CN114717323A - Application of gene regulator in preparation of liver cancer metastasis drugs - Google Patents
Application of gene regulator in preparation of liver cancer metastasis drugs Download PDFInfo
- Publication number
- CN114717323A CN114717323A CN202210632526.6A CN202210632526A CN114717323A CN 114717323 A CN114717323 A CN 114717323A CN 202210632526 A CN202210632526 A CN 202210632526A CN 114717323 A CN114717323 A CN 114717323A
- Authority
- CN
- China
- Prior art keywords
- gene
- liver cancer
- application
- cancer metastasis
- preparing
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Abstract
The invention provides an application of a gene regulator in preparing a liver cancer metastasis medicament, belonging to the technical field of biology. The biomarker provided by the invention is ENST00000415932.1 gene, and experiments show that the ENST00000415932.1 gene is low in expression in peripheral blood mononuclear cells of liver cancer patients, and the ENST00000415932.1 gene has high diagnostic value when being used for diagnosis. Moreover, the invention discovers that the overexpression of the ENST00000415932.1 gene in the liver cancer cell can effectively inhibit the invasion of the liver cancer cell, so that the plasmid for promoting the overexpression of the ENST00000415932.1 gene can be used for preparing the medicine for treating liver cancer metastasis.
Description
Technical Field
The invention belongs to the technical field of biology, and particularly relates to an application of a gene regulator in preparation of a liver cancer metastasis medicament.
Background
Liver cancer is one of the most common malignant tumors worldwide. Liver cancer is highly heterogeneous, and thus has the characteristics of easy metastasis, relapse and drug resistance compared with other solid tumors. Although the therapeutic technology for liver cancer is now continuously improved, the 5-year survival rate of liver cancer patients is not significantly improved.
LncRNA is a transcript greater than 200nt in length, which is unable to encode proteins due to its lack of open reading frames. At the very beginning, lncRNA was considered a garbage gene and had no biological function. However, subsequent studies have shown that lncRNA can participate in physiological activities of cells through transcriptional activation, mRNA degradation, and translational regulation, and can participate in the development of various diseases. Therefore, the early diagnosis of the liver cancer patient is realized by utilizing the lncRNA, and the effect of the lncRNA in liver cancer metastasis is researched, so that the early diagnosis and the early treatment of the liver cancer patient are of great significance to the improvement of the survival rate of the liver cancer patient.
Disclosure of Invention
The invention aims to provide an application of a gene regulator in preparing a liver cancer metastasis medicament.
In a first aspect, the invention provides an application of a reagent for detecting ENST00000415932.1 gene expression in preparing a liver cancer diagnostic kit.
Preferably, the cDNA sequence of the ENST00000415932.1 gene is shown as SEQ ID NO. 1.
Preferably, the reagent is a fluorescent quantitative PCR primer for detecting the expression level of the ENST00000415932.1 gene.
Preferably, the sequence of the fluorescent quantitative PCR primer is as follows:
the upstream primer is as follows: CTGGACGACACAGTGAGACC, respectively;
the downstream primer is: GGCTCAATGGTTCATGCCTG are provided.
In a second aspect, the invention provides an application of a regulator of ENST00000415932.1 gene in preparing a medicine for treating liver cancer metastasis, wherein the cDNA sequence of the ENST00000415932.1 gene is shown as SEQ ID NO. 1.
Preferably, the modulator is an overexpression plasmid of the ENST00000415932.1 gene.
In a third aspect, the invention provides an application of a regulator of ENST00000415932.1 gene in preparing a liver cancer cell invasion inhibiting drug, wherein the cDNA sequence of the ENST00000415932.1 gene is shown in SEQ ID NO. 1.
Preferably, the modulator is an overexpression plasmid of the ENST00000415932.1 gene.
In a fourth aspect, the invention provides an application of a regulator of ENST00000415932.1 gene in preparing a medicine for inhibiting liver cancer cell invasion promoting protein N-cadherin, wherein the cDNA sequence of the ENST00000415932.1 gene is shown in SEQ ID NO. 1.
Preferably, the modulator is an overexpression plasmid of the ENST00000415932.1 gene.
In a fifth aspect, the invention provides an application of a regulator of ENST00000415932.1 gene in preparing a drug for inhibiting hepatoma cell invasion arrestin E-cadherin, wherein the cDNA sequence of the ENST00000415932.1 gene is shown in SEQ ID NO. 1.
Preferably, the modulator is an overexpression plasmid of the ENST00000415932.1 gene.
The invention has the beneficial effects that:
the invention discovers that the ENST00000415932.1 gene is low in expression in peripheral blood mononuclear cells of liver cancer patients, and an ROC curve shows that the AUC value of the ENST00000415932.1 gene in liver cancer diagnosis is 0.907, so that the ENST00000415932.1 gene has higher diagnosis value, and the ENST00000415932.1 gene can be used for preparing a liver cancer diagnosis kit.
Drawings
FIG. 1 shows the relative expression levels of ENST00000415932.1 gene in peripheral blood mononuclear cells of the normal group and the liver cancer group;
FIG. 2 is a ROC curve showing the diagnostic effect of ENST00000415932.1 gene;
FIG. 3 is the effect of pcDNA3.1-ENST00000415932.1 plasmid in increasing the expression of ENST00000415932.1 gene;
FIG. 4 is the effect of overexpression of ENST00000415932.1 gene on hepatoma cell Hep3B cell invasion;
FIG. 5 shows the effect of overexpression of ENST00000415932.1 gene on protein associated with hepatoma cell Hep3B cell invasion.
Detailed Description
In order to clearly illustrate the technical features of the present solution, the present solution is explained below by way of specific embodiments.
Example 1
(1) Venous blood of 50 liver cancer patients and venous blood of 50 normal persons are collected;
(2) taking 2ml of venous blood, adjusting the rotating speed of a centrifugal machine to 3500 rpm, centrifuging for 10min, wherein the blood is divided into two layers, the upper layer is faint yellow plasma, and the lower layer is cells;
(3) removing the upper layer of plasma, adding normal saline according to the proportion of 1:1, and gently mixing;
(4) adding 4ml of lymphocyte separation liquid into an enzyme-free centrifuge tube, carefully pouring cells mixed with physiological saline into the centrifuge tube, adjusting the rotation speed of a centrifuge to 1500 revolutions per minute, and centrifuging for 20 min;
(5) at the moment, the liquid is divided into 3 layers, wherein the top layer is light yellow plasma, the middle layer is milk white lymphocyte, the lower layer is red blood cell, the cells in the middle layer are carefully sucked into a centrifuge tube, the rotation speed of the centrifuge is adjusted to 10000 r/min, and the centrifuge is centrifuged for 5 min;
(6) and after the centrifugation is finished, removing the supernatant, and reserving the precipitate to obtain the mononuclear cells.
Example 2
(1) Adding 1ml of Trizol into the obtained mononuclear cells, and blowing the cells by using a pipette;
(2) adding 200ul chloroform, mixing, standing at room temperature for 5min, and centrifuging in a centrifuge;
(3) after the centrifugation is finished, carefully absorbing the upper-layer water phase into a new enzyme-free centrifuge tube, adding isopropanol, placing on ice for 10min, placing in a centrifuge for centrifugation, and after the centrifugation is finished, keeping the precipitate;
(4) adding 500ul of precooled 70% ethanol to dissolve and precipitate, centrifuging, removing supernatant, drying at room temperature for 5-10min, and adding DEPC water to obtain RNA;
(5) gDNA removal reaction system configured by reference reverse transcription kit
| Composition of matter | Amount of the composition used |
| 5×gDNA Buffer | 2μL |
| TotaL RNA | 2μg |
| RNase-Free ddH2O | Make up to 10. mu.L |
The reaction conditions set were: 42 ℃ for 3min, and after completion, the mixture was placed on ice.
(6) Configuring a reverse transcription reaction system
| Composition of matter | Amount of the composition used |
| 10×King RT Buffer | 2μL |
| FastKing RT Enzyme Mix | 1μL |
| FQ-RT Primer Mix | 2μL |
| Reaction solution in step (5) | 10μL |
| RNase-Free ddH2O | 5μL |
The reaction conditions set were: placing on ice at 42 deg.C for 15min and 95 deg.C for 3 min.
(7) Preparing reaction solution according to fluorescent quantitative PCR kit
| Composition (I) | Volume of |
| SYBR⑩Premix Ex Taq II | 10μl |
| PCR upstream primer | 0.8μl |
| PCR downstream primer | 0.8μl |
| ROX Reference Dye | 0.4μl |
| DNA template | 2μl |
| dH2O | 6μl |
| Total | 20μl |
The reaction conditions set were: pre-denaturation at 95 ℃ for 30s, 5s at 95 ℃ and 35s at 60 ℃ and 40 cycles were repeated.
(8) Beta-actin is used as internal reference, 2 is adopted-∆∆CtThe method of (4) calculates the relative expression level of the gene.
The gene detected by the invention is ENST00000415932.1 gene, and the sequence cDNA sequence of the gene is as follows:
GGCAAAGTTCAGCATCATCCTCTCTGCTGAAATAACCAACATGGTGCTCATTAATTGGTCATGTGAGCACTAAGGATAACCACCCTCCCCTCCTCAATCAGGATCACAAATGCTAGCTTTCATATGGATTTCAAGCTGGGTGAAATGACTTTTTTTGCTTGTAAAGAAGAAATGATGATGGAGGTCTCATCAGGAAGTGATGCAGAAGACTGGGACAGACGGGGGTTTCACCATGTTGGCCAGGATGGTCTCAAACTCCTAACCTCGCGATCCACCCACCTCGGCCTCCCAAAGTGCTAGGATTACAGGCGTGAGGCACTGCACCCAGCCCATCATAAGTATTTTCATGTATCATCATGTATTTTAGAAAATGGTATTATTGACTATATATCAGTTCATTGTGTGCACACATTTTATTTAATTAATTTGCTCTTTTCAGTTATTTAGTTTTCTTTTTTTGTTATTATAAATTTCATAGTAATATATGTCCTTATACATAAATCTGAGTATGAATCTAGGATTATTTACTTAAAATGAATTTCCAGACACAAATTGTGGGGTTAAAGTGGGAGGAGCATTTTTAAAGCTTTTGATATATACCGCTAAATTGTCTTATAGGAATGTATAAATTATGAAACAACCAGCTGTCCATGTGAGACCATGCATTTCCTTATCCAAATGAAGTTAAAGAAATTATTTGTCAGCTTTTTTGGTGGTATGTGGTAACTCCTTTTCCTGATTTGAATGTTTTTCTAGTACTAGTGACTTTTTACAGGTTTTTCTTATGTTTGTTGGTTGAGTTTTTTTTTTTAATGTCTATGCCTATCTTAGTATCTATGCCTATTTTAATTTTTTAATGTCTATGTACTTTCTTTTGGAGCATGTTGTATGATATTTTATAAATAAAAGGTGTTAACTCTGTCATTATAGTGTAAATATATTTCCCAATATGTTTTTAAATTTTCATTTATGATATATAGAAATTTTAACTTTTATATATTAAAAATATCTATATTTAAATGACTTTGTCCAGATGTAGTGACTCATGCCTGTAATCACAGAATTTTGAGAGGCTATGTCAAGAGGATTGCTTGAGGCCAGGAGTTCCTGGCCAGCCTGGACGACACAGTGAGACCCCTATCTCTAAAAAAGTTTTTTTTCAAACAATCCTGCCACCTCAGCTTCCTAAAGTGCTGGGATTACAGGCATGAACCATTGAGCCCAGGTTCTTTGTAATATCTTCCTCCACGTTTTTACGTATCAATCCTGCATTCAAACATTTACTCATTCTGAAACAAATTTTAGTATATGTTATAAGGTATTGATCCAAATTTTTACGTTTATAAATAGTTAACATCTCCAAACCATTTATTGATATTAATTTCACCTTCATCATATTGTAAATTATAGTTTTGATTTTCCTTTTTGACAATGAATTATCTAAGAGGATACTTTAGAATTTTCAAACTTAATAAAAAACTTTT；
the upstream primer sequence of the ENST00000415932.1 gene is as follows: CTGGACGACACAGTGAGACC, SEQ ID NO. 2;
the sequences of the downstream primers of the ENST00000415932.1 gene are as follows: GGCTCAATGGTTCATGCCTG, SEQ ID NO. 3;
the results obtained from the experiment are shown in fig. 1, the relative expression level of the ENST00000415932.1 gene in the hepatoma group mononuclear cells is 0.485 ± 0.273, the P value is less than 0.001, and the difference has statistical significance, which indicates that the relative expression level of the ENST00000415932.1 gene in the hepatoma group mononuclear cells is lower than that in the normal group.
To test the diagnostic effect of ENST00000415932.1, the present invention plotted an ROC curve, with the results shown in fig. 2. The area under the curve (AUC) was 0.907, the confidence interval was 0.849-0.965, the Cut-off value was 0.805, the sensitivity was 0.900, the specificity was 0.800, the positive predictive value was 0.818, and the negative predictive value was 0.889.
The closer the AUC is to 1, the better the diagnostic effect. AUC has lower accuracy at 0.5-0.7, certain accuracy at 0.7-0.9, and higher accuracy at 0.9 or above. The AUC value of the invention is 0.907, which shows that ENST00000415932.1 has higher accuracy when being used for diagnosing whether a patient has liver cancer, so that the invention can be used for assisting in diagnosing whether the patient has the liver cancer.
Example 3
The invention provides a fluorescent quantitative PCR kit for diagnosing liver cancer, which comprises SYBR Premix Ex Taq II, ENST00000415932.1 gene upstream primer and ENST00000415932.1 gene downstream primer,ROX Reference Dye, DNA modulo and dH2O；
The upstream primer sequence of the ENST00000415932.1 gene is as follows: CTGGACGACACAGTGAGACC, SEQ ID NO. 2;
the sequences of the downstream primers of the ENST00000415932.1 gene are as follows: GGCTCAATGGTTCATGCCTG, SEQ ID NO. 3.
Example 4
(1) pcDNA3.1 plasmid is used for constructing overexpression plasmid of ENST00000415932.1 gene, the restriction sites are XbaI restriction sites and EcoRI restriction sites, and the primer sequences are as follows:
an upstream primer: TCTAGAGGCAAAGTTCAGCAT, SEQ ID NO. 4;
a downstream primer: GAATTCAAAAGTTTTTTATTA, SEQ ID NO. 5;
(2) inoculating the liver cancer cell Hep3B cell into a 6-well plate, when the cell density reaches 90%, transfecting pcDNA3.1 plasmid in a control group and transfecting pcDNA3.1-ENST00000415932.1 plasmid in an experimental group;
(3) the expression of ENST00000415932.1 was tested for changes according to the procedure of example 2.
As shown in FIG. 3, it can be seen that the transfection of pcDNA3.1-ENST00000415932.1 can effectively improve the expression level of ENST 00000415932.1.
Example 5
Regulation of hepatoma cell invasion by overexpression of ENST00000415932.1
(1) Melting the Matrigel glue in a refrigerator at 4 ℃ overnight, and then diluting the Matrigel glue by using a pre-cooled serum-free culture medium according to a ratio of 1: 3;
(2) placing the chamber into a 24-hole plate, adding the diluted Matrigel glue into a Transwell chamber to enable the glue to be flatly paved in the chamber, and then placing the 24-hole plate into a cell culture box to solidify the Matrigel glue;
(3) the Hep3B cells transfected with pcDNA3.1 plasmid and pcDNA3.1-ENST00000415932.1 plasmid were made into 5X 104A single cell suspension in ml;
(4) add 200. mu.l of single cell suspension to a Transwell chamber plated with Matrigel gel;
(5) adding 500 μ l of DMEM medium containing 10% FBS to the 24-well plate, and then putting the 24-well plate into a cell culture box for culturing for 24 h;
(6) after the culture is finished, taking out the Transwell chamber, washing the Transwell chamber by using PBS (phosphate buffer solution), and slightly wiping off cells on the inner membrane of the chamber by using a cotton swab;
(7) polyformaldehyde fixed cells are added into a 24-pore plate, and the fixed cells are stained by using a crystal violet cell staining solution;
(8) the staining solution was removed, the cells were washed with PBS, and then photographed under an inverted microscope, and 5 different fields were selected for averaging.
The experimental results are shown in FIG. 4, and it can be seen that the number of cells passing through the Transwell chamber in the experimental group is significantly less than that in the control group, which indicates that the invasion ability of hepatoma cell Hep3B can be effectively inhibited by over-expressing ENST00000415932.1 gene.
Example 6
Regulation of cell invasion-related protein in liver cancer cells by overexpression of ENST00000415932.1
(1) Inoculating the Hep3B cells into a 6-hole cell culture plate, transfecting an experimental group with pcDNA3.1 plasmid, transfecting an experimental group with pcDNA3.1-ENST00000415932.1 plasmid, setting 3 repeats for each group, and after transfecting for 48 hours, adding a protein lysate to lyse the cells;
(2) scraping the cells by using a cell scraper, collecting the cells into a 1.5ml centrifuge tube, placing the centrifuge tube on ice for cracking for 30min, shaking the centrifuge tube for 1min by using a vortex oscillator every 10min, and repeating the steps for 3 times;
(3) after the cracking is finished, putting the protein sample into a centrifuge for centrifuging, and after the centrifugation is finished, collecting the supernatant into a new 1.5ml centrifuge tube;
(4) detecting the concentration of the protein sample by using a BCA method, and adjusting the concentration of the protein sample by using SDS Loading Buffer;
(5) preparing SDS-PAGE separation gel and concentrated gel according to a configuration table, assembling an electrophoresis frame after the preparation, placing the electrophoresis frame in an electrophoresis tank, adding electrophoresis liquid, and carrying out sample addition on a protein sample and a protein Marker;
(6) opening the electrophoresis apparatus, adopting constant pressure 80V for the concentrated gel, adopting constant pressure 120V for the separation gel, and stopping electrophoresis when bromophenol blue reaches the bottom of the separation gel;
(7) installing a film rotating clamp according to the sequence of the spongy cushion, the filter paper, the gel, the PVDF film, the filter paper and the spongy cushion, performing constant current of 250mA, and performing electric rotation for 1.5 h;
(8) after the electrotransformation is finished, taking out the PVDF membrane, placing the PVDF membrane in 5% skimmed milk powder prepared by TBST, and sealing the PVDF membrane for 1.5h at room temperature on a horizontal shaking table;
(9) diluting E-cadherin, N-cadherin and beta-actin according to the antibody specification, cutting the membrane, incubating the primary antibody, and then placing the membrane at 4 ℃ for incubation overnight;
(10) after the incubation is finished, recovering the primary antibody, and washing the PVDF membrane by using TBST for 3 times, 10min each time;
(11) incubating the secondary antibody according to the instruction, and incubating for 1h at room temperature;
(12) the secondary antibody was removed, and the PVDF membrane was washed with TBST 3 times for 10min each, and then developed and exposed by adding a luminescent solution.
The results of the experiment are shown in FIG. 5, from which it can be seen that overexpression of ENST00000415932.1 gene can effectively promote the expression of E-cadherin protein and can effectively suppress the expression of N-cadherin protein, which further verifies the results of example 5.
The technical features of the present invention which are not described in the above embodiments may be implemented by or using the prior art, and are not described herein again, of course, the above description is not intended to limit the present invention, and the present invention is not limited to the above examples, and variations, modifications, additions or substitutions which may be made by those skilled in the art within the spirit and scope of the present invention should also fall within the protection scope of the present invention.
Sequence listing
<110> university of Shandong Master
Application of gene regulator in preparation of liver cancer metastasis drugs
<150> 2021112456138
<151> 2021-10-26
<160> 5
<170> SIPOSequenceListing 1.0
<210> 1
<211> 1484
<212> DNA
<213> Human source (Human)
<400> 1
ggcaaagttc agcatcatcc tctctgctga aataaccaac atggtgctca ttaattggtc 60
atgtgagcac taaggataac caccctcccc tcctcaatca ggatcacaaa tgctagcttt 120
catatggatt tcaagctggg tgaaatgact ttttttgctt gtaaagaaga aatgatgatg 180
gaggtctcat caggaagtga tgcagaagac tgggacagac gggggtttca ccatgttggc 240
caggatggtc tcaaactcct aacctcgcga tccacccacc tcggcctccc aaagtgctag 300
gattacaggc gtgaggcact gcacccagcc catcataagt attttcatgt atcatcatgt 360
attttagaaa atggtattat tgactatata tcagttcatt gtgtgcacac attttattta 420
attaatttgc tcttttcagt tatttagttt tctttttttg ttattataaa tttcatagta 480
atatatgtcc ttatacataa atctgagtat gaatctagga ttatttactt aaaatgaatt 540
tccagacaca aattgtgggg ttaaagtggg aggagcattt ttaaagcttt tgatatatac 600
cgctaaattg tcttatagga atgtataaat tatgaaacaa ccagctgtcc atgtgagacc 660
atgcatttcc ttatccaaat gaagttaaag aaattatttg tcagcttttt tggtggtatg 720
tggtaactcc ttttcctgat ttgaatgttt ttctagtact agtgactttt tacaggtttt 780
tcttatgttt gttggttgag tttttttttt taatgtctat gcctatctta gtatctatgc 840
ctattttaat tttttaatgt ctatgtactt tcttttggag catgttgtat gatattttat 900
aaataaaagg tgttaactct gtcattatag tgtaaatata tttcccaata tgtttttaaa 960
ttttcattta tgatatatag aaattttaac ttttatatat taaaaatatc tatatttaaa 1020
tgactttgtc cagatgtagt gactcatgcc tgtaatcaca gaattttgag aggctatgtc 1080
aagaggattg cttgaggcca ggagttcctg gccagcctgg acgacacagt gagaccccta 1140
tctctaaaaa agtttttttt caaacaatcc tgccacctca gcttcctaaa gtgctgggat 1200
tacaggcatg aaccattgag cccaggttct ttgtaatatc ttcctccacg tttttacgta 1260
tcaatcctgc attcaaacat ttactcattc tgaaacaaat tttagtatat gttataaggt 1320
attgatccaa atttttacgt ttataaatag ttaacatctc caaaccattt attgatatta 1380
atttcacctt catcatattg taaattatag ttttgatttt cctttttgac aatgaattat 1440
ctaagaggat actttagaat tttcaaactt aataaaaaac tttt 1484
<210> 2
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
ctggacgaca cagtgagacc 20
<210> 3
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
ggctcaatgg ttcatgcctg 20
<210> 4
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
tctagaggca aagttcagca t 21
<210> 5
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
gaattcaaaa gttttttatt a 21
Claims (4)
1. The application of the regulator of the ENST00000415932.1 gene in preparing the medicine for treating liver cancer metastasis is characterized in that the cDNA sequence of the ENST00000415932.1 gene is shown as SEQ ID NO. 1.
2. Use according to claim 1, wherein the modulator is an overexpression plasmid of the ENST00000415932.1 gene.
3. The application of the regulator of the ENST00000415932.1 gene in preparing the liver cancer cell invasion inhibiting medicine is characterized in that the cDNA sequence of the ENST00000415932.1 gene is shown as SEQ ID NO. 1.
4. Use according to claim 3, wherein the modulator is an overexpression plasmid of the ENST00000415932.1 gene.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111245613 | 2021-10-26 | ||
| CN2021112456138 | 2021-10-26 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN114717323A true CN114717323A (en) | 2022-07-08 |
| CN114717323B CN114717323B (en) | 2022-08-09 |
Family
ID=78986699
Family Applications (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202111296653.5A Pending CN113862366A (en) | 2021-10-26 | 2021-11-03 | Biomarker for liver cancer diagnosis and diagnosis kit thereof |
| CN202210632526.6A Active CN114717323B (en) | 2021-10-26 | 2022-06-07 | Application of gene regulator in preparation of liver cancer metastasis drugs |
Family Applications Before (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202111296653.5A Pending CN113862366A (en) | 2021-10-26 | 2021-11-03 | Biomarker for liver cancer diagnosis and diagnosis kit thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (2) | CN113862366A (en) |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103146688A (en) * | 2012-09-12 | 2013-06-12 | 上海长海医院 | Application of long-chain non-coding RNA as blood molecular marker for disease diagnosis |
| US20160083791A1 (en) * | 2014-09-18 | 2016-03-24 | Pathadvantage Associated | System and method for detecting abnormalities in cervical cells |
| CN110724765A (en) * | 2019-10-30 | 2020-01-24 | 元码基因科技（北京）股份有限公司 | Gene containing HPV integration site and application thereof |
| US20210269881A1 (en) * | 2018-09-05 | 2021-09-02 | Amoneta Diagnostics Sas | Long non-coding rnas (lncrnas) for the diagnosis and therapeutics of brain disorders, in particular cognitive disorders |
Family Cites Families (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2018009838A1 (en) * | 2016-07-07 | 2018-01-11 | Rubius Therapeutics, Inc. | Compositions and methods related to therapeutic cell systems expressing exogenous rna |
| CN111286536B (en) * | 2020-04-24 | 2020-10-02 | 山东大学齐鲁医院(青岛) | Gene marker for diagnosing myocardial infarction and application thereof |
| CN113862349A (en) * | 2021-10-26 | 2021-12-31 | 山东师范大学 | Pulmonary fibrosis diagnosis biomarker |
-
2021
- 2021-11-03 CN CN202111296653.5A patent/CN113862366A/en active Pending
-
2022
- 2022-06-07 CN CN202210632526.6A patent/CN114717323B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103146688A (en) * | 2012-09-12 | 2013-06-12 | 上海长海医院 | Application of long-chain non-coding RNA as blood molecular marker for disease diagnosis |
| US20160083791A1 (en) * | 2014-09-18 | 2016-03-24 | Pathadvantage Associated | System and method for detecting abnormalities in cervical cells |
| US20210269881A1 (en) * | 2018-09-05 | 2021-09-02 | Amoneta Diagnostics Sas | Long non-coding rnas (lncrnas) for the diagnosis and therapeutics of brain disorders, in particular cognitive disorders |
| CN110724765A (en) * | 2019-10-30 | 2020-01-24 | 元码基因科技（北京）股份有限公司 | Gene containing HPV integration site and application thereof |
Non-Patent Citations (2)
| Title |
|---|
| SHIBATA E等: "Detection of novel fusion genes by next-generation sequencing-based targeted RNA sequencing analysis in adenoid cystic carcinoma of head and neck", 《ORAL SURG ORAL MED ORAL PATHOL ORAL RADIOL》 * |
| 王娜娜等: "喉鳞状细胞癌的转录组数据分析及生物标志物筛选", 《癌症进展》 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN113862366A (en) | 2021-12-31 |
| CN114717323B (en) | 2022-08-09 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| WO2018024034A1 (en) | Circular rna circ-nfatc3 and application thereof | |
| CN107663539B (en) | Use of circular RNA circ-PTGR1 | |
| CN109295221B (en) | Application of circular RNA as colorectal cancer molecular marker | |
| CN110747163A (en) | Method for improving adipogenic differentiation of human adipose-derived mesenchymal stem cells and special culture medium thereof | |
| CN111254146A (en) | Application of LINC01331 gene inhibitor in preparation of medicine for treating lung cancer | |
| CN110229901A (en) | Gene hsa_circ_0027089 relevant to triple negative breast cancer diagnosis and treatment and its application | |
| CN112795655B (en) | Colorectal cancer diagnosis marker and diagnosis kit thereof | |
| CN112618564B (en) | Inhibitor of hsa _ circ _0001400 and application of inhibitor in preparation of antitumor drugs | |
| CN107557472B (en) | Glioma diagnosis marker circ9:135881633|135883078 and application | |
| CN114717323B (en) | Application of gene regulator in preparation of liver cancer metastasis drugs | |
| CN110229900A (en) | Gene hsa_circ_0103520 relevant to breast cancer diagnosis and treatment and its application | |
| CN113502269B (en) | Method for inhibiting bovine skeletal muscle satellite cell proliferation and myogenic differentiation by interfering UBA2 expression | |
| CN114752670A (en) | Pulmonary fibrosis diagnosis biomarker and application thereof | |
| CN113209312B (en) | Application of reagent for inhibiting expression of transcription factor MEF2C in preparation of medicine for treating keloid | |
| CN114457158B (en) | Application of Hsa_circ_0006867 serving as esophageal cancer molecular target in preparation of medicines and kits | |
| CN114522179B (en) | Application of gene preparation in preparation of colorectal cancer cell proliferation and metastasis inhibitor | |
| CN107753956B (en) | Targeted inhibitor of RAX2 gene and application thereof | |
| CN110257522A (en) | Gene hsa_circ_0045881 relevant to breast cancer diagnosis and treatment and its application | |
| CN113789383B (en) | Biomarker for auxiliary diagnosis of colorectal cancer and detection kit thereof | |
| CN114410589B (en) | Application of ETV4 gene in reprogramming Cheng Zeng-derived scar fibroblast | |
| CN109847054B (en) | Application of TgGRA15 in preparation of medicine for inducing type I interferon | |
| CN114836424B (en) | lncRNA IFFD and application thereof in porcine ovarian granulosa cells | |
| CN109722435A (en) | Pancreas islet long-chain non-coding RNA 1810019D21Rik and its application | |
| CN112280859B (en) | Breast cancer marker and application thereof | |
| CN112301030B (en) | Gene inhibitor for inhibiting Hippo signal pathway and gastric cancer |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |