CN114732772B

CN114732772B - Schizophyllum commune cereal fermentation liquor, and preparation method and application thereof

Info

Publication number: CN114732772B
Application number: CN202111483413.6A
Authority: CN
Inventors: 霍彤; 翟文丽; 石秀芹; 王思艺; 周明; 安全; 张佳婵; 王昌涛
Original assignee: Yunnan Baiyao Group Health Products Co ltd; Yunnan Baiyao Group Shanghai Technology Co ltd; Beijing Technology and Business University
Current assignee: Yunnan Baiyao Group Health Products Co ltd; Yunnan Baiyao Group Shanghai Technology Co ltd; Beijing Technology and Business University
Priority date: 2021-12-07
Filing date: 2021-12-07
Publication date: 2023-10-27
Anticipated expiration: 2041-12-07
Also published as: CN114732772A

Abstract

The present disclosure provides a schizophyllum commune cereal fermentation broth and a preparation method thereof, which is prepared by liquid fermentation of schizophyllum commune YSC1 with a preservation number of CGMCC No.17788 and cereal; comprising the following steps: the preparation method of the bacterial liquid comprises the following steps: inoculating schizophyllum commune YSC1 into a proper culture medium for culture activation treatment, and then inoculating the obtained single colony into the proper culture medium for expansion culture to obtain schizophyllum commune bacterial liquid; the preparation step of fermentation substrate: mixing grains and water in proportion, and sterilizing to obtain a fermentation substrate; fermentation: inoculating schizophyllum commune bacterial liquid to a fermentation substrate, and carrying out fermentation treatment; tail treatment: and (3) sequentially separating and sterilizing the fermented product to obtain fermentation liquor. The novel schizophyllum commune YSC1 and a proper fermentation process are utilized, and the obtained fermentation liquid has good antioxidant, repairing, anti-aging and moisturizing effects, has no sensitization and high safety, and can be used as cosmetics or raw materials of cosmetics.

Description

Schizophyllum commune cereal fermentation liquor, and preparation method and application thereof

Technical Field

The disclosure belongs to the technical field of cosmetics, and in particular relates to schizophyllum commune cereal fermentation liquor, and a preparation method and application thereof.

Background

The recognition of schizophyllum commune (Schizophyllum commune) is as early as in ancient books such as Xinhua Ben Cao gang (compendium of New Hua), yunnan edible fungi and Chinese medicinal fungi, and the schizophyllum commune has the advantages of unique smell, flat nature, nourishing and strengthening and tranquilizing. At present, according to the classification of microorganisms, 2 species of schizophyllum commune are recognized in the family of the schizophyllum commune, and 3 species of schizophyllum commune exist in China, wherein white ginseng bacteria are most widely distributed. Schizophyllum commune is a medicinal and edible fungus and contains abundant active substances.

The method for searching more schizophyllum commune strains and extracting active substances thereof meets the requirements of vast consumer groups and is a common target of technical researchers.

Disclosure of Invention

In order to solve the problems, the disclosure provides a schizophyllum commune cereal fermentation liquor, and a preparation method and application thereof.

In order to solve the technical problems, the technical scheme provided by the present disclosure is as follows:

in a first aspect, the present disclosure provides a schizophyllum commune cereal fermentation broth prepared by liquid fermentation of schizophyllum commune (Schizophyllum commune Fr.) YSC1 with a preservation number of CGMCC No.17788 with cereal.

The schizophyllum commune (Schizophyllum commune Fr.) strain YSC1 used in the present disclosure collects wild fungus fruiting bodies from the natural protection area (E100° 14 '31.13', N38 ° 32 '52.71'; altitude 2810-2980 m) of Qilian mountain country in Nanlian county, gansu province by the applicant. And selecting the tissue at the junction of the fungus cover and the fungus handle, and then placing the tissue on a slant culture medium filled with PDA enriched culture medium, and carrying out dark culture at 25 ℃ for 5 days to obtain hyphae. Mycelium was picked out and purified twice to obtain a purified strain of fungal YSC 1. The purification steps are as follows: mycelia were placed on a slant medium containing PDA enriched medium and dark cultured at 25℃for 5d.

In a second aspect, the present disclosure provides a method of preparing a schizophyllum commune cereal fermentation broth, comprising:

the preparation method of the bacterial liquid comprises the following steps: inoculating a schizophyllum commune (Schizophyllum commune Fr.) strain YSC1 CGMCC No.17788 to a proper culture medium for culture activation treatment, and then inoculating single colonies obtained by the culture activation treatment to the proper culture medium for expansion culture to obtain schizophyllum commune bacterial liquid;

the preparation step of fermentation substrate: mixing grains and water in proportion, and sterilizing to obtain a fermentation substrate;

fermentation: inoculating the schizophyllum commune bacterial liquid to the fermentation substrate, and carrying out fermentation treatment.

Tail treatment: and sequentially separating and sterilizing the fermentation product to obtain the fermentation liquor.

In the above method for preparing a fermentation broth of schizophyllum commune cereal, as a preferred embodiment, in the step of preparing the fermentation substrate, the cereal is used in an amount (i.e. the concentration of the culture medium) of 1-3% of the total mass of cereal and water (e.g. 0.8%, 1%, 1.5%, 2%, 2.5%, 2.8%, etc.); preferably, the cereal is selected from at least one of rice, highland barley, oat.

In the above method for producing a schizophyllum commune cereal fermentation broth, as a preferred embodiment, in the step of producing the bacterial liquid, the schizophyllum commune bacterial liquid has a concentration of 10 ⁴ -10 ¹⁰ CFU/mL (e.g. 10 ⁵ CFU/mL、10 ⁶ CFU/mL、10 ⁷ CFU/mL、10 ⁸ CFU/mL、10 ⁹ CFU/mL, etc.).

In the above method for preparing a schizophyllum commune cereal fermentation broth, as a preferred embodiment, in the fermentation step, the inoculation amount is 1-10% (2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, etc.) by volume percent, that is, the volume ratio of the schizophyllum commune cereal fermentation broth to the rice fermentation substrate is 1-10:100 (such as 1:100, 2:100, 3:100, 4:100, 5:100, 6:100, 7:100, 8:100, 9:100, etc.); more preferably 1-7%; further preferably 1 to 3%.

In the above method for producing a schizophyllum commune cereal fermentation broth, as a preferred embodiment, in the fermentation step, the fermentation treatment is performed at a temperature of 20-35 ℃ (e.g., 20 ℃, 30 ℃, 32 ℃, 34 ℃ etc.) for a period of 48-72 hours (e.g., 50 hours, 55 hours, 60 hours, 65 hours, 70 hours, etc.); bottle capacity, i.e., the ratio of the volume of the fermentation system to the volume of the fermentation vessel, is 100-400mL/500mL (e.g., 150mL/500mL, 200mL/500mL, 250mL/500mL, etc.); the rotating speed is 150-210r/min (such as 160r/min, 170r/min, 180r/min, 190r/min, 200r/min, etc.). Under the fermentation condition, the schizophyllum commune has better propagation condition and better product quality.

In the above method for preparing a schizophyllum commune cereal fermentation liquor, as a preferred embodiment, in the tail treatment step, the separation treatment adopts a centrifugal treatment, and the rotational speed of the centrifugal treatment is 4000-5000rpm (such as 4200rpm, 4500rpm, 4800rpm, etc.), and the time is 20-40min (such as 22min, 25min, 30min, 35min, 38min, etc.).

In a third aspect, the present disclosure provides a schizophyllum commune cereal fermentation broth prepared by the above preparation method.

In a fourth aspect, the present disclosure provides a schizophyllum commune cereal fermentation broth freeze-dried powder, obtained by freeze-drying the schizophyllum commune cereal fermentation broth.

In a fifth aspect, the present disclosure provides the use of the schizophyllum commune cereal fermentation broth described above in cosmetics.

Benefits of the present disclosure include, but are not limited to:

1) The method selects the schizophyllum commune (Schizophyllum commune) strain YSC1 with the preservation number of CGMCC No.17788 to carry out liquid fermentation on grains such as rice and the like to finally obtain fermentation liquor, has good antioxidant, repairing, anti-aging and moisturizing effects, has no sensitization and high safety, and can be directly used as cosmetics or used as a raw material of cosmetics.

2) The preparation method of the schizophyllum commune rice fermentation liquor is simple and practical, and fermentation products such as fermentation liquor with good quality can be prepared.

The new schizophyllum commune strain disclosed by the disclosure has a preservation date of 2019, 06 month and 05 days, a preservation number of CGMCC No.17788 and a classification name of: schizophyllum commune (Schizophyllum commune) YSC1, the preservation unit name is China general microbiological culture Collection center (CGMCC), and the address is: the number 3 of North Chen West Lu 1 in the Chaoyang area of Beijing city is 100101.

Drawings

FIG. 1 shows the effect of rice medium concentration and inoculum size on pH in fermentation broth in example 2;

FIG. 2 shows the effect of rice medium concentration and inoculum size on conductivity in fermentation broth in example 2;

FIG. 3 shows the effect of rice culture concentration and inoculum size on viscosity in fermentation broth in example 2;

FIG. 4 shows the effect of rice culture concentration and inoculum size on extracellular polysaccharide in fermentation broth in example 2;

FIG. 5 shows the effect of rice culture concentration and inoculum size on biomass in fermentation broth in example 2;

FIG. 6 is a graph showing the median trend of moisture content in different areas at different time points obtained by performing water content tests on fermentation broth No.1 and SK II skin care essence lotion prepared in example 2;

FIG. 7 is a graph showing the percentage change trend of the moisture content of fermentation broth No.1 and SK II skin care essence obtained in example 2 at different time points after use and before use in various areas;

FIG. 8 is a graph showing the trend of TEWL median change in different areas at different time points obtained by performing water dispersion test on the fermentation broth No.1 and SK II skin care essence prepared in example 2;

FIG. 9 is a graph showing the trend of the percent change in TEWL after various time points and before each area of the fermentation broth No.1 and SK II skin care serum prepared in example 2 are used in the water dispersion test;

FIG. 10 shows H in example 3 ₂ O ₂ In the model, fermentation liquor samples have influence on the relative expression amounts of COL1A1, COL1A2, COL4A5, FN1, NR4A1, IGF2 and PIK3R1 genes respectively, wherein 1 is rice fermentation liquor, 2 is highland barley fermentation liquor and 3 is oat fermentation liquor;

FIG. 11 shows the effect of fermentation broth samples in the UVA model in example 3 on the relative expression levels of COL1A1, COL1A2, COL4A5, FN1, NR4A1, IGF2, PIK3R1 genes, respectively, wherein 1 is rice fermentation broth, 2 is highland barley fermentation broth, and 3 is oat fermentation broth.

Detailed Description

The following examples facilitate a better understanding of the present disclosure, but are not intended to limit the present disclosure.

The experimental methods in the following examples are all conventional methods unless otherwise specified; the test materials used in the examples described below, unless otherwise specified, were purchased from conventional biochemical reagent stores.

In the following examples, experimental data were statistically processed using SPSS 19.0 data processing software, and the comparisons between groups were analyzed using one-way ANOVA, the comparisons were performed using t-test, and the differences were statistically significant at P <0.05, and the results were obtained as followsAnd (3) representing.

Example 1

This example describes the isolation, identification and preservation of the schizophyllum commune (Schizophyllum commune) species YSC 1.

1. Isolation of species

The inventor of the present invention collects wild fungus fruiting bodies from natural protection areas (E100° 14 '31.13', N38 ° 32 '52.71'; altitude 2810-2980 m) of Qilian mountain country in Nanjiao, gansu province, zhangye. And selecting the tissue at the junction of the fungus cover and the fungus handle, and then placing the tissue on a slant culture medium filled with PDA enriched culture medium, and carrying out dark culture at 25 ℃ for 5 days to obtain hyphae. Mycelium was picked out and purified twice to obtain a purified strain of fungal YSC 1. The purification steps are as follows: mycelia were placed on a slant medium containing PDA enriched medium and dark cultured at 25℃for 5d.

2. Morphological identification

The mycelium has white hypha, the diameter of 1-1.5 mu m, branches, bends and a lock combination. On PDA culture medium, when mycelium grows vigorously, a layer of white crystal containing calcium oxalate is secreted from the surface. Hypha grows radially around an inoculation point which is usually yellowish, the hypha stolons on the surface of a matrix, and yellow or yellow brown pigment is easy to form a bacterial film when the hypha is aged. After the mycelium grows to a certain stage, under proper conditions, the mycelium starts to kink with each other, a smooth white substance is formed on the surface of the matrix, and the white substance protrudes upwards, namely the primordium of the fruiting body.

Examples: the mycelium is white villus at the initial stage of the inclined surface of the test tube, the diameter of the mycelium is 1.0-1.5 mu m, the mycelium is clung to the culture medium after one week, the mycelium turns to light yellow, a film with stronger toughness is formed, and the mycelium does not secrete pigment.

3. Molecular phylogenetic analysis

The genomic DNA of YSC1 was extracted according to the procedure of the fungal genome extraction kit (model D3390-02, OMEGA).

The YSC1 genome DNA extracted as above is used as an amplification template, and a general primer ITS1 of a fungus ribosomal rDNA region is used as a primer: TCCGTAGGTGAACCTGCGG and ITS4: TCCTCCGCTTATTGATATGC is a primer for PCR reaction. The reaction procedure is: pre-denatured at 94 ℃ for 3min, denatured at 94 ℃ for 30s, annealed at 55 ℃ for 30s, and extended at 72 ℃ for 1min for 35 cycles. Sequencing the obtained PCR product, wherein the sequencing result shows that the rDNA-ITS sequence of YSC1 is shown as SEQ ID No.1, and the sequence is subjected to on-line homology comparison with the rDNA-ITS sequence disclosed in NCBI database, so that the result shows that the homology of YSC1 and schizophyllum (Schizophyllum communestrain) fungus nucleic acid sequence is the highest, and the similarity is 99%.

4. Seed preservation of Schizophyllum commune YSC1 (Schizophyllum commune)

YSC1 has been preserved in China general microbiological culture Collection center (CGMCC) of China Committee for culture Collection of microorganisms (CGMCC, address: north Xili No.1, no. 3, of the Korean region of Beijing city) at 05, and the preservation number is CGMCC No.17788.YSC1 is known as Schizophyllum commune (Schizophyllum commune) YSC1 CGMCC No.17788.

Example 2

The rice is subjected to liquid fermentation by using a schizophyllum commune (Schizophyllum commune) strain YSC1 CGMCC No.17788, and the method comprises the following steps.

1. Preparation of YSC1 bacterial liquid

The preparation method of the schizophyllum commune YSC1 bacterial liquid comprises the following steps:

(1) YSC1 was inoculated on glucose potato agar (PDA) medium and incubated at 28 ℃ for 2d (for activation purposes);

(2) Inoculating single colony obtained in step (1) into 100mL potato dextrose water culture medium (trade name: potato dextrose water, qingdao high-tech industrial park Haibo biotechnology Co., ltd.) and culturing at 28deg.C and 180rpm for 24 hr to obtain YSC1 bacterial liquid with concentration of about 10 ⁸ CFU/ml of (c).

2. Preparation of rice fermentation substrate

Blending rice with distilled water at a ratio of 0.5-3%, and sterilizing at 121deg.C/20 min; the rice fermentation substrate is prepared.

3. Inoculating and fermenting

Inoculating the rice fermentation substrate prepared in the second step: taking freshly prepared YSC1 bacterial liquid, wherein the inoculation amount is 1-7%, and the volume of a fermentation system (namely the bottle capacity) in a triangular bottle with the capacity of 500 milliliters is 100-400 milliliters; then placing the mixture at 28 ℃ for culturing at 90-210 rpm for 24-120 hours to obtain a fermentation product.

4. Separation of fermentation products

After fermentation, the fermentation product is centrifugally separated and sterilized, wherein the centrifugal condition is 4800rpm for 10min, the sterilization condition is 121 ℃ for 20min, and a series of supernatant fluid, namely fermentation primary pulp (fermentation liquor) is obtained, and the shape indexes are as follows: the pH is 4.5-6; 3-5% of solid content; conductivity is below 350; a pale or yellowish clear or slightly turbid liquid having a viscosity of about 50-700 mpa.s; smell: slight special fermentation smell.

5. Analysis of experimental results

As is clear from FIG. 1, under the condition that the concentration of the rice culture medium is 0.5%, 1%, 1.5%, 2% and 3%, the pH value in the fermentation broth tends to decrease along with the progress of fermentation, and the process may be that schizophyllum commune grows, wherein lactic acid is mainly produced by fermentation in the sugar alcoholysis pathway, the acidity in the fermentation broth is increased, the pH tends to decrease, and if the fermentation broth is directly used as a cosmetic, the concentration of the rice culture medium should be limited to be more than 1%.

As can be seen from FIG. 2, the higher the inoculum size, the higher the conductivity of the fermentation broth, indicating that the corresponding broth has more mineral content, i.e., more nutrients in the broth, at the same rice culture medium concentration. Preferably, the inoculation amount is 3-7% and the rice culture medium concentration is 1-3%.

The development trend of the viscosity in the fermentation broth and the content of the produced extracellular polysaccharide are related to a certain extent, and as can be seen from fig. 3, the viscosity has a trend of increasing and then decreasing with the increase of the concentration of the culture medium under the condition that the inoculation amount is 7%, which indicates that the concentration of the culture medium possibly reaches a peak value in the fermentation process, and then the dissolved oxygen amount, the nutrient substances and the like in the container are insufficient, so that mycelium secretion is decreased.

As can be seen from FIG. 4, the amount of exopolysaccharide was increased at 1% and 3% of the total fermentation of Schizophyllum commune YSC1, whereas the amount of exopolysaccharide was relatively low at 5% and 7% of the total fermentation, and there was a possibility that the contact inhibition of hyphae was caused, thereby reducing the amount of exopolysaccharide secretion.

Biomass, i.e. during fermentation, the schizophyllum commune consumes nutrients in the medium to promote its own growth to synthesize mycelium, which is dried to constant weight after a period of fermentation culture. As can be seen from FIG. 5, the higher the concentration of the culture medium, the larger the inoculation amount, the higher the biomass content, good strain fluctuation and high strain density, but the secretion of extracellular polysaccharide is not necessarily facilitated.

6. Performance testing

The following properties were measured for the fermentation broth prepared in this example and lyophilized powder thereof.

1. Stability test

The fermentation broth prepared in this example (preparation conditions: 1% medium concentration, 3% inoculum size, 300ml/500ml bottle capacity, 180rpm at 28 ℃ C. For 48 hours) was prepared by adding preservative (namely, 2.3wt.%1,2 hexanediol, 0.5wt.% pentanediol) to prepare a sample, and the stability of the sample was examined according to national standard QBT 1857-2013.

The fermentation broth samples were packed in 10mL sample bottles, placed in a-20 ℃ refrigerator, taken out at 0, 1,2, 3, 4 weeks, and left at room temperature, and then observed for delamination, odor and changes in solids content (cold resistance stability). Samples were placed in a refrigerator at 40 ℃ and taken out at 0, 1,2, 3, 4 weeks, and after being left at room temperature, were observed for delamination, odor and changes in solids content (heat stability). Subpackaging the fermentation liquor sample into 10mL transparent sample bottles, placing the transparent sample bottles in an oven at 40 ℃ for 24 hours, taking out the transparent sample bottles, placing the transparent sample bottles in a refrigerator at-20 ℃ for 24 hours, regarding the transparent sample bottles as 1 cycle, observing five cycles in total, and observing whether layering, smell and solid content change (cycle stability) of the fermentation liquor sample bottles exist. The experimental results are shown in Table 1, and the stability of the fermentation broth is good.

TABLE 1 results of fermentation broth stability experiments prepared in this example

2. Safety detection-closed spot labeling experiment

The fermentation broth prepared in this example (preparation conditions: 1% in medium concentration, 3% in inoculum size, 300ml/500ml in bottle capacity, 180rpm at 28 ℃ C. For 48 hours) and its lyophilized powder solution were subjected to a skin closed patch test by referring to the "cosmetic safety Specification (2015). Skin reactions were observed according to the criteria in table 2 and observations were recorded as shown in table 3.

TABLE 2 skin response grading Standard for skin seal Patch test

As shown in table 3, a total of 30 volunteers completed the patch experiments of five samples (blank group was deionized water), and as a result, no positive reaction occurred, indicating that the samples were safer.

TABLE 3 skin seal Patch test results

3. Skin moisture content test and transdermal moisture loss test

The effect of the sample on the short-time moisturizing effect of the human body was tested, and the samples include two types, wherein the fermentation broth (preparation condition medium concentration 3%, inoculum size 1%, bottle capacity 300ml/500ml, 180rpm culture at 28 ℃ C. For 120 hours) prepared in this example was designated as fermentation broth No.1, and in addition, SK II (namely SK II skin care essence) existing in the market was used as a control.

1) Test environment: the temperature is 22+/-1 ℃; humidity is 50% -60%.

2) Test area: skin moisture content test, skin moisture loss test: left and right forearms.

3) Test time point: skin moisture content test, skin moisture loss test: before use, 5min, 20min, and 60min after use.

4) Experimental instrument: cornemeter, CM825, tewameter, TM300.

5) The testing method comprises the following steps:

30 eligible volunteers participated in the test. The test place has no direct light and no wind, the room temperature is 22-24 ℃, and the humidity is 40-60%. The double-sided forearms of the subjects were rinsed with facial cleanser before testing and left to rest for 30min, and the insides of the double-sided forearms of the subjects were marked with a marker pen to give a 3.5X3.5 cm normal skin. The skin moisture content and the skin moisture loss before use were measured sequentially.

Cutting facial mask into pieces of 3×3cm, respectively attaching to corresponding mark of forearm, taking off after 15min, slightly soaking with cosmetic cotton to dry the undried essence at the test part, and starting timing. The stratum corneum moisture content and the percutaneous moisture loss (transepidermal waterloss, TEWL) values of the 3 parts were tested at 5min, 20min, and 60min, respectively. Each site was measured 3 times and averaged.

6) Data analysis:

skin moisture content and skin moisture loss test data if the data are normally distributed, analyzing the difference of each parameter among the four groups by using a t test method; if the data is in a non-normal distribution, a non-parametric test method is applied to analyze the differences between the five sets of parameters.

7) Notice that:

the tester did not use moisturizing skin care product 48 hours before testing.

The tester cannot leave the working chamber during the whole test, and the test part remains exposed and uncovered.

And (5) if any allergic and uncomfortable conditions exist, immediately reporting by the testers, stopping the test, and cleaning the tested parts with a large amount of clear water.

8) Experimental results:

moisture content testing:in the test, the change trend analysis is carried out on the median of different data, and the results are shown in fig. 6-7. From the graph, the water content of the sample reaches the maximum 5min after the use, and gradually decreases and becomes gentle with the extension of the time after the use; the water content change percentages of the two samples reach the maximum after 5min, and the water content change percentages of the two samples are smaller than 0 after 20min and 60min, wherein the reduction amplitude of the fermentation broth No.1 is the maximum. From the trend, the percent change of the water content of the fermentation liquid No.1 is higher than that of SK II, and from the significance, the two are not significantly different.

The water content values of different time points after the use of each sample and the values before the use of the respective region are subjected to T test, the significance of the water content values is judged, the results are shown in Table 4, the water content of the two samples after the use for 5min and 20min is not significantly different from the water content of the two samples before the use, and the water content of the two samples after the use for 60min is significantly different from the water content of the two samples before the use; by one-way ANOVA analysis of the percent change in water content, there was no significant difference between the water content at 5min, 20min, 60min after use for both samples.

Table 4 analysis of the significance of the skin water content of the samples before and after use

Note that: the letters are different, which means that the differences among groups are significant; the same letters indicate no significant difference between groups, and the letter ordering is in increasing order from the average.

Percutaneous moisture loss test:the samples were subjected to skin transdermal water loss tests at various time points before and after use, and the results are shown in fig. 8 and 9. T test is carried out on the TEWL value of each sample at different time points after use and the value before use of each region, the significance of the TEWL value is judged, the result is shown in a table 5, and the two samples have significant differences compared with the samples before use at the time of 5min after use, wherein the TEWL value of the SKII sample at 20min after use also has significant differences compared with the TEWL value before use; by one-way ANOVA analysis of the percent TEWL change, there was no significant difference between samples at the same time point, but two samples had significant differences in TEWL 5min after use compared to the other two groups of time points of use.

Table 5 analysis of skin TEWL of samples for significance before and after use

The test analyzes the variation trend of the median of different data, and the results are shown in fig. 8 and 9. The TEWL values of the two samples reach the maximum 5min after use, and the samples have a descending trend and tend to be gentle along with the extension of the use time; the TEWL change percentage is maximum at 5min after use, and the TEWL change percentage is reduced along with the extension of the time after use, wherein the TEWL change percentage of a fermentation broth sample No.1 is smaller than that of a SKII sample after 20min after use. From the trend, the change percentage of the percutaneous water loss of the fermentation liquor No.1 and the SKII is smaller than 0 in 60min, which means that the fermentation liquor No.1 and the SKII can reduce the skin TEWL value and have the effect of repairing the skin barrier; from the perspective of significance, there was no significant difference between the two.

Example 3

The method comprises respectively fermenting rice, semen Avenae Nudae and herba Avenae Fatuae with Schizophyllum commune (Schizophyllum commune) strain YSC1 CGMCC No.17788, and comprises the following steps.

1. Preparation of YSC1 bacterial liquid

The procedure of preparation of the schizophyllum commune YSC1 bacterial liquid is the same as that of example 2.

2. Fermentation substrate preparation

Respectively blending rice, highland barley and oat with distilled water at a mass percentage of 1%, and sterilizing at 121 ℃/20min to obtain a fermentation substrate.

3. Inoculating and fermenting

Inoculating the fermentation substrate prepared in the second step: taking freshly prepared YSC1 bacterial liquid, wherein the inoculation amount is 3%, and the volume of a fermentation system (namely the bottle capacity) in a triangular bottle with the capacity of 500 milliliters is 250 milliliters; then, the mixture was incubated at 28℃and 150rpm for 48 hours to obtain a fermentation product.

4. Separation of fermentation products

And after fermentation, centrifugally separating and sterilizing the fermentation product, wherein the centrifugal condition is 4800rpm for 10min, the sterilization condition is 121 ℃ for 20min, taking supernatant fluid, respectively obtaining rice fermentation liquid, highland barley fermentation liquid and oat fermentation liquid, and further preparing into freeze-dried powder for later use.

5. Performance testing

1. Determining the Effect of fermentation broth samples on oxidatively damaged cells

The reagents and manufacturers used in this experiment were as follows: 0.25% (containing EDTA) trypsin, GIBCO Life technologies, inc., USA; DMEM high sugar medium, GIBCO life technologies, usa; fetal bovine serum, GIBCO life technologies, usa; DMSO, biotupped; CCK-8,Merck Millipore; human fibroblast (HSF), cell bank of China academy of sciences; FM medium, corning, USA; trizol (Total RNA extraction reagent), biyun Biotechnology Co.

The experimental method is as follows:

1) Cell resuscitation and culture: taking out the frozen fibroblast from liquid nitrogen, immediately placing the frozen fibroblast in a water area of a water bath kettle at 37 ℃, taking out and blowing uniformly after the mixed solution of the cell and the serum is completely melted, immediately transferring the mixed solution into a T75 culture bottle, and then adding 15mL of DMEM culture medium. T75 flasks were placed in 5% CO ₂ Culture recovery was performed in an incubator at 37 ℃. After successful resuscitation, fibroblasts were passaged by washing 2 times with PBS, adding 2mL of pancreatin per bottle of cells, stopping digestion after complete digestion and suspension of cells, adding 4mL of DMEM medium, transferring the cell suspension to a 15mL centrifuge tube, centrifuging at 1000rpm for 5 minutes, removing the supernatant, adding 4mL of DMEM medium, blowing cell pellet and medium uniformly, then transferring to 4T 75 flasks in an average distribution, and transferring to 5% CO ₂ Subculturing was performed in an incubator at 37 ℃.

2) Establishment of UVA oxidative stress injury model

HSF cells were 1X 10 per well ⁴ Inoculating into 96-well plate, culturing overnight in cell culture box, discarding culture medium, and screening UVA-stimulated fibroblast dose by CCK-8 method with UVA dose of 7J/cm respectively ² 、9J/cm ² 、10J/cm ² 、12J/cm ² 、15J/cm ² 、18J/cm ² 、20J/cm ² 、22J/cm ² 、25J/cm ² . The UVA dose is determined based on the calculated cell viability and cell morphology changes.

Examining the viability of HSF cells after treatment with different doses of UVA, it can be seen that the viability of HSF cells gradually decreases with increasing UVA dose. The inhibition of cell proliferation was not evident at too low a dose of UVA, when the UVA dose was 22J/cm ² The cell viability was (50.89.+ -. 3.84)%. When an oxidative stress model is established, the cell viability is generally in the range of 50% to 70%. The cell survival rate is too high to cause obvious oxidative damage, but the cell survival rate is too low to cause irreversible damage, and the construction of an oxidative stress model is not facilitated. Therefore, 20J/cm is selected ² The dose of UVA establishes a model of injury.

By a similar method, H is established ₂ O ₂ Oxidative stress injury model.

3) Detection of cytotoxicity by each broth sample and control sample:

a. collecting fibroblast, and preparing into 10×10 concentration with DMEM medium ⁴ Each/mL of the cell suspension was added to 100. Mu.L of the cell suspension per well in a 96-well plate.

b.5％CO ₂ Incubation was performed at 37℃for 12 hours or overnight, the cell culture solution was discarded, 100. Mu.L of samples (previously prepared solutions of different concentrations of the fermented lyophilized powder and the control sample) were added to each well of the experimental group, and 5 duplicate wells were set for each concentration. Meanwhile, a control group (containing cells+serum-free DMEM medium) and a blank group (PBS alone) were set. Samples were prepared using serum-free DMEM medium.

c. 96-well plates were incubated at 5% CO ₂ Incubation was carried out in an incubator at 37℃for the corresponding time of action, then 10. Mu.L of CCK-8 solution was added to each well, and after incubation for a further 2-4 hours, absorbance was measured at a wavelength of 450 nm. Cell viability was calculated by the following formula: cell viability (%) = (OD experimental group-OD blank)/(OD control-OD blank) ×100%. The results are shown in the following table, and it can be found that the three fermentation broths have almost no damage to cells and have a certain proliferation effect.

4) According to H obtained in step 2 ₂ O ₂ An oxidative stress injury model and a UVA oxidative stress injury model; h is added to the cultured cells ₂ O ₂ UVA is stimulated for 2 hours, then a sample (highland barley fermentation broth freeze-dried powder solution 0.32mg/mL, rice fermentation broth freeze-dried powder solution 0.625mg/mL, oat fermentation broth freeze-dried powder solution 0.04mg/mL and ectoin solution 0.008 mg/mL) is added for repair treatment, and the cell survival rate is measured by adopting a CCK-8 method. The results are shown in the table below, and the comparison of the sample group and the model group shows that the sample group can obviously improve the survival rate of cells, which proves that the sample group has a certain proliferation effect on the cells.

TABLE 6 cytotoxicity test results on different samples

4) qPCR detection of cellular mRNA expression levels

The sample fluid is as follows: highland barley fermentation broth freeze-dried powder solution 0.32mg/mL, rice fermentation broth freeze-dried powder solution 0.625mg/mL, oat fermentation broth freeze-dried powder solution 0.04mg/mL, and ectoin solution 0.008mg/mL.

Extracting RNA, qPCR detecting the relative expression of genes according toTop Green qPCR SuperMix kit was operated with a total reaction system of 20. Mu.L, and specific reagents and amounts are shown in Table 7.

TABLE 7 reagents and amounts

Cycle parameters: the reaction was performed at 94℃for 30s, then at 94℃for 15s, at 60℃for 15s, at 72℃for 10s, for 45 cycles, and fluorescence data were collected at 72 ℃.

The design and synthesis of the primers are shown in Table 8.

TABLE 8 Real-Time PCR primer sequences

Fermentation broth acting on H ₂ O ₂ Damaged cells were validated and the results are shown in fig. 10 (significant differences, #p<0.05, very significant difference, #p<0.01). From the figure, it can be seen that these three fermentation broths may exert cell proliferation and DNA repair effects by up-regulating insulin growth factors, and also promote the formation of anti-apoptotic proteins (Bcl-xl) by modulating upstream genes.

The results of the validation of the effect of the fermentation broth on UVA-damaged cells are shown in fig. 11 (significant differences, #p <0.05, very significant differences, #p < 0.01). From the figure, it can be seen that all three fermentation broths up-regulate CLOL1A1, FN1, NR4A1, IGF2 and PIK3R1, suggesting that these three broths may act to protect fibroblasts from UVA oxidative damage by up-regulating insulin growth factor, collagen and fibronectin synthesis.

Finally, it is further noted that in this disclosure relational terms such as first and second, and the like are used solely to distinguish one entity or action from another entity or action without necessarily requiring or implying any actual such relationship or order between such entities or actions. Moreover, the terms "comprises," "comprising," or any other variation thereof, are intended to cover a non-exclusive inclusion, such that a process, method, article, or apparatus that comprises a list of elements does not include only those elements but may include other elements not expressly listed or inherent to such process, method, article, or apparatus. Without further limitation, an element defined by the phrase "comprising one … …" does not exclude the presence of other like elements in a process, method, article, or apparatus that comprises the element.

While the disclosure has been disclosed by the foregoing description of specific embodiments thereof, it will be understood that various modifications, improvements, or equivalents may be devised by those skilled in the art that will fall within the spirit and scope of the appended claims. Such modifications, improvements, or equivalents are intended to be included within the scope of this disclosure.

cttccgtagggtgaacctgcggaaggatcattaacgaatcaaacaagttcatcttgttctgatcctgtgcaccttatgtagtcccaaagccttcacgggcggcggttgactacgtctacctcacaccttaaagtatgttaacgaatgtaatcatggtcttgacagaccctaaaaagttaatacaactttcgacaacggatctcttggctctcgcatcgatgaagaacgcagcgaaatgcgataagtaatgtgaattgcagaattcagtgaatcatcgaatctttgaacgcaccttgcgccctttggtattccgaggggcatgcctgtttgagtgtcattaaataccatcaaccctcttttgacttcggtctcgagagtggcttggaagtggaggtctgctggagcctaacggagccagctcctcttaaatgtattagcggatttcccttgcgggatcgcgtctccgatgtgataatttctacgtcgttgaccatctcggggctgacctagtcagtttcaataggagtctgcttctaaccgtctcttgactgagactagcgacttgtgcgctaacttttgacttgacctcaaatcaggtaggactacccgctgaacttaagcatatcaataaagcggaggaa

Claims

1. A schizophyllum commune cereal fermentation liquor is characterized in that schizophyllum commune with the preservation number of CGMCC No.17788 is adoptedSchizophyllum commune) The YSC1 is prepared by liquid fermentation of grains selected from at least one of rice, highland barley, and oat.

2. A method for preparing schizophyllum commune cereal fermentation broth, comprising the steps of:

the preparation method of the bacterial liquid comprises the following steps: inoculating schizophyllum commune YSC1 with the preservation number of CGMCC No.17788 into a proper culture medium for culture activation treatment, and then inoculating single colony obtained by the culture activation treatment into the proper culture medium for expansion culture to obtain schizophyllum commune bacterial liquid;

the preparation step of fermentation substrate: mixing grains and water in proportion, and sterilizing to obtain a fermentation substrate; the cereal is selected from at least one of rice, highland barley and oat;

fermentation: inoculating the schizophyllum commune bacterial liquid to the fermentation substrate, and carrying out fermentation treatment;

3. The method for producing a fermentation broth of schizophyllum commune cereal according to claim 2, wherein the amount of cereal used in the fermentation substrate production step is 1 to 3% of the total mass of cereal and water.

4. The method for producing a schizophyllum commune cereal fermentation broth according to claim 2 or 3, wherein in the step of producing a bacterial liquid, the schizophyllum commune bacterial liquid has a concentration of 10 ⁴ -10 ¹⁰ CFU/mL。

5. The method according to claim 4, wherein in the fermentation step, the volume ratio of the schizophyllum commune liquid to the fermentation substrate is 1-10:100.

6. The method according to claim 5, wherein in the fermentation step, the volume ratio of the schizophyllum commune liquid to the fermentation substrate is 1-7%.

7. The method for producing a fermentation broth of schizophyllum commune cereal according to claim 6, wherein in the fermentation step, the volume ratio of the schizophyllum commune broth to the fermentation substrate is 1-3% by volume.

8. The method for producing a fermentation broth of schizophyllum commune cereal according to any of claims 2 to 3 and 5 to 7, wherein in the fermentation step, the fermentation treatment is carried out at a temperature of 20 to 35 ℃ for 48 to 72 hours, and the ratio of the volume of the fermentation system to the capacity of the fermentation vessel is 100 to 400mL/500 mL.

9. The method for producing a fermentation broth of schizophyllum commune cereal according to claim 8, wherein the fermentation treatment is carried out in a shaker at a rotational speed of 150-210r/min.

10. The method for producing a fermentation broth of schizophyllum commune cereal according to any of claims 2 to 3, 5 to 7 and 9, wherein in the tail treatment step, the separation treatment is a centrifugal treatment at a rotational speed of 4000 to 5000rpm for 20 to 40 minutes.

11. A schizophyllum commune cereal ferment characterized in that a schizophyllum commune cereal ferment liquid prepared by the preparation method of any one of claims 2-10 is adopted or is further subjected to freeze drying treatment to obtain a schizophyllum commune cereal ferment liquid freeze-dried powder.

12. Use of the schizophyllum commune cereal ferment of claim 11 for the preparation of cosmetics.