CN113862349A - Pulmonary fibrosis diagnosis biomarker - Google Patents
Pulmonary fibrosis diagnosis biomarker Download PDFInfo
- Publication number
- CN113862349A CN113862349A CN202111296643.1A CN202111296643A CN113862349A CN 113862349 A CN113862349 A CN 113862349A CN 202111296643 A CN202111296643 A CN 202111296643A CN 113862349 A CN113862349 A CN 113862349A
- Authority
- CN
- China
- Prior art keywords
- pulmonary fibrosis
- lncrna
- seq
- primer
- kit
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Withdrawn
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/178—Oligonucleotides characterized by their use miRNA, siRNA or ncRNA
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Biotechnology (AREA)
- Biomedical Technology (AREA)
- General Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- Microbiology (AREA)
- Physics & Mathematics (AREA)
- Analytical Chemistry (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- General Health & Medical Sciences (AREA)
- Pathology (AREA)
- Immunology (AREA)
- Plant Pathology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a pulmonary fibrosis diagnosis biomarker, and belongs to the technical field of clinical medicine. The pulmonary fibrosis biomarker provided by the invention is LncRNA ENST00000564534.1, pulmonary fibrosis patients and normal people can be effectively distinguished by detecting LncRNA ENST00000564534.1, and pulmonary fibrosis patients and chronic obstructive pulmonary disease patients can be effectively distinguished by detecting LncRNA ENST 00000564534.1.
Description
Technical Field
The invention belongs to the technical field of clinical medicine, and particularly relates to a pulmonary fibrosis diagnosis biomarker.
Background
Idiopathic pulmonary fibrosis is a chronic interstitial disease whose cause and mechanism of pathogenesis are not completely clear. Idiopathic pulmonary fibrosis is one of the most common and severe subtypes of idiopathic interstitial pneumonia, which is not easily diagnosed and develops in a progressive, irreversible fashion. Idiopathic pulmonary fibrosis is occult and its pathogenesis and pathogenesis are clear. In diagnosing the disease, it is difficult to diagnose the disease by combining clinical, pathological and imaging studies of the patient. In addition, there is no effective treatment for idiopathic pulmonary fibrosis, and patients have a poor prognosis and a high mortality rate. Therefore, achieving early detection and early treatment of the disease is of great significance in improving survival rate of patients.
The long-chain non-coding RNA is a non-coding RNA which is longer than 200 nucleotides and has lower protein coding capacity. Studies have shown that the number and type of lncrnas far exceed protein-encoding mrnas, however, the number of lncrnas with defined biological functions is currently very limited. At present, there is increasing evidence that lncRNA plays an important role in a variety of biological processes. Serum markers are a readily available, inexpensive and reproducible marker. The prior art shows that the use of lncRNA as a molecular biomarker is more effective than the conventional specific protein molecular markers.
Disclosure of Invention
The invention aims to provide a diagnosis biomarker capable of assisting in diagnosing pulmonary fibrosis.
The invention improves the following technical scheme implementation:
in a first aspect, the invention provides an application of a reagent for detecting expression of LncRNA ENST00000564534.1 in preparation of a diagnostic kit for idiopathic pulmonary fibrosis.
Preferably, the cDNA sequence of LncRNA ENST00000564534.1 is shown in SEQ ID NO. 1.
Preferably, the reagent is a PCR primer for detecting expression of LncRNA ENST 00000564534.1.
Preferably, the sequences of the PCR primers are shown as SEQ ID NO.2 and SEQ ID NO. 3.
In a second aspect, the present invention provides a diagnostic kit for detecting idiopathic pulmonary fibrosis, wherein the kit comprises a primer component and an amplification component.
Preferably, the primer component is a PCR primer for detecting expression of LncRNA ENST 00000564534.1;
the sequences of the PCR primers are shown as SEQ ID NO.2 and SEQ ID NO. 3.
Preferably, the amplification isThe component is SYBR⑩Premix Ex Taq II, ROX Reference Dye, DNA template and dH2O。
In a third aspect, the invention provides application of primers for amplifying LncRNA ENST00000564534.1 in preparation of a kit for idiopathic pulmonary fibrosis.
Preferably, the cDNA sequence of LncRNA ENST00000564534.1 is shown in SEQ ID NO. 1.
Preferably, the sequence of the primer is shown as SEQ ID NO.2 and SEQ ID NO. 3.
The invention has the beneficial effects that:
the pulmonary fibrosis biomarker provided by the invention can effectively assist in diagnosing patients with pulmonary fibrosis and can effectively distinguish patients with pulmonary fibrosis from patients with chronic obstructive pulmonary disease.
Drawings
Figure 1 expression differences of LncRNA ENST00000564534.1 in normal, pulmonary and chronic obstructive pulmonary disease groups;
FIG. 2 ROC curve using LncRNA ENST00000564534.1 as a marker to distinguish between normal and pulmonary fibrosis groups;
FIG. 3 ROC curve using LncRNA ENST00000564534.1 as a marker for differentiating pulmonary fibrosis group from chronic obstructive pulmonary disease group.
Detailed Description
In order to clearly illustrate the technical features of the present solution, the present solution is explained below by way of specific embodiments.
Example 1
(1) 32 cases of normal human peripheral blood, 32 cases of idiopathic pulmonary fibrosis patients peripheral blood and 15 cases of chronic obstructive pulmonary disease are collected.
(2) Placing the collected blood in a centrifuge, centrifuging at 3000rpm for 15min, and transferring the plasma on the upper layer into a new centrifuge tube;
(3) sucking 250ul of plasma into a centrifuge tube, adding 750ul of RNA extracting solution, uniformly mixing, and standing for 5 min;
(4) after standing, adding 200ul of chloroform, uniformly mixing, standing for 5min, and placing the centrifugal tube in a centrifugal machine for centrifuging at 12000rpm for 15 min;
(5) after the centrifugation is finished, transferring the upper aqueous phase into a new centrifugal tube without RNase, adding isopropanol with the same volume as that of the upper aqueous phase, uniformly mixing, and then standing for 10 min;
(6) placing the centrifugal tube in a centrifugal machine for centrifugation, and after the centrifugation is finished, retaining the precipitate;
(7) adding 70% ethanol prepared from precooled DEPC water, centrifuging, removing supernatant, drying at room temperature for 5-10min, and adding DEPC water to obtain RNA.
Example 2
Detecting differential expression of genes
(1) gDNA removal reaction system configured by reference reverse transcription kit
| Composition of matter | Amount of the composition used |
| 5× |
2 μL |
| TotaL |
2 μg |
| RNase-Free ddH2O | To 10 μL |
The reaction conditions were as follows:
standing at 42 deg.C for 3min on ice;
(2) configuring reverse transcription reaction system by reference reverse transcription kit
| Composition of matter | Amount of the composition used |
| 10×King |
2 μL |
| FastKing |
1 μL |
| FQ-RT Primer |
2 μL |
| Reaction solution in step (1) | 10 μL |
| RNase-Free ddH2O | 5μL |
The reaction conditions were as follows:
standing at 42 deg.C for 15min and 95 deg.C for 3min on ice.
(3) Primers for LncRNA ENST00000564534.1 were designed and synthesized, and the cDNA sequence (SEQ ID NO: 1) of LncRNA ENST00000564534.1 was as follows:
ATATCGCTGCTGTCCCCTACAAGTTATGTGACTCTCTTGCCTGTGCTCTGCCAACATGGGCCATTGTGACATGTTGCTGGGTCCAAAACCTAGGTTCTGCCTGCAGAAGAGATTGTAACATGTTGCTGGGCACCTTGGGCCTGCCCTCAGAAGGCATTATGACATATTCCTGGGTCCAACACCAAGGTGATGTGCGTCTCCTGGCTGGACCCTGCCCACAGTGGGCACTGTGACATATCTCTTGGCCCATCAGATTGTTCATGTTATCCCCTTCCCTTTTTTTCCTGGTGTTTGCCCATGAGAGACATTGTGATGCATTTCTGGACCTAGCACCTAGGTGATATCTTCCTGGGACCTGTCTATATGGGTTATTGTGATACATCATGTACGTGGCCCAGTACTTACTTGATGTGACTCTCCTCTCATGCCTAGACCCTGCTCACAGGTGATGCTACTCTCTACTTATGGCTGGGCCTTGACAAAAAGAGGGATTGGGACATATCCCTGGACGCTGAACCTAAGAGGTGGAGGTTGCCGTGGTGACAGAGTGAGACTTCGCCAAAACAAAACAAAAAAAACAACAACAAAAAAGGCAGGGTTTCACCGTGTTAGTCAGGATGGTCTCAATCTCCTGACCTCGTGATCTGCCCGCCTTGGCCTCCCAAAGTGCTGCAATTACAGGCGTAAGCCATCGCACCTGGCCAGGGGGTACTTTCTGCCCACAAATGAGATTGTGGCATCTAACCCTAAGGTGATGTTACTTCTTTGCTCTGGCTGTGCCCTTAGAAAACACTGAAACATACTGCTGGGTCCAGCACCAAGATTATGTGAGTTTTCTGCCTGAACCCTGACCACAGGAAGCATTGTAACATATCTCTTGACCCATTGCAATTTCTCCTATGGGCAAAGCCCAGGGGGCCTTGTGACATATTTCTGTATCCATCACCCAGGAGATGAAACTGTCTACTTCTGCATTCTGCCCACTCGGAAGATTGTGACAATCATTAGGCCCAGCAACCAGAGCCCACTGGTGAGGTCCTGAATCACACGTGAATGCCGTTCACAGTTGGAATTTTCACTGTCATAAGTGAACATCTGGCCACAGTTGGGATGGTGACTCATTTCTAAACCCAGCTTGTAGGAAGGTGAGGACTCTCCTATCTGGACTCAACCAATTGGAGAGATGTTGACTGTCATATCTGGACGTAGAACCACAGGGAAGACTCTGGATCTCCTTCCTGTATGAAGGTCACAGAGGATCACCATTCTTGCATATTGTATAAAGCCTTCAGGTGACACAGAGAGTGTCATAAGAGAACACAGCACACAGGTGGGCTAGTGACTCTCAGACCAAGATTCAGCACACATGTGAGGCTGTAACTGCACTGAAAGGACAAGTCTGCAGAATAAACTGTGGCTGTCTTGCAAAAATTCTGTCAACCATTGAGACTGTGACTCACACACTTAGATCCAACATCCAAGGCTGGGCGCAGTGGCTCACGCCTGTAATCCCAGCACTTTGAAAGGCCAACGCAGGCGGATCACCGGAGGTCAGGAGTTCAAGACCATCCTGGCCAACATGGTGAAACCCCCATCTCTACTAAAAATACAAAAATTAGCCGCGCGTGGTGGCAGGCACCTGTAATCCCAGCTACTCGGGAGGCTGACACAGGAGAATCGCTTGAACCTGGGAGGCAGAGGTTGCAGTGAGCCGAGATCACACCATTGCATCCCAGCCTGGGGGACAAGAGTGAGACTTCATCTCAAAAAAACAAAAGCAAAAACAAAATAGATAAATAGATCCAACATCCAGGAGGTGTTGACTCTCATACCTAGAA；
the primer sequences of LncRNA ENST00000564534.1 are as follows:
the upstream primer is as follows: CATTAGGCCCAGCAACCAGA, SEQ ID NO. 2;
the downstream primer is: ATCCCAACTGTGGCCAGATG, SEQ ID NO. 2;
(2) preparing fluorescent quantitative PCR reaction solution
| Composition (I) | Volume of |
| SYBR⑩Premix Ex Taq II | 10μl |
| PCR upstream primer | 0.8μl |
| PCR downstream primer | 0.8μl |
| ROX Reference Dye | 0.4μl |
| DNA template | 2μl |
| dH2O | 6μl |
| Total | 20μl |
The PCR reaction conditions were as follows:
pre-denaturation at 95 ℃ for 30s, 5s at 95 ℃ and 30s at 60 ℃ for 40 cycles;
(3) using beta-actin as internal reference, adopting 2-∆∆CtThe method of (4) calculates the relative expression level of the gene.
As shown in fig. 1, the relative expression amount of LncRNA ENST00000564534.1 in the pulmonary fibrosis group was 1.958 ± 0.492, and the relative expression amount of LncRNA ENST00000564534.1 in the chronic obstructive pulmonary disease group was 1.067 ± 0.280, and it can be seen that LncRNA ENST00000564534.1 was highly expressed in the peripheral blood plasma of pulmonary fibrosis patients, but was not significantly highly expressed in the chronic obstructive pulmonary disease group.
The results of the ROC curves of the control group and the pulmonary fibrosis group are shown in fig. 2, the area under the curves is 0.937, the confidence interval is 0.879-0.994, the sensitivity is 0.880, and the specificity is 0.875, and it can be seen that LncRNA ENST00000564534.1 has higher sensitivity and specificity when used for distinguishing normal persons from pulmonary fibrosis patients.
The results of ROC curves for the pulmonary fibrosis group and chronic obstructive pulmonary disease group are shown in fig. 3, with an area under the curve of 0.952, a confidence interval of 0.893-1.000, a sensitivity of 0.933, and a specificity of 0.888, and it can be seen that LncRNA ENST00000564534.1 has a higher sensitivity and specificity when used to distinguish pulmonary fibrosis patients from chronic obstructive pulmonary disease.
The technical features of the present invention which are not described in the above embodiments may be implemented by or using the prior art, and are not described herein again, of course, the above description is not intended to limit the present invention, and the present invention is not limited to the above examples, and variations, modifications, additions or substitutions which may be made by those skilled in the art within the spirit and scope of the present invention should also fall within the protection scope of the present invention.
Sequence listing
<110> university of Shandong Master
<120> a pulmonary fibrosis diagnosis biomarker
<150> 2021112455690
<151> 2021-10-26
<160> 3
<170> SIPOSequenceListing 1.0
<210> 1
<211> 1838
<212> DNA
<213> Human source (Human)
<400> 1
atatcgctgc tgtcccctac aagttatgtg actctcttgc ctgtgctctg ccaacatggg 60
ccattgtgac atgttgctgg gtccaaaacc taggttctgc ctgcagaaga gattgtaaca 120
tgttgctggg caccttgggc ctgccctcag aaggcattat gacatattcc tgggtccaac 180
accaaggtga tgtgcgtctc ctggctggac cctgcccaca gtgggcactg tgacatatct 240
cttggcccat cagattgttc atgttatccc cttccctttt tttcctggtg tttgcccatg 300
agagacattg tgatgcattt ctggacctag cacctaggtg atatcttcct gggacctgtc 360
tatatgggtt attgtgatac atcatgtacg tggcccagta cttacttgat gtgactctcc 420
tctcatgcct agaccctgct cacaggtgat gctactctct acttatggct gggccttgac 480
aaaaagaggg attgggacat atccctggac gctgaaccta agaggtggag gttgccgtgg 540
tgacagagtg agacttcgcc aaaacaaaac aaaaaaaaca acaacaaaaa aggcagggtt 600
tcaccgtgtt agtcaggatg gtctcaatct cctgacctcg tgatctgccc gccttggcct 660
cccaaagtgc tgcaattaca ggcgtaagcc atcgcacctg gccagggggt actttctgcc 720
cacaaatgag attgtggcat ctaaccctaa ggtgatgtta cttctttgct ctggctgtgc 780
ccttagaaaa cactgaaaca tactgctggg tccagcacca agattatgtg agttttctgc 840
ctgaaccctg accacaggaa gcattgtaac atatctcttg acccattgca atttctccta 900
tgggcaaagc ccagggggcc ttgtgacata tttctgtatc catcacccag gagatgaaac 960
tgtctacttc tgcattctgc ccactcggaa gattgtgaca atcattaggc ccagcaacca 1020
gagcccactg gtgaggtcct gaatcacacg tgaatgccgt tcacagttgg aattttcact 1080
gtcataagtg aacatctggc cacagttggg atggtgactc atttctaaac ccagcttgta 1140
ggaaggtgag gactctccta tctggactca accaattgga gagatgttga ctgtcatatc 1200
tggacgtaga accacaggga agactctgga tctccttcct gtatgaaggt cacagaggat 1260
caccattctt gcatattgta taaagccttc aggtgacaca gagagtgtca taagagaaca 1320
cagcacacag gtgggctagt gactctcaga ccaagattca gcacacatgt gaggctgtaa 1380
ctgcactgaa aggacaagtc tgcagaataa actgtggctg tcttgcaaaa attctgtcaa 1440
ccattgagac tgtgactcac acacttagat ccaacatcca aggctgggcg cagtggctca 1500
cgcctgtaat cccagcactt tgaaaggcca acgcaggcgg atcaccggag gtcaggagtt 1560
caagaccatc ctggccaaca tggtgaaacc cccatctcta ctaaaaatac aaaaattagc 1620
cgcgcgtggt ggcaggcacc tgtaatccca gctactcggg aggctgacac aggagaatcg 1680
cttgaacctg ggaggcagag gttgcagtga gccgagatca caccattgca tcccagcctg 1740
ggggacaaga gtgagacttc atctcaaaaa aacaaaagca aaaacaaaat agataaatag 1800
atccaacatc caggaggtgt tgactctcat acctagaa 1838
<210> 2
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
cattaggccc agcaaccaga 20
<210> 3
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
atcccaactg tggccagatg 20
Claims (10)
1. Application of a reagent for detecting expression of LncRNA ENST00000564534.1 in preparation of a diagnostic kit for idiopathic pulmonary fibrosis.
2. The use according to claim 1, wherein the cDNA sequence of LncRNA ENST00000564534.1 is shown in SEQ ID No. 1.
3. The use according to claim 1, wherein the reagents are PCR primers for detecting the expression of LncRNA ENST 00000564534.1.
4. The use according to claim 3, wherein the PCR primers have the sequences shown in SEQ ID No.2 and SEQ ID No. 3.
5. A diagnostic kit for detecting idiopathic pulmonary fibrosis, the kit comprising a primer component and an amplification component.
6. The kit according to claim 5, wherein the primer component is a PCR primer for detecting expression of LncRNA ENST 00000564534.1;
the sequences of the PCR primers are shown as SEQ ID NO.2 and SEQ ID NO. 3.
7. The kit according to claim 5, wherein the amplification component is SYBR⑩Premix Ex Taq II, ROX Reference Dye, DNA template and dH2O。
8. Application of primers for amplifying LncRNA ENST00000564534.1 in preparation of idiopathic pulmonary fibrosis kit.
9. The use according to claim 8, wherein the cDNA sequence of LncRNA ENST00000564534.1 is shown in SEQ ID No. 1.
10. The use of claim 8, wherein the primer has the sequence shown in SEQ ID No.2 and SEQ ID No. 3.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2021112455690 | 2021-10-26 | ||
| CN202111245569 | 2021-10-26 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN113862349A true CN113862349A (en) | 2021-12-31 |
Family
ID=78986694
Family Applications (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202111296643.1A Withdrawn CN113862349A (en) | 2021-10-26 | 2021-11-03 | Pulmonary fibrosis diagnosis biomarker |
| CN202210627473.9A Pending CN114752670A (en) | 2021-10-26 | 2022-06-06 | Pulmonary fibrosis diagnosis biomarker and application thereof |
Family Applications After (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202210627473.9A Pending CN114752670A (en) | 2021-10-26 | 2022-06-06 | Pulmonary fibrosis diagnosis biomarker and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (2) | CN113862349A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113862366A (en) * | 2021-10-26 | 2021-12-31 | 山东师范大学 | Biomarker for liver cancer diagnosis and diagnosis kit thereof |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107663538B (en) * | 2005-04-15 | 2022-03-18 | Epi基因组股份公司 | Methods and nucleic acids for analyzing cell proliferative disorders |
| CN111235275B (en) * | 2020-03-13 | 2020-11-06 | 青岛市中心医院 | Gene marker of lung cancer and application thereof |
-
2021
- 2021-11-03 CN CN202111296643.1A patent/CN113862349A/en not_active Withdrawn
-
2022
- 2022-06-06 CN CN202210627473.9A patent/CN114752670A/en active Pending
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113862366A (en) * | 2021-10-26 | 2021-12-31 | 山东师范大学 | Biomarker for liver cancer diagnosis and diagnosis kit thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN114752670A (en) | 2022-07-15 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN112522392B (en) | Biomarker for diabetes complicated with coronary heart disease | |
| KR102178922B1 (en) | Biomarker microRNA let-7 or microRNA-150 for diagnosing diabetic nephropathy and use thereof | |
| CN109402262B (en) | PCR detection kit for auxiliary diagnosis of neuroblastoma and method for detecting miR-199a-3p expression level | |
| TW202128995A (en) | Compositions, methods and kits for biological sample and rna stabilization | |
| CN113862349A (en) | Pulmonary fibrosis diagnosis biomarker | |
| CN113234810A (en) | Diabetic nephropathy chemotactic factor detection kit and application thereof | |
| CN105441565A (en) | miRNA regarding as osteosarcoma treatment target | |
| JP7436004B2 (en) | Diagnostic aid method and diagnostic kit for depression | |
| CN110373457B (en) | mRNA marker for ulcerative colitis diagnosis and application thereof | |
| CN108410977B (en) | Ultra-early detection kit for serum miRNAs of alcoholic femoral head necrosis patient | |
| WO2020220678A1 (en) | Detection primer set for snp site rs10757278 related to abdominal aortic aneurysm and application thereof | |
| CN107447008B (en) | Enhancer RNA combination for diagnosing recurrent abortion caused by unknown reasons, primer set, application and kit | |
| CN111808961B (en) | Biomarker group for detecting liver cancer and application thereof | |
| CN110295232B (en) | microRNA biomarkers for colorectal cancer | |
| CN108728528B (en) | Fluorescent quantitative PCR one-step kit for detecting specific gene of renal tubular epithelial cell based on Taqman probe | |
| CN108165546A (en) | A kind of miRNA biomarker, composition and application thereof | |
| CN112522391A (en) | Application of hsa _ circ _0008961 as gout diagnosis marker | |
| CN111334579A (en) | Detection primer and probe for plasma EBV miR-BART8-3p and application | |
| CN112266955A (en) | Ankylosing spondylitis diagnosis marker and application thereof | |
| CN110699444A (en) | Serum/plasma miRNA marker related to ankylosing spondylitis and application thereof | |
| US10131956B2 (en) | Marker used for detection of colon cancer, and application thereof | |
| CN109355372B (en) | Application of long-chain non-coding RNA PEV71I-1 in molecular marker for EV71 infection diagnosis | |
| CN115948546B (en) | Exosome miRNA biomarker for breast cancer and application thereof | |
| CN116515995B (en) | Serum microRNA marker for detecting hemophagocytic lymphocytohyperplasia and application thereof | |
| CN112921090B (en) | Application of extracellular vesicle circRNAs as gastric cancer diagnosis marker |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WW01 | Invention patent application withdrawn after publication |
Application publication date: 20211231 |
|
| WW01 | Invention patent application withdrawn after publication |