃and shaking at 180rpm for 24h for further use. Then, a puncher is used for punching a circular bacterial cake (with the diameter of 0.60 cm) on the edge of the hypha of the activated plant pathogenic bacterial strain (the growth condition is as consistent as possible) and connecting the circular bacterial cake with another PDA flat plate; diluting the obtained MP261 fermentation broth to 1×10 ⁶ Cells/ml, 20 μl was plated on PDA plates, control group untreated. The PDA plate with plant pathogenic bacteria is buckled with the PDA plate coated with MP261 strain, and the control group is buckled with the PDA plate with plant pathogenic bacteria and the blank PDA plate, and the sealing film is sealed. The plate with pathogenic bacteria is placed on the upper part, the MP261 plate is coated on the upper part, the plate is cultured for 3-6 days at 28 ℃, and the experimental result is observed after the pathogenic bacteria of the control group grow up on the plate.

The results are shown in figures 7-13, and the volatile gas generated by MP261 strain has obvious antibacterial effect on phytophthora capsici, phytophthora nicotianae, botrytis cinerea, alternaria alternata, fusarium graminearum, fusarium oxysporum and corynespora polyrhiza. Table 1 shows the inhibitory effect of the volatile gas produced by MP261 strain on the above pathogenic bacteria, wherein the MP261 strain has the highest inhibitory rate on Botrytis cinerea.

TABLE 1 inhibition of pathogenic bacteria by volatile gases of MP261 Strain

Example 2

After dipping bacterial liquid of Ralstonia solanacearum with a sterile cotton stick, the bacterial liquid is coated on the surface of a flat plate, and then MP261 strain is inoculated in the center of the flat plate. The culture dish is inverted and cultured in an incubator (26-28 ℃) for 1-2 days, and the antibacterial effect of the MP261 strain on the bacterial wilt is measured.

As shown in fig. 14 and table 2, the MP261 strain was found to have a distinct zone of inhibition around the colonies of the MP261 strain, indicating that the MP261 strain also had a significant inhibitory effect on the growth of ralstonia solanacearum.

TABLE 2 inhibition effect of MP261 Strain on Ralstonia solanacearum

Example 3

Volatile gases generated by MP261 were collected using a 20ml headspace bottle, and the composition of the volatile gases was tested using a solid phase extraction and gas phase-mass spectrometry GC-MS instrument. Solid phase extraction: SIGMA-ALDRICH 57329-U (DVB/CAR/FDMS); GC-MS instrument: TSQ services 8000; chromatographic column: thermo TG-5SILMS, capillary column (30 m. Times.0.25 mm. Times.0.25 μm). The headspace was extracted at 40 ℃ for 1 hour. Sample injection temperature 250 ℃, carrier gas: he, flow rate was 1.3ml/min. Column temperature rising procedure: maintaining at 40deg.C for 2min, and then raising to 100 at 3deg.C/min for 0.1min; then the temperature is raised to 240 ℃ at 20 ℃/min and kept for 5min. The chromatogram was recorded in full scan mode, m/z 40-400amu, with the ion source temperature set at 230 ℃. The obtained material is automatically searched by a computer and is matched with NIST Library for qualitative.

Experimental results indicate that MP261 can generate a variety of volatile gases (fig. 15). Mass spectrometry showed that the Ethyl Acetate (Ethyl Acetate) content was 73.07% (2.21 min) in these volatile gases; 3-methyl-1-Butanol acetate (1-Butanol, 3-methyl-, acetate) content of 10.8% (7.11 min); the phenethyl alcohol (Phenylethyl Alcoho 1) content is 0.27 percent (17.43 min); the content of phenethyl acetate (Acetic acid,2-phenylethyl ester) was 7.73% (23.28 min).

The above embodiments are only for illustrating the technical solution of the present invention, and are not limiting; although the invention has been described in detail with reference to the foregoing embodiments, it will be apparent to one skilled in the art that modifications may be made to the technical solutions described in the foregoing embodiments, or equivalents may be substituted for some of the technical features thereof; such modifications and substitutions do not depart from the spirit and scope of the corresponding technical solutions.

Sequence listing

<110> Qingdao university of agriculture

<120> Hansenula polymorpha MP261 strain for inhibiting plant pathogenic bacteria and application thereof

<141> 2022-04-19

<160> 3

<170> SIPOSequenceListing 1.0

<210> 1

<211> 24

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 1

gcatatcaat aagcggagga aaag 24

<210> 2

<211> 19

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 2

ggtccgtgtt tcaagacgg 19

<210> 3

<211> 625

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 3

ttttaaattt acaaaatagg aggaaaagaa accaaccggg attgcctcag taacggcgag 60

tgaagcggca aaagctcaaa tttgaaatct ggcactttca gtgtccgagt tgtaatttgt 120

agaagtagtt ttggggctgg tccttgtcta tgttccttgg aacaggacgt catagagggt 180

gagaatcccg tgtggcgagg atcccagttc tttgtaaaac gctttcgaag agtcgagttg 240

tttgggaatg cagctctaag tgggtggtaa attccatcta aagctaaata ttggcgagag 300

accgatagcg aacaagtaca gtgatggaaa gatgaaaaga actttgaaaa gagagtgaaa 360

aagtacgtga aattgttgaa agggaagggc atttgatcag acatggtgtt tggacgccct 420

gcgctccttg tgggtgcagg acacgctttt cactgggcca acatcggttt tggcagcagg 480

ataaatcgtt aggaacgtag ctgccctcgg gtagtgttac agcctagcgg aatactgcta 540

gccgggactg aggactgcgt cttttgacaa ggatgttggc ataatggtta aatgccgccc 600

gtttgaaaaa cccgggccca aagaa 625

Claims (6)

1. A vineyard hansenula MP261 for inhibiting plant pathogenic bacteria, characterized in that: its classification is named Hansenula polymorpha in vineyardHanseniaspora vineaeThe culture medium is preserved in China Center for Type Culture Collection (CCTCC) with the preservation number of NO: m2022262.

2. Use of hansenula polymorpha MP261 according to claim 1 for the preparation of plant pathogen inhibitors, characterized in that: the plant pathogenic bacteria are Ralstonia solanacearum, phytophthora capsici, phytophthora nicotianae, botrytis cinerea, alternaria, fusarium graminearum, fusarium oxysporum and Leuconostoc polycephalum.

3. The use according to claim 2, characterized in that: the Hansenula polymorpha MP261 can remarkably inhibit growth of hyphae of Ralstonia solanacearum, phytophthora capsici, phytophthora nicotianae, botrytis cinerea, alternaria alternata, fusarium graminearum, fusarium oxysporum and Exospora polymorpha.

4. Use of hansenula polymorpha MP261 according to claim 1 for the preparation of biocontrol agents for controlling bacterial wilt and/or phytophthora infestans, characterized in that: the phytophthora root rot is plant phytophthora root rot caused by phytophthora nicotianae and/or phytophthora capsici; the plant bacterial wilt is plant bacterial wilt caused by bacterial wilt; the plant mycosis is caused by Botrytis cinerea, alternaria alternata, fusarium graminearum, fusarium oxysporum and Cladosporium polycephalum.

5. The use according to claim 4, characterized in that: the biocontrol microbial inoculum contains hansenula polymorpha MP261 fermentation liquor.

6. The use according to claim 5, characterized in that: the preparation method of the Hansenula polymorpha MP261 fermentation liquor comprises the following steps: inoculating the Hansenula polymorpha MP261 fermentation broth into a potato juice culture medium, and shake-culturing at 28 ℃ and 180rpm for 24h to obtain a fermentation broth containing Hansenula polymorpha MP 261.

Images