CN114736884B - Cytidine monophosphate kinase mutant and gene and application thereof - Google Patents

Cytidine monophosphate kinase mutant and gene and application thereof Download PDF

Info

Publication number
CN114736884B
CN114736884B CN202210512509.9A CN202210512509A CN114736884B CN 114736884 B CN114736884 B CN 114736884B CN 202210512509 A CN202210512509 A CN 202210512509A CN 114736884 B CN114736884 B CN 114736884B
Authority
CN
China
Prior art keywords
cytidine monophosphate
monophosphate kinase
asparagine
mutant
kinase mutant
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN202210512509.9A
Other languages
Chinese (zh)
Other versions
CN114736884A (en
Inventor
吴金勇
王静静
陈祥松
刘伟伟
李忠奎
袁丽霞
李翔宇
姚建铭
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Hefei Institutes of Physical Science of CAS
Cabio Biotech Wuhan Co Ltd
Original Assignee
Hefei Institutes of Physical Science of CAS
Cabio Biotech Wuhan Co Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Hefei Institutes of Physical Science of CAS, Cabio Biotech Wuhan Co Ltd filed Critical Hefei Institutes of Physical Science of CAS
Priority to CN202210512509.9A priority Critical patent/CN114736884B/en
Publication of CN114736884A publication Critical patent/CN114736884A/en
Application granted granted Critical
Publication of CN114736884B publication Critical patent/CN114736884B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/12—Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
    • C12N9/1229—Phosphotransferases with a phosphate group as acceptor (2.7.4)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/70—Vectors or expression systems specially adapted for E. coli
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P19/00—Preparation of compounds containing saccharide radicals
    • C12P19/26—Preparation of nitrogen-containing carbohydrates
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/48—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving transferase
    • C12Q1/485—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving transferase involving kinase
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/6858—Allele-specific amplification
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y207/00—Transferases transferring phosphorus-containing groups (2.7)
    • C12Y207/04—Phosphotransferases with a phosphate group as acceptor (2.7.4)
    • C12Y207/04014—UMP/CMP kinase (2.7.4.14), i.e. uridine monophosphate kinase
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2800/00—Nucleic acids vectors
    • C12N2800/10—Plasmid DNA
    • C12N2800/101—Plasmid DNA for bacteria
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2800/00—Nucleic acids vectors
    • C12N2800/22—Vectors comprising a coding region that has been codon optimised for expression in a respective host
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/90—Enzymes; Proenzymes
    • G01N2333/91—Transferases (2.)
    • G01N2333/912—Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
    • G01N2333/91205—Phosphotransferases in general
    • G01N2333/91235—Phosphotransferases in general with a phosphate group as acceptor (2.7.4)

Abstract

The invention relates to the technical field of biology, and particularly discloses a cytidine monophosphate kinase mutant, and a gene and application thereof. The cytidine monophosphate kinase mutant has at least 90% nucleotide sequence identity with SEQ ID NO. 1 and comprises a mutation at least one or more of the following positions, wherein the mutation site comprises at least one mutation site at positions 3, 4, 5, 74, 77, 79, 85, 170 or 173 of SEQ ID NO. 1. The invention adopts site-directed mutagenesis to improve the thermal stability of cytidine monophosphate kinase, constructs cytidine monophosphate kinase mutant with good thermal stability into the strain, improves the rate of enzyme catalytic reaction and reduces the loss of enzyme activity in the enzyme catalytic synthesis of 3'-sialyllactose, so that 3' -sialyllactose with higher yield can be obtained, the conversion rate of a substrate is further improved, the production period is shortened, and the production cost is reduced.

Description

Cytidine monophosphate kinase mutant and gene and application thereof
Technical Field
The invention relates to the technical field of biology, in particular to a cytidine monophosphate kinase mutant, and a gene and application thereof.
Background
Cytidine monophosphate kinase (Cytidine monophosphate kinase, CMK) is an important member of the nucleoside monophosphate kinase family. CMK plays a key role in nucleotide anabolism, catalyzing the transfer of phosphate groups from adenosine triphosphate (Adenosine triphosphate, ATP) to cytidine monophosphate (Cytidine monophosphate, CMP), yielding cytidine diphosphate (Cytidine diphosphate, CDP). CDP is then phosphorylated to produce cytidine triphosphate (Cytidine triphosphate, CTP).
3'-sialyllactose (3' -SL) is one of the acidic oligosaccharide components rich in breast milk, contains prebiotics, and has important physiological functions of resisting virus and pathogenic bacteria, promoting cognition, promoting brain development and regulating immunity.
Studies have shown that Cytidine Monophosphate Kinase (CMK) plays an important role in the enzymatic synthesis of 3'-SL, and CTP regeneration is an important pathway for enzymatic synthesis of 3' -SL. CMK and polyphosphate kinase (Polyphosphate kinase, PPK) catalyze the conversion of CMP to CTP using polyphosphate as a substrate. However, in the CTP regeneration process, it was found that the heat stability of CMK enzyme was poor, affecting CTP regeneration effect, and thus affecting synthesis of 3' -sialyllactose.
Disclosure of Invention
The invention aims to overcome the defects of the prior art and provide a cytidine monophosphate kinase mutant, and a gene and application thereof.
In order to achieve the above purpose, the technical scheme adopted by the invention is as follows:
in a first aspect, the present invention provides a cytidine monophosphate kinase mutant having at least 90% nucleotide sequence identity to SEQ ID No. 1 and comprising a mutation at least one or more of positions 3, 4, 5, 74, 77, 79, 85, 170 or 173 of SEQ ID No. 1 wherein the mutation is a substitution, insertion or deletion of one or more amino acid residues at the mutation.
The thermal stability of the enzyme is an important index for evaluating the enzyme biocatalyst, and the high thermal stability is beneficial to improving the reaction rate and reducing the loss of the enzyme activity. Because the CMK enzyme has poor thermal stability in the CTP regeneration process and affects the synthesis of 3'-sialyllactose, the invention carries out molecular modification on Cytidine Monophosphate Kinase (CMK) to obtain cytidine monophosphate kinase mutant with higher thermal stability, thereby improving the reaction rate of 3' -sialyllactose synthesis, shortening the production period and reducing the production cost.
In order to provide the thermal stability of cytidine monophosphate kinase, analysis modification is carried out on cytidine monophosphate kinase, CMK (PDB database accession number: 1 KDO) is selected as a template of CMK mutation sites in a PDB database, the inventor carries out a plurality of experiments on the modification of a plurality of sites of cytidine monophosphate kinase, and finally 11 mutation sites are obtained, namely at least one site of 3 rd, 4 th, 5 th, 74 th, 76 th, 77 th, 79 th, 85 th, 170 th, 173 th or 223 rd sites is mutated on the basis of SEQ ID NO: 1. Wherein, after site-directed mutagenesis is carried out on at least one position of 3 rd, 4 th, 5 th, 74 th, 77 th, 79 th, 85 th, 170 th or 173 th positions on the basis of SEQ ID NO. 1, the thermal stability of cytidine monophosphate kinase can be improved, which is helpful for improving the yield of 3' -sialyllactose and obtaining substrate SA with higher conversion rate.
As a preferred embodiment of the cytidine monophosphate kinase mutant, the mutation is a substitution mutation, and at least comprises one or more of the following amino acid residues:
alanine in position 3 is replaced with proline; or (b)
Isoleucine at position 4 with glycine; or (b)
Alanine at position 8 with asparagine; or (b)
Threonine at position 74 is replaced with glycine; or (b)
Asparagine at position 77 is replaced with histidine; or (b)
Glutamine 79 is replaced with asparagine; or (b)
Substitution of glutamic acid at position 85 with asparagine; or (b)
Asparagine at position 170 is substituted with glycine; or (b)
Arginine at position 173 is replaced with serine.
According to the invention, compared with a wild type, the mutation at 77 th, 79 th and 173 th positions can obviously improve the residual enzyme activity of the cytidine monophosphate kinase mutant by 9.52%, 5.91% and 12.53% respectively, and the thermal stability is better.
As a preferred embodiment of the cytidine monophosphate kinase mutant of the present invention, the mutation is selected from any one of the following combinations:
1) Comprises substitution of asparagine at position 77 with histidine and substitution of glutamine at position 79 with asparagine, or;
2) Comprises substitution of asparagine at position 77 with histidine and substitution of arginine at position 173 with serine, or;
3) Comprises substitution of glutamine at position 79 with asparagine and substitution of arginine at position 173 with serine, or;
4) Comprises substitution of asparagine at position 77 with histidine, substitution of glutamine at position 79 with asparagine, and substitution of arginine at position 173 with serine.
According to the invention, the obtained nucleotide sequence is subjected to codon optimization, and finally, the cytidine monophosphate kinase mutant with higher thermal stability is obtained through mutation, the cytidine monophosphate kinase mutant has higher yield of synthesizing 3' -sialyllactose in an enzyme catalysis experiment, and the conversion rate of a substrate SA is also higher.
Through thermal stability experimental screening, the cytidine monophosphate kinase is subjected to combined mutation at 77 th, 79 th and 173 th positions, and when the residue Asn & gtHis (asparagine is substituted by histidine) and the residue Arg & gtSer (arginine is substituted by serine) of the 77 th position of the cytidine monophosphate kinase, the residual enzyme activity of the cytidine monophosphate kinase mutant is improved by 24.43%, and the thermal stability effect is optimal.
The cytidine monophosphate kinase mutant subjected to combined mutation is introduced into the synthesis process of 3' -sialyllactose, so that the content of 3' -sialyllactose and the conversion rate of a substrate can be remarkably improved, and the 3' -sialyllactose is beneficial to industrial production.
The invention provides a primer for detecting the cytidine monophosphate kinase mutant, and the nucleotide sequence of the primer is shown in SEQ ID NO. 2-SEQ ID NO. 23.
More preferably, the primer for detecting the substitution of proline for alanine at position 3 in cytidine monophosphate kinase is shown in SEQ ID NO. 2-3; the primer for detecting the substitution of the 4 th isoleucine by glycine is shown as SEQ ID NO. 4-5; the primer for detecting the substitution of the 8 th alanine by the asparagine is shown as SEQ ID NO. 6-7; the primer for detecting the substitution of threonine at position 74 by glycine is shown in SEQ ID NO. 8-9; the primer for detecting the substitution of the 76 th glycine by histidine is shown as SEQ ID NO. 10-11; the primer for detecting the substitution of the 77 th asparagine by histidine is shown in SEQ ID NO. 12-13; the primer for detecting the substitution of the 79 th glutamine by the asparagine is shown as SEQ ID NO. 14-15; the primer for detecting the substitution of 85 th glutamic acid by asparagine is shown as SEQ ID NO. 16-17; the primer for detecting substitution of the 170 th asparagine by glycine is shown as SEQ ID NO. 18-19; the primer for detecting the 173 th arginine substituted by serine is shown as SEQ ID NO. 20-21; the primer for detecting the substitution of the 223 rd lysine by arginine is shown as SEQ ID NO. 22-23.
The third object is to provide a gene which codes for the above cytidine monophosphate kinase mutant.
In a fourth aspect, the present invention provides a plasmid comprising the cytidine monophosphate kinase mutant described above.
In a fifth aspect, the present invention provides a host cell comprising a gene or plasmid as described above.
The host cell is preferably E.coli, and in a preferred embodiment, the host cell may be a host microorganism such as E.coli, streptomyces, yeast, or the like.
The sixth object is to provide the application of the cytidine monophosphate kinase mutant in preparing 3' -sialyllactose.
The seventh object is to provide the application of the cytidine monophosphate kinase mutant in improving the heat stability of cytidine monophosphate kinase.
In an eighth aspect, the present invention provides a method for promoting the catalytic activity of 3' -sialyllactose, wherein the above cytidine monophosphate kinase mutant is used in a biological enzyme catalysis system.
In a preferred embodiment, the bio-enzymatic catalysis system is in vitro enzymatic or whole cell catalysis.
Compared with the prior art, the invention has the following beneficial effects:
the invention provides a cytidine monophosphate kinase mutant, a gene and application thereof, wherein the thermal stability of cytidine monophosphate kinase is improved by adopting site-directed mutagenesis, the cytidine monophosphate kinase mutant with good thermal stability is constructed into a strain, and in the enzyme catalysis synthesis of 3'-sialyllactose, the rate of enzyme catalysis reaction is improved, the loss of enzyme activity is reduced, so that 3' -sialyllactose with higher yield can be obtained, the conversion rate of a substrate is further improved, the production period is shortened, and the production cost is reduced.
Drawings
FIG. 1 is a graph of the thermal stability of single point mutations of wild-type and cytidine monophosphate kinases;
FIG. 2 is a graph of the thermostability of wild-type and cytidine monophosphate kinase complex mutations;
FIG. 3 is a diagram showing the alignment of the mutation sequences of the gene loci of the N77H/R173S combined mutants;
FIG. 4 is a standard curve of CMP;
FIG. 5 is a standard curve for 3' -SL;
FIG. 6 is a standard curve of SA;
FIG. 7 is a graph showing changes in 3' -sialyllactose content.
Detailed Description
For a better description of the objects, technical solutions and advantages of the present invention, the present invention will be further described with reference to the accompanying drawings and specific embodiments.
In the following examples, the experimental methods used are conventional methods unless otherwise specified, and the materials, reagents, etc. used are commercially available.
The invention is based on the rational design method of B-factor, carry on the point mutation transformation to cytidine monophosphate kinase, get cytidine monophosphate kinase mutant after mutation. The cytidine monophosphate kinase mutant of the present invention may be recombinant polypeptide or synthetic polypeptide. It may be a product of chemical synthesis or produced from a prokaryotic or eukaryotic host (e.g., bacterial, yeast, higher plant, insect, and mammalian cells) using recombinant techniques. The nucleotide sequence of the cytidine monophosphate kinase mutant has at least 90% of nucleotide sequence identity with SEQ ID NO. 1, and comprises at least one or more mutation positions including at least one mutation position in positions 3, 4, 5, 74, 77, 79, 85, 170 or 173 of SEQ ID NO. 1, wherein the mutation is a substitution, insertion or deletion of one or more amino acid residues at the mutation position.
Examples1Construction of cytidine monophosphate kinase Single-point mutant plasmid
1) The method comprises the steps of selecting a nucleotide sequence of CMK (PDB database accession number: 1 KDO) from a PDB database as a template of CMK mutation sites (the nucleotide sequence is shown as SEQ ID NO: 1), modifying a plurality of sites of cytidine monophosphate kinase through a large number of experiments, and finally selecting 11 mutation sites, namely, carrying out single-point mutation on the basis of SEQ ID NO:1, wherein the 3 rd alanine is replaced by proline; or isoleucine at position 4 with glycine; or alanine at position 8 is replaced with asparagine; or threonine at position 74 is replaced with glycine; or glycine at position 76 is substituted with histidine; or asparagine at position 77 is substituted with histidine; or glutamine at position 79 is replaced with asparagine; or substitution of glutamic acid at position 85 with asparagine; or asparagine at position 170 is substituted with glycine; or arginine at position 173 is substituted with serine; or the 223 rd lysine is replaced by arginine. The invention adopts a site-directed kit to carry out mutation, wherein the primer table of the mutation site is shown in table 1.
TABLE 1
2) The CMK gene was inserted between HindIII and BamHI restriction sites of the expression plasmid pET22b (+) by PCR technique to obtain plasmid pET22b (+) -CMK. The primers of Table 1 were used to perform site-directed mutagenesis using pET22b (+) -CMK as a mutation template.
The PCR conditions were: the gene was synthesized between BamHI and HindIII sites of pET-22b (+) expression vector after codon optimization.
pET22b(+)-CMK 2.5uL
primer-F 2.5uL
primer-R 2.5uL
5×FastAlteration Buffer 10uL
FastAlteration DNA Polymerase 1.0uL
ddH 2 O 31.5uL
Final volume 50uL
3) Elimination of plasmid templates
In order to prevent false positive interference of potential template plasmid in the subsequent transformation experiment, the PCR product is subjected to template plasmid elimination treatment. The restriction endonuclease DpnI can degrade methylated plasmids, the reaction system is gently mixed, incubated for 1h at 37 ℃ and preserved at-20 ℃ for standby. Finally obtaining the single-point mutant plasmid of cytidine monophosphate kinase before transformation.
Example 2 transformation
1. Preparation of chemocompetence
(1) E.coli BL21 Star (DE 3) DeltalacZ as a glycerol tube deposit was removed from the-80℃refrigerator
nanETKA, streaking on LB solid medium, culturing overnight at 37 ℃;
(2) Inoculating the single colony into 5mL LB liquid medium (g/L), culturing at 37 ℃ for 10-16h at 230 rpm;
(3) Transferring into 5mL liquid LB culture medium at a ratio of 1%, shake culturing at 37deg.C and 230rpm until reaching OD 600 Stopping culturing when the culture time reaches 0.4-0.6;
(4) Transferring the bacterial liquid into a 2mL centrifuge tube, and placing the bacterial liquid on ice for 30min;
(5) Centrifuging at 4000r/min at 4deg.C for 10min, and discarding supernatant;
(6) 0.1moL/L CaCl pre-cooled on ice 2 1mL of the solution is used for lightly suspending cells, and the cells are placed on ice for 30min;
(7) Centrifuging at 4deg.C at 4000r/min for 10min, discarding supernatant, adding pre-chilled 0.1moL/L glycerol-CaCl 2 The solution gently suspended the cells, volume 100. Mu.L/tube. The competence can be used immediately or placed in a refrigerator at-80 ℃ for standby.
2. Transformation of cytidine monophosphate kinase mutant plasmids
(1) Taking 100 mu L of the competent cells, adding the cytidine monophosphate kinase single-point mutant plasmid DNA to be converted, gently mixing, and carrying out ice bath for 30min;
(2) Immediately carrying out ice bath for 2min after heat shock at 42 ℃ for 90 s;
(3) 1mL of fresh LB culture medium is added, 150rpm is carried out, and the repair culture is carried out for 1h at 37 ℃;
(4) The bacterial liquid is evenly coated on LB plates with corresponding resistance, and is cultivated for 12-16h at 37 ℃.
3. Screening and identification of Positive transformants
Single colonies were picked up and cultured in Amp-resistant LB liquid medium containing 50ug/mL at 37℃with shaking at 230rpm for 8-12h, plasmid extraction was performed using a plasmid extraction kit, and were sequenced after detection by (1%, w/v) agarose gel electrophoresis. The plasmids with correct sequencing were named pET22b (+) -3P (cytidine monophosphate kinase mutant A3P), pET22b (+) -4G (cytidine monophosphate kinase mutant I4G), pET22b (+) -5N (cytidine monophosphate kinase mutant A5N), pET22b (+) -74G (cytidine monophosphate kinase mutant T74G), pET22b (+) -76H (cytidine monophosphate kinase mutant G76H), pET22b (+) -77H (cytidine monophosphate kinase mutant N77H), pET22b (+) -79N (cytidine monophosphate kinase mutant Q79N), pET22b (+) -85N (cytidine monophosphate kinase mutant E85N), pET22b (+) -170G (cytidine monophosphate kinase mutant N170G), pET22b (+) -173S (cytidine monophosphate kinase R173S) and pET22b (+) -223R (cytidine monophosphate kinase mutant K223R), respectively; the strain with correct sequencing was stored at-80 ℃.
4. Construction of cytidine monophosphate kinase composite mutant
The cytidine monophosphate kinase mutant N77H, Q N with good thermostability screened above and R173S are subjected to combined mutation, namely, combined mutation can be performed on the basis of SEQ ID NO:1, for example, 1) a combined mutant comprising substitution of asparagine at position 77 with histidine and substitution of glutamine at position 79 with asparagine (N77H/Q79N), or; 2) Comprises substitution of asparagine at position 77 with histidine and substitution of arginine at position 173 with serine (N77H/R173S combination mutant), or; 3) Comprises substitution of glutamine at position 79 with asparagine and substitution of arginine at position 173 with serine (Q79N/R173S combination mutant), or; 4) Comprises substitution of asparagine at position 77 with histidine, substitution of glutamine at position 79 with asparagine and substitution of arginine at position 173 with serine (N77H/Q79N/R173S combination mutant). Taking the N77H/Q79N combined mutant as an example, taking pET22b (+) -77H plasmid as a template, taking Q79N-F and Q79N-R as primers, cloning by utilizing a PCR technology, converting into E.coli BL21 Star (DE 3) delta lacZ delta nanETKA, sequencing by extracting plasmids, and storing the strains with correct sequencing at-80 ℃ by using the construction methods of pET22b (+) -N77H/Q79N, pET b (+) -N77H/R173S, pET b (+) -Q79N/R173S and pET22b (+) -N77H/Q79N/R173S.
EXAMPLE 3 mutant fermentation and enzyme Activity detection
1. Preparation of a microorganism
1) Seed liquid preparation: the glycerol tube deposited strain containing single/composite mutant of cytidine monophosphate kinase in example 2 was removed from the-80℃refrigerator, streaked onto LB plates containing 50ug/mL Amp resistance, and cultured overnight at 37 ℃; single colonies were picked from the solid plates and inoculated into 5mL LB medium containing 50ug/mL of Amp resistance, and cultured overnight at 37℃with shaking;
2) Fermentation culture: the above overnight culture was transferred to a flask containing 100mL LB medium containing 50ug/mL of Amp resistance at 1% of the inoculum size, and the culture was continued at 37℃and 230rpm to OD 600 =0.6 to 0.8, adding IPTG with a final concentration of 0.2mM, transferring to 18 ℃, and culturing for 16h at constant temperature and 250 rpm.
3) And (3) thallus collection: centrifuging the fermentation broth at 4deg.C and 10000rpm for 10min, removing supernatant, collecting thallus, and preserving at-20deg.C.
2. Thermal stability detection
1) Respectively quantitatively and ultrasonically crushing Wild (WT) bacteria containing unmutated plasmids and strains containing cytidine monophosphate kinase single-point/compound mutants in an ice bath under the conditions of: and (3) standing for 6s, and performing ultrasonic treatment for 50 times.
2) Adding a certain amount of crude enzyme solution into 5mL of substrate system, water-bathing at 30deg.C for 30min, immediately boiling with boiling water for 2min, centrifuging at 12000rpm for 5min, collecting supernatant, and filtering for sample injection. Group 3 experiments were performed in parallel and the average was taken. Substrate system: 50mM Tris-HCl (pH 8.0), 50mM (NH 4) 2 SO 4 、10mM MgCl 2 、10mM ATP、5mM CMP。
3) Enzyme activity assay
Simultaneously, the rest crude enzyme solution is placed at 35 ℃ for incubation for 4 hours, and the second step operation is repeated. The enzyme activity of WT and each mutant incubated without incubation was defined as 100% and the thermostability, i.e. residual enzyme activity, was defined as the enzyme activity measured after 4h incubation/100% of the enzyme activity measured without incubation.
4) Definition of enzyme activity:
an amount of enzyme capable of converting 1. Mu.L of substrate CMP per minute at 30 ℃.
As can be seen from the thermal stability experimental screening, compared with the wild type, the cytidine monophosphate kinase mutant N77H, the cytidine monophosphate kinase mutant Q79N and the cytidine monophosphate kinase mutant R173S are respectively improved by 9.52%, 5.91% and 12.53% (refer to figure 1). The residual enzyme activity of the N77H/R173S combined mutant was increased by 24.43% as compared with the wild type, so that the heat stabilizing effect of the N77H/R173S combined mutant was optimal (refer to FIG. 2).
Example 4, 3'-sialyllactose (3' -SL) enzyme catalysis method
1) 3' -SL enzyme catalyzed plasmid construction
The N77H/R173S gene fragment was amplified using plasmid pET-22b (+) -N77H/R173S as template, primers SL-F (ATATACATATGACCGCAATT) and SL-R (CAGACTCGAGGGCCAGGGCC), and the amplified fragment and pETDuet-PPK were digested with restriction enzymes NdeI and XhoI. Fragments were recovered from agarose gels and ligated with linearized vectors using T4 ligase. The ligation products were transferred to laboratory-stored competent cells E.coli DH 5. Alpha. And, after repair at 37℃they were plated onto Amp plates for selection. After the positive transformant was confirmed by PCR and sequencing (FIG. 3), the plasmid pETDuet-PPK-CMK-N77H/R173S (pDCPCNS) was obtained. The plasmid pDCPCNS was transformed into E.coli BL21 Star (DE 3) ΔlacZ ΔnanETKA/pCOLADuet-CSS-ST to give strain E.coli BL21 Star (DE 3) ΔlacZ ΔnanETKA/pCOLADuet-CSS-ST/pETDuet-PPK-CMK-N77H/R173S, designated strain B. The strain E.coli BL21 Star (DE 3) DeltalacZ DeltananETKA/pCOLADuet-CSS-ST/pETDuet-PPK-CMK was designated as strain A, wherein pCOLADuet-CSS-ST/pETDuet-PPK-CMK was derived from Li Z, chen X, ni Z, et al, processes, efficient Production of 3' -Sialyllactose by Single Whole-Cell in One-dot biosystemsis.2021, 9 (6). The same procedure gives strain C: e.coli BL21 Star (DE 3) DeltanetKA/pCOLADuet-CSS-ST/pCOLADuet-PPK-CMK-N77H/Q79N/R173S, strain D E.coli BL21 Star (DE 3) DeltanetKA/pCOLADuet-CSS-ST/pCOLADuet-PPK-CMK-Q79N/R173S, strain E.coli BL21 Star (DE 3) DeltanetKA/pCOLADuet-CSS-ST/pETDuet-PPK-CMK-N77H/Q79N.
2) Preparation of thermostable strains
(1) Seed liquid preparation: the strain A, B, C, D, E of the previous step of glycerol tube preservation was removed from the-80℃refrigerator and streaked on LB plates containing 50ug/mL Amp and 50ug/mL Kan resistance, and cultured overnight at 37 ℃; single colonies were picked from the solid plates and inoculated into 50mL LB medium containing 50ug/mL of Amp and 50ug/mL of Kan resistance, and cultured overnight at 37℃with shaking.
(2) Fermentation culture: the above overnight culture was transferred to a flask containing 50ug/mL Amp and 50ug/mL Kan-resistant 100mL LB medium at 1% inoculum size, and further cultured at 37℃and 230rpm until OD600 = 0.6-0.8, and further cultured at 20℃with addition of 0.2mM IPTG and constant temperature shaking at 250rpm for 18 hours.
(3) And (3) collecting thalli: the fermentation broth was centrifuged at 8000rpm at 4℃for 10min, and the supernatant was discarded to collect the cells. Preserving at-20 ℃.
3) Enzymatic synthesis of 3' -SL
(1) Respectively quantifying the thalli of the strains A-E, carrying out ultrasonic crushing in an ice bath, wherein the crushing conditions are as follows: and (3) standing for 6s, and performing ultrasonic treatment for 50 times.
(2) Adding the crude enzyme solution into a reaction system of 25mL of 3' -SL enzyme catalysis, wherein the reaction system is as follows: 80mM SA, 90mM lactose, 30mM MgCl 2 30mM hexametaphosphate, 30mM CMP, 40g/L cell. The reaction temperature was 35℃and the pH was 7.00, and stirred with a magnetic stirrer. After 2h 10mM sodium hexametaphosphate was added. Samples were taken every 2 hours, immediately boiled in boiling water at 2min,12000rpm, centrifuged at 5min, the supernatant was taken, diluted by an appropriate factor, and samples were taken by filtration. Group 3 experiments were performed in parallel and the average was taken. HPLC was used to detect the SA and 3' -SL content.
Wherein detecting the condition of CMP comprises: a Zorbax C18 column; the column temperature is 30 ℃; the detection wavelength is 271nm; the mobile phase was 11% (methanol) and contained 89% of 0.6% phosphoric acid (triethylamine ph 6.6); the flow rate was 0.6mL/min.
Conditions for detecting SA, SL include: TSKGEL AMIDE-80 chromatographic column; column temperature is 60 ℃; the detection wavelength is 210nm; the mobile phase was 70% (acetonitrile) and 30% ammonium formate (10 mM, pH 4.0); the flow rate was 1.0mL/min. Wherein the standard curves for CMP, 3' -SL, SA are shown in FIGS. 4-6, respectively.
Referring to FIG. 7, when SA substrate was 80mM, after 10 hours of reaction, 76.54mM of 3' -SL was produced in the enzyme-catalyzed experiment by the added strain B, and the substrate SA conversion was 95.7%; the control group, enzyme catalyzed experiments with added strain A produced 60.68mM 3' -SL with a substrate SA conversion of 75.9%.
In summary, the gene containing the N77H/R173S combined mutant with better thermal stability is constructed into the recombinant strain B, and in the enzyme catalysis synthesis process of the 3'-SL, compared with a control group, the enzyme catalysis system added with the recombinant strain B thallus can obtain higher conversion rate of the 3' -SL and the substrate SA with higher yield.
Finally, it should be noted that the above embodiments are only for illustrating the technical solution of the present invention and not for limiting the scope of the present invention, and although the present invention has been described in detail with reference to the preferred embodiments, it should be understood by those skilled in the art that the technical solution of the present invention may be modified or substituted equally without departing from the spirit and scope of the technical solution of the present invention.
SEQUENCE LISTING
<110> national academy of sciences of fertilizer materials science institute, jiabijia biological technology (Wuhan) Co., ltd
<120> cytidine monophosphate kinase mutant and gene and application thereof
<130> 2022-04-22
<160> 23
<170> PatentIn version 3.5
<210> 1
<211> 681
<212> DNA
<213> Synthesis
<400> 1
atgaccgcaa ttgccccggt tattaccatt gatggcccga gtggtgccgg taaaggcacc 60
ctgtgtaaag ccatggccga agccctgcag tggcatctgc tggatagcgg tgccatctat 120
cgtgtgctgg cactggcagc actgcatcat catgtggatg tggccagcga agatgcactg 180
gttccgctgg ccagccatct ggatgttcgc tttgtgagca ccaatggtaa tctgcaggtt 240
attctggaag gtgaagatgt tagcggtgaa attcgtaccc aggaagtggc caatgccgcc 300
agtcaggttg cagcatttcc gcgtgttcgt gaagcactgc tgcgtcgcca gcgtgccttt 360
cgcgaactgc cgggtctgat tgcagatggc cgtgatatgg gtaccgtggt ttttccggat 420
gccccggtga aaatttttct ggatgcaagc agtgaagaac gtgcccatcg ccgtatgctg 480
cagctgcagg ttaaaggttt tagcgtgaat tttgaacgtc tgctggcaga attcaaagaa 540
cgcgatgatc gtgatcgtaa tcgtgccgtt gccccgctgg tgccggcagc agatgcctta 600
gttctggata gtaccaccct gagcattgaa caggttattg aaaaagccct gcagtatgcc 660
cgtcagaaac tggccctggc c 681
<210> 2
<211> 25
<212> DNA
<213> Synthesis
<400> 2
gatccgatga ccccaattgc cccgg 25
<210> 3
<211> 25
<212> DNA
<213> Synthesis
<400> 3
tggggtcatc ggatccgaat taatt 25
<210> 4
<211> 25
<212> DNA
<213> Synthesis
<400> 4
ccgatgaccg caggtgcccc ggtta 25
<210> 5
<211> 25
<212> DNA
<213> Synthesis
<400> 5
acctgcggtc atcggatccg aatta 25
<210> 6
<211> 25
<212> DNA
<213> Synthesis
<400> 6
atgaccgcaa ttaacccggt tatta 25
<210> 7
<211> 25
<212> DNA
<213> Synthesis
<400> 7
gttaattgcg gtcatcggat ccgaa 25
<210> 8
<211> 25
<212> DNA
<213> Synthesis
<400> 8
cgctttgtga gcggcaatgg taatc 25
<210> 9
<211> 25
<212> DNA
<213> Synthesis
<400> 9
gccgctcaca aagcgaacat ccaga 25
<210> 10
<211> 25
<212> DNA
<213> Synthesis
<400> 10
gtgagcacca atcataatct gcagg 25
<210> 11
<211> 25
<212> DNA
<213> Synthesis
<400> 11
atgattggtg ctcacaaagc gaaca 25
<210> 12
<211> 25
<212> DNA
<213> Synthesis
<400> 12
agcaccaatg gtcatctgca ggtta 25
<210> 13
<211> 25
<212> DNA
<213> Synthesis
<400> 13
atgaccattg gtgctcacaa agcga 25
<210> 14
<211> 25
<212> DNA
<213> Synthesis
<400> 14
aatggtaatc tgaacgttat tctgg 25
<210> 15
<211> 25
<212> DNA
<213> Synthesis
<400> 15
gttcagatta ccattggtgc tcaca 25
<210> 16
<211> 25
<212> DNA
<213> Synthesis
<400> 16
attctggaag gtaacgatgt tagcg 25
<210> 17
<211> 25
<212> DNA
<213> Synthesis
<400> 17
gttaccttcc agaataacct gcaga 25
<210> 18
<211> 25
<212> DNA
<213> Synthesis
<400> 18
ggttttagcg tgggctttga acgtc 25
<210> 19
<211> 25
<212> DNA
<213> Synthesis
<400> 19
gcccacgcta aaacctttaa cctgc 25
<210> 20
<211> 25
<212> DNA
<213> Synthesis
<400> 20
gtgaattttg aaagcctgct ggcag 25
<210> 21
<211> 25
<212> DNA
<213> Synthesis
<400> 21
gctttcaaaa ttcacgctaa aacct 25
<210> 22
<211> 25
<212> DNA
<213> Synthesis
<400> 22
tatgcccgtc agagactggc cctgg 25
<210> 23
<211> 25
<212> DNA
<213> Synthesis
<400> 23
tctctgacgg gcatactgca gggct 25

Claims (7)

1. The cytidine monophosphate kinase mutant is characterized in that the cytidine monophosphate kinase mutant is formed by substitution mutation of 1) -13) at positions 3, 4, 5, 74, 77, 79, 85, 170 or 173 of SEQ ID NO. 1;
1) Alanine in position 3 is replaced with proline; or (b)
2) Isoleucine at position 4 with glycine; or (b)
3) Alanine at position 5 with asparagine; or (b)
4) Threonine at position 74 is replaced with glycine; or (b)
5) Asparagine at position 77 is replaced with histidine; or (b)
6) Glutamine 79 is replaced with asparagine; or (b)
7) Substitution of glutamic acid at position 85 with asparagine; or (b)
8) Asparagine at position 170 is substituted with glycine; or (b)
9) Arginine at position 173 is replaced with serine;
10 Substitution of asparagine at position 77 with histidine and glutamine at position 79 with asparagine, or;
11 Substitution of asparagine at position 77 with histidine and arginine at position 173 with serine, or;
12 Glutamine at position 79 with asparagine and arginine at position 173 with serine, or;
13 A substitution of asparagine at position 77 with histidine, glutamine at position 79 with asparagine, and arginine at position 173 with serine.
2. A gene encoding the cytidine monophosphate kinase mutant according to claim 1.
3. A plasmid comprising the cytidine monophosphate kinase mutant of claim 1.
4. A host cell comprising the gene of claim 2 or the plasmid of claim 3.
5. Use of a cytidine monophosphate kinase mutant as defined in claim 1 for the preparation of 3' -sialyllactose.
6. Use of a cytidine monophosphate kinase mutant as defined in claim 1 for improving the thermostable performance of cytidine monophosphate kinase for non-diagnostic and therapeutic purposes.
7. A method for promoting 3' -sialyllactose catalytic activity for non-diagnostic and therapeutic purposes, characterized in that the cytidine monophosphate kinase mutant according to claim 1 is used in a bio-enzymatic catalytic system.
CN202210512509.9A 2022-05-11 2022-05-11 Cytidine monophosphate kinase mutant and gene and application thereof Active CN114736884B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202210512509.9A CN114736884B (en) 2022-05-11 2022-05-11 Cytidine monophosphate kinase mutant and gene and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202210512509.9A CN114736884B (en) 2022-05-11 2022-05-11 Cytidine monophosphate kinase mutant and gene and application thereof

Publications (2)

Publication Number Publication Date
CN114736884A CN114736884A (en) 2022-07-12
CN114736884B true CN114736884B (en) 2023-10-20

Family

ID=82286576

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202210512509.9A Active CN114736884B (en) 2022-05-11 2022-05-11 Cytidine monophosphate kinase mutant and gene and application thereof

Country Status (1)

Country Link
CN (1) CN114736884B (en)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN116240193B (en) * 2023-05-06 2023-08-01 北京量维生物科技研究院有限公司 Choline kinase mutant and application thereof in production of citicoline

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2003093083A (en) * 2001-08-03 2003-04-02 Ajinomoto Co Inc New variant carbamoyl phosphate synthetase and method for producing compound derived from carbamoyl phosphate
CN105473728A (en) * 2013-05-31 2016-04-06 基因化学株式会社 Method for preparing sialic acid derivative
CN110373398A (en) * 2019-08-06 2019-10-25 江苏诚信药业有限公司 A kind of niacinamide ribokinase mutant and its application
AU2019101117A4 (en) * 2019-09-26 2020-02-20 Tianjin University Of Science And Technology Method for the enzymatic production of uridine monophosphate and cytidine monophosphate
CN113151211A (en) * 2021-03-11 2021-07-23 中国科学院合肥物质科学研究院 Alpha-1, 3-fucosyltransferase mutant and application thereof in preparing 3-fucosyllactose

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
AU2020253354A1 (en) * 2019-03-29 2021-10-28 Greenlight Biosciences, Inc. Cell-free production of ribonucleic acid

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2003093083A (en) * 2001-08-03 2003-04-02 Ajinomoto Co Inc New variant carbamoyl phosphate synthetase and method for producing compound derived from carbamoyl phosphate
CN105473728A (en) * 2013-05-31 2016-04-06 基因化学株式会社 Method for preparing sialic acid derivative
CN110373398A (en) * 2019-08-06 2019-10-25 江苏诚信药业有限公司 A kind of niacinamide ribokinase mutant and its application
AU2019101117A4 (en) * 2019-09-26 2020-02-20 Tianjin University Of Science And Technology Method for the enzymatic production of uridine monophosphate and cytidine monophosphate
CN113151211A (en) * 2021-03-11 2021-07-23 中国科学院合肥物质科学研究院 Alpha-1, 3-fucosyltransferase mutant and application thereof in preparing 3-fucosyllactose

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
PDB: 1CKE_A;Genbank;Genbank;第1-2页 *
The cmk gene encoding cytidine monophosphate kinase is located in the rpsA operon and is required for normal replication rate in Escherichia coli;J Fricke等;Journal of Bacteriology;第177卷(第3期);第1-12页 *
肇东盐单胞菌中胞苷酸激酶基因cmk的克隆与功能分析;姜巨全;杨立娜;刘艳双;孙开福;;东北农业大学学报(07);第36-43页 *
胞苷单磷酸激酶的分子改造及热稳定性研究;王静静等;硕士电子期刊 基础科学(第2期);第1-64页 *
胞苷磷酸激酶基因的克隆与原核表达;吴娟娟等;现代医药卫生;第27卷(第1期);第47-49页 *

Also Published As

Publication number Publication date
CN114736884A (en) 2022-07-12

Similar Documents

Publication Publication Date Title
CN108424900B (en) Nitrilase mutant and construction method and application thereof
CN108753669B (en) Adenine production strain and construction method and application thereof
CN113151198B (en) Gamma-glutamine synthetase mutant, coding gene, amino acid sequence and application thereof
CN113265382A (en) Polyphosphate kinase mutant
TW201842187A (en) A composition for producing tagatose and methods for producing tagatose using the same
CN114736884B (en) Cytidine monophosphate kinase mutant and gene and application thereof
WO2005105991A1 (en) Amp deaminase originating in streptomyces and utilization thereof
CN111172142A (en) Cephalosporin C acylase mutant with high thermal stability
CN112342178B (en) Recombinant microorganism, preparation method thereof and application thereof in producing tagatose
CN116855471B (en) Purine nucleoside phosphorylase mutant and application thereof
CN111808829B (en) Gamma-glutamyl methylamine synthetase mutant and application thereof
CN113151133A (en) Recombinant host bacterium for high yield of sialyllactose, and construction method and application thereof
CN111057686B (en) Alcohol dehydrogenase mutant and application thereof
KR100922085B1 (en) Processes for producing cmp-n-acetylneuraminic acid
CN110358751B (en) Recombinant lipase mutant, encoding gene, recombinant engineering bacterium and application
CN112574970A (en) Nicotinamide mononucleotide adenyltransferase mutant and application thereof
CN115960875A (en) Alginate lyase mutant enzyme with improved thermal stability
CN110904088B (en) High-temperature-resistant D-psicose3-epimerase, mutant and application thereof
JP3833584B2 (en) Process for producing CMP-N-acetylneuraminic acid
CN111057697A (en) High-temperature-resistant TIM barrel protein mutant and application thereof
CN114381446B (en) Heat-resistant acid-resistant arabinosidase gene, and expression protein, recombinant vector, recombinant bacterium and application thereof
CN113564141B (en) Single-cell genome amplification enzyme mutant and application thereof
CN110452899B (en) Glucose isomerase, mutant and application of mutant in preparation of D-fructose
CN116925993B (en) Genetically engineered strains and methods for enzyme-catalyzed production of cytidine acids
CN114438052B (en) Nicotinamide mononucleotide adenyltransferase mutant and application thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant