CN114703228B

CN114703228B - Application of epc1epc2 mutant in construction of environment-susceptible zebra fish model

Info

Publication number: CN114703228B
Application number: CN202210261147.0A
Authority: CN
Inventors: 刘静霞; 刘茜; 刘文叶; 林舒慧
Original assignee: Huazhong Agricultural University
Current assignee: Huazhong Agricultural University
Priority date: 2022-03-16
Filing date: 2022-03-16
Publication date: 2024-03-05
Anticipated expiration: 2042-03-16
Also published as: CN114703228A

Abstract

The invention belongs to the field of molecular biology, in particular to a method for preparing a polypeptideepc1 ^‑/‑ epc2 ^‑/‑ Mutant and application thereof in construction of environment-susceptible zebra fish model, and construction of mutant and application of mutant in construction of environment-susceptible zebra fish modelepc1Andepc2the homozygous mutant zebra fish with single gene deletion is hybridized to obtain the homozygous double mutantepc1 ^‑/‑ epc2 ^‑/‑ Zebra fish. Obtained by the inventionepc1 ^‑/‑ epc2 ^‑/‑ The environment-susceptible mutant zebra fish model can be used for biological indication and monitoring of oxygen content and bacteria in a fishery water environment or a drinking water environment, is applied to real-time early warning of water environment pollution and drinking water pollution, and has the advantages of higher sensitivity, quicker emergency effect and the like.

Description

Application of epc1epc2 mutant in construction of environment-susceptible zebra fish model

Technical Field

The invention belongs to the field of molecular biology, and in particular relates to epc1 ^-/- epc2 ^-/- Mutant and application thereof in construction of environment-susceptible zebra fish model, epc1 constructed by the invention ^-/- epc2 ^-/- The environment-susceptible mutant zebra fish can be used for establishing a water environment monitoring system taking organism death as a monitoring endpoint.

Background

EPC1 (enhancer of polycomb homolog 1) and EPC2 (enhancer of polycomb homolog 2) are important chromatin regulatory factors that are highly conserved from yeast to human (Doyon et al, 2004). EPC family genes are involved in a variety of physiological processes including cell differentiation and development (Prasad et al 2014,Wang et al 2016,Searle et al 2017). In yeast, the deletion of Epl1 (yeast homolog of EPC) leads to the accumulation of cells at G2/M and the global deletion of acetylated histones H4 and H2A, epl1 mutations inhibiting gene silencing by telomere position effects (Boud reault et al 2003). In mammals, most reports on genes of the EPC family have focused on their function in skeletal muscle differentiation (Kim et al 2009,Kee et al 2012). EPC1 is essential for initiating skeletal muscle differentiation in mice and can interact with HOP proteins (Homeodomain Only), serum response factors (serum response factor, SRF) or RET finger proteins (RET finger protein, RFP) to induce expression of the relevant genes (Kee et al 2007,Kim et al 2009). EPC genes also play an important role in tumorigenesis, EPC1 genes are located on human chromosome 10p11, a region where genomic rearrangements are frequent in various human tumors, and the formation of fusion genes (such as EPC1-PHF1, EPC1-ASXL2, etc.) can lead to the generation of a range of tumor-related diseases. EPC1 and EPC2 are also required to maintain the stem cell potential of acute myeloid leukemia (acute myeloid leukemia, AML). In zebra fish, little research is done on epc1 and epc2 genes, and the only literature reported to date is that preliminary screening results published in the university of harvard Zon laboratory at 2013 for function against 425 apparent regulatory factors showed that epc2 gene knockdown affected zebra fish initial erythrocyte development (Huang et al, 2013).

Cox17 (cytochrome c oxidase copper chaperone COX 17) is an important component of cytochrome oxidase, and is involved in the precise structural formation of the mitochondrial cristae, and also acts as an important copper transporter in mitochondria to carry Cu ⁺ Cytochrome oxidase transported to mitochondria, thereby regulating copper metallization of cytochrome oxidase and regulating distribution and content of copper in mitochondria.

In a fishery water environment, the occurrence of fish diseases is closely related to pathogenic bacterial infection in a culture environment, for example, aeromonas hydrophila can enter blood through fish body skin, then enter liver, kidney, spleen and other tissues through blood circulation, infect an immune system, and finally generate systemic bleeding symptoms. In addition, bacterial contamination in drinking water environments also threatens human health. Dissolved Oxygen (DO) in a water body is comprehensively influenced by factors such as partial pressure of Oxygen in air, water temperature, contact area of liquid level and Oxygen in air, day and night change, oxygen consumption sediment, water flow speed, salinity, depth of water, photosynthesis rate of aquatic plants and algae, respiration intensity of aquatic organisms and the like. Moreover, when a large amount of industrial wastewater or domestic sewage enters a water body, serious deoxidation of the water body is caused, so that the dissolved oxygen is generally used as a main index of environment monitoring and self-cleaning capability of the water body. Oxygen is critical to the survival of aerobic organisms, particularly freshwater fish, which are more susceptible to hypoxia stress.

In water environment monitoring, the application of biological monitoring technology is becoming more and more widespread. The biological monitoring is based on the corresponding change of indexes such as physiological and biochemical indexes, protein molecules and the like of each level of organisms in an ecological system after environmental pollution is utilized, and comprehensively reflects the environmental pollution problem, the ecological influence effect and the like. Compared with the traditional single physical and chemical detection, the biological monitoring can show the effect of environmental pollutants through individuals, comprehensively reflect the complex influence of various pollutants, has the advantages of rapidness, broad spectrum, comprehensiveness and the like, can early and timely early warn in water quality pollution such as sudden pollution accidents and the like, and can carry out rapid qualitative analysis on the environmental pollution condition from the perspective of biological response pollutant toxicity. At present, research and application of biological monitoring, indication, diagnosis and technology of water environment have become research hot spots and leading edge fields in the field of environmental evaluation and protection.

The fish starts to be used in a biological monitoring and early warning system in 1929, and the water environment is monitored by using the bearing according to the respiratory change of the fish. The swimming behavior, positive fluidity, selective behavior and the like of the fish are sequentially applied to water environment monitoring. Biological monitoring was applied to the environment as early as the 40 s of the 20 th century in developed countries such as europe and america. Such as french research and development of water quality monitoring systems that utilize fish as a test organism; the biological water quality monitoring system based on video image understanding is developed by BBE company in Germany, and achieves the aim of water quality evaluation through analysis and understanding of biological state change by the principle that behavior and distribution habits of water fleas and fishes are influenced by water quality; the water quality monitoring system based on visual image understanding of fish as a test organism is also being researched and developed by the emerging company in japan. In addition, the European International Commission on ocean exploration (ICES) has used biomarkers as important indicators for the assessment of marine ecological health that indicate heavy metal contamination. European scholars such as france and the united kingdom propose to jointly indicate ocean pollution levels by using synchronous responses of multiple biomarkers, and establish multiple comprehensive indexes for diagnosing sea pollution characteristics on the basis of comprehensive statistical marker response information. The research and system construction of the environmental biological monitoring in China are started later, the biological monitoring technology is gradually introduced in the 80 s of the 20 th century, and the monitoring system needs to be further enhanced and perfected.

Disclosure of Invention

The invention aims to provide epc1 ^-/- epc2 ^-/- The application of the mutant in constructing an environment-susceptible zebra fish model. In order to achieve the above object, the present invention adopts the following measures:

epc1 ^-/- epc2 ^-/- the application of the mutant in constructing an environment-susceptible zebra fish model comprises the step of double knocking out epc1 (gene ID: 566686) and epc2 (gene ID: 394050) genes in zebra fish by utilizing a conventional mode in the field, and the obtained transgenic fish is sensitive to aeromonas hydrophila and/or oxygen stress and can be used for preparing the environment-susceptible zebra fish model.

In the application, it is preferable that the homozygous mutant zebra fish with single gene deletion of epc1 and epc2 is respectively constructed, and then the homozygous mutant zebra fish and the homozygous mutant zebra fish are hybridized to obtain the homozygous double mutant epc1 ^-/- epc2 ^-/- Zebra fish;

in the above application, preferably, the CRISPR/Cas9 gene editing technology adopted for constructing the homozygous mutant zebra fish with single gene deletion is that: 5'-ggtctggcagatcctcgcag-3', epc2gRNA target site is: 5'-gggcgtctagcgctcgcgcg-3'.

Compared with the prior art, the invention has the following advantages:

using epc1 obtained according to the present invention as an important point for environmental detection with respect to death of normal wild-type fish as a monitoring endpoint ^-/- epc2 ^-/- The environment-susceptible mutant zebra fish model can be prepared by adjusting the oxygen content and bacteria in the fishery water environment or the drinking water environmentThe biological indication monitoring is carried out, and the method is applied to real-time early warning of water environment pollution and drinking water pollution, and has the advantages of higher sensitivity, quicker emergency effect and the like. In addition, the sensitivity of the model to other environmental stress factors (environmental pollutants) can be detected, and other environmental susceptibility factors of the model can be screened out and applied to water environment detection.

Drawings

FIG. 1 is a schematic diagram of epc1 and epc2 gene mutation targets;

wherein A is an epc1 gene pattern diagram deleted by 11bp, and B is an epc2 gene pattern diagram deleted by 4 bp.

FIG. 2 shows that different concentrations of Aeromonas hydrophila infest control (wild type), epc1 ^-/- 、epc2 ^-/- And epc1 ^-/- epc2 ^-/- The lethality of the double mutant zebra fish juvenile fish is shown in a schematic diagram;

wherein A-C are each 10 ⁶ CFU/mL、10 ⁷ CFU/mL、10 ⁸ Aeromonas hydrophila at CFU/mL concentration.

FIG. 3 shows the infection of control (wild type) and cox17 by Aeromonas hydrophila at various concentrations ^-/- The lethality of mutant zebra fish juvenile fish is shown in the schematic diagram;

A. b is respectively 10 ⁶ CFU/mL and 10 ⁷ CFU/mL of Aeromonas hydrophila.

FIG. 4 is 2% hypoxia stress control (wild type), epc1 ^-/- 、epc2 ^-/- And epc1 ^-/- epc2 ^-/- Survival rate of double mutant zebra fish juvenile fish is shown in the schematic diagram;

A-C is 72hpf wild-type, epc1 under 2% hypoxia stress and 21% normoxic conditions, respectively ^-/- 、epc2 ^-/- And epc1 ^-/- epc2 ^-/- Survival statistics of young fish within 12 hours after mutant embryo.

Detailed Description

The technical scheme of the invention is a conventional mode in the field unless specifically stated; the reagents or materials used, unless otherwise specified, are commercially available.

Example 1:

obtaining epc1 ^-/- epc2 ^-/- The method for transforming the mutant zebra fish into a gene fish line comprises the following steps:

1.1 Experimental materials

Wild zebra fish (Zebrafish, danio rerio) and mutants were both raised in the aquatic university of china, aquacultural houses under the following conditions: the water temperature is 28.5+/-0.5 ℃, the illumination time and the darkness time are respectively 14h and 10h, and the artemia are fed for 2 times per day.

1.2 Experimental methods

Selection and confirmation of the target sites of the epc1 and epc2 genes of zebra fish:

determining epc1gRNA target sites as: 5'-ggtctggcagatcctcgcag-3'.

Determining epc2gRNA target sites as: 5'-gggcgtctagcgctcgcgcg-3'.

1.2.1 construction of epc1 Using CRISPR/Cas9 Gene editing techniques, respectively ^-/- And epc2 ^-/- Mutant

1.2.1.1 in vitro synthesis of gRNA

PCR amplification was performed with the pMD19-TgRNA (Chang et al, 2013) plasmid as template, with either the upstream primer (epc1_gRNA-F5'gtaatacgactcactataggtctggcagatcctcgcaggttttagagctagaaatagc 3') or (epc2_gRNA-F5'gtaatacgactcactatagggcgtctagcgctcgcgcggttttagagctagaaatagc 3') with the T7 promoter and specific target site sequence, and the downstream universal primer (gRNA-R5'-aaaagcaccgactcggtgcc-3'). The PCR system is as follows:

the reaction conditions are as follows: pre-denatured at 94℃for 3min,30 cycles (denaturation at 94℃for 30s, annealing at 60℃for 30s, extension at 72℃for 10 s), and extension at 72℃for 5min.

Taking 1 mu L of PCR product to carry out agarose gel electrophoresis detection, purifying and recycling through a PCR clean kit;

in vitro transcription was performed using Thermo Transcript Aid T7 High Yield Transcription Kit, the transcription system is as follows:

mixing, centrifuging, sealing, and incubating in a water bath kettle at 37 ℃ for 2 hours; adding 1 mu L DNase, incubating at 37 ℃ for 15min, and removing the DNA template; 1. Mu.L of EDTA was added and incubated at 60℃for 10min to terminate the reaction; adding 30 mu L of DEPC water and 30 mu L of LiCl, uniformly mixing, and precipitating for 4 hours at-80 ℃; centrifuging at 4deg.C for 10min at 14000 g; the supernatant was discarded, 1mL of 70% ethanol was added for washing, and the mixture was centrifuged at 14000g for 10min at 4 ℃; repeating the previous step; after the supernatant is discarded, the mixture is dried at room temperature, 20 mu L of RNase-free water is added for dissolution, 1 mu L of RNA concentration and quality are measured by a NanoDrop 2000 nucleic acid quantitative instrument, the mixture is diluted to 80 ng/mu L, and the mixture is split-packed and placed at-80 ℃ for standby, thus obtaining epc1_gRNA and epc2_gRNA.

1.2.1.2 Synthesis of Cas9 mRNA

Cas9 mRNA was prepared: linearizing the Cas9 plasmid through single digestion of XbaI, taking 1 mu L of enzyme digestion product to carry out agarose gel electrophoresis to confirm complete linearization, and purifying and recovering the linearization product by using a PCR purification kit;

cas9 mRNA was synthesized by in vitro transcription using the MAXIscript T7 Kit of Ambion, the transcription system being as follows:

mixing the above systems, centrifuging, sealing, and incubating in a water bath at 37deg.C for 2 hr; adding 1 mu L DNase, incubating at 37 ℃ for 15min, and removing the DNA template; 1. Mu.L of EDTA was added and incubated at 60℃for 10min to terminate the reaction; adding 30 mu L of DEPC water and 30 mu L of LiCl, uniformly mixing, and precipitating for 4 hours at-80 ℃; 14000g at 4deg.C for 10min; the supernatant was discarded, 1mL of 70% ethanol was added for washing, at 4 ℃,14000g,10min; repeating the previous step; after discarding the supernatant, air-drying at room temperature, adding 20. Mu.L of RNase-free water for dissolution, taking 1. Mu.L of the solution, measuring the concentration and quality of RNA by using a NanoDrop 2000 nucleic acid quantitative measuring instrument, diluting 500 ng/. Mu.L, subpackaging and then placing the solution at-80 ℃ for standby.

1.2.1.3 F ₀ Target point mutation efficiency detection and genetic screening

(1) Uniformly mixing 500 ng/mu L of Cas9 and 80 ng/mu L of gRNA in equal volumes, and microinjection into single-cell-phase zebra fish embryos, wherein at least 200 embryos are injected into each target point, and a part of wild-type embryos in the same batch are reserved as controls for embryo injection;

(2) Taking 20 embryos of injection group and control group respectively, adding 100 mu L of NaOH (50 mM) lysate, cracking for 20min at 95 ℃, adding 10 mu L of Tris-HCl (pH 8.0 50 mM) for balancing, and taking the embryos as a PCR template to be preserved at 4 ℃ for later use;

(3) Using detection primer (epc 1-det-F:5'-tttctcattctccacctcc-3', epc1-det-R:5'-acaaaataaatcccagca-3'; epc2-det-F:5'-tcagagatgcctttaaccgtc-3', epc2-det-R: 5'-gccagtgattcagaagggct-3'), carrying out ordinary PCR amplification using the above product as a template;

(4) Taking 1 mu L of PCR product to carry out agarose gel detection and then sending the PCR product to sequencing;

(5) Identifying an effective target according to a sequencing result, and injecting F corresponding to the effective target in the same batch ₀ Embryo culture to adult fish.

(6) Shearing F ₀ Adding 50 mu L of NaOH (50 mM) lysate into the tail fin of the adult fish, cracking for 20min at 95 ℃, adding 5 mu L of Tris-HCl (50 mM pH 8.0) for balancing, and taking the mixture as a PCR template to be preserved at 4 ℃ for later use;

(7) Using detection primer, using the above-mentioned product as template to make ordinary PCR amplification;

(8) Taking 1 mu L of PCR product to carry out agarose gel detection and then sending the PCR product to sequencing;

(9) Selection of mutant F based on sequencing results ₀ Mating with wild zebra fish, collecting F ₁ Taking 20 embryos, adding 100 mu L of NaOH pyrolysis liquid into the 20 embryos, carrying out pyrolysis for 20min at 95 ℃, adding 10 mu L of Tris-HCl for balancing, carrying out ordinary PCR amplification by taking the products as templates, and carrying out sequencing after electrophoresis detection;

(8) Based on sequencing results, mutation heritable F is selected ₁ (F ₀ Offspring) embryos mated with wild zebra fish and raised to size (at least 60F ₁ Adult fish for screening mutant F ₁ Adult fish).

1.2.1.4F carrying target site mutations ₁ Adult fish screening

(1) Will F ₁ Raising the mixture to be large enough (1-2 months), and cutting tail fins；

(2) Adding NaOH lysate, cracking for 20min at 95 ℃, adding 5 mu LTris-HCl for balancing, and taking the mixture as a PCR template for common PCR amplification;

(3) Sequencing after electrophoresis detection, and screening out F with mutation ₁ Adult fish;

(4) The residual PCR products are purified and recovered by a PCR purification kit, then are connected to a pM18-T carrier for transformation, single colony is selected for colony PCR amplification, and amplified products are sent to a qingke biological company for sequencing;

(5) According to the sequencing result, 1-2 mutants are selected, each mutant ensures that both the male and the female are matched with the male and the female of the same mutation type, and F is obtained ₂ And (3) embryo.

1.2.1.5F carrying target site mutations ₂ Adult fish screening

(2) Will F ₂ Embryo raising to be large enough, and cutting tail fins;

(2) Adding 50 mu L of NaOH lysate, cracking for 20min at 95 ℃, adding 5 mu L of Tris-HCl for balancing, and taking the mixture as a PCR template for common PCR amplification;

(3) Sequencing after electrophoresis detection, and screening out F with mutation ₂ And adult fish can be ensured to be male and female, and can be used for subsequent experiments.

1.2.2epc1 ^-/- epc2 ^-/- Obtaining of double mutants

Epc1 is used ^-/- And epc2 ^-/- Mating the homozygous mutant zebra fish to obtain heterozygous F ₁ epc1 ^+/- epc2 ^+/- F is to F ₁ Is obtained by male and female mating of F ₂ The colony is subjected to DNA electrophoresis detection and DNA sequencing identification by using a screening primer (epc 1-122bp-F4:5'-tgaaaccgctgcccatattc-3', epc1-122bp-R4:5'-at ggtgttccagttcctcgt-3'; epc2-147-F:5'-ccgaatgatccgtgttctgtg-3', epc2-147-R: 5'-gttgatggagacgcagtcgg-3') to obtain the homozygous double mutant epc1 ^-/- epc2 ^-/- 。

By the above experiment, we can obtain epc1 capable of stable inheritance ^-/- epc2 ^-/- Double mutant. Epc1 compared to wild type (epc 1-targetSEQ ID No.1 and epc 2-targetSEQ ID No. 2) ^-/- epc2 ^-/- The target sequences in the double mutants were mutated to the sequences shown in epc 1-variant SEQ ID No.3 and epc 2-variant SEQ ID No.4, respectively, resulting in frame shift mutations. The epc1 gene codes 796 amino acids, 11 base pairs in the 1 st exon are knocked out, and then gene expression is terminated in advance, and only 66 amino acids are coded; the epc2 gene encodes 751 amino acids, and gene expression is terminated in advance after knocking out 4 base pairs in the 1 st exon, and only encodes 10 amino acids (A-B in FIG. 1).

>epc1-target SEQ ID NO.1

ggtctggcagatcctcgcagcgg

>epc2-target SEQ ID NO.2

cggcgtctagcgctcgcgcgcgg

>epc1-mutant SEQ ID NO.3

ggtctgcagcgg

>epc2-mutant SEQ ID NO.4

cggcgtctagcgctcgcgg

Example 2: aeromonas hydrophila stress experiment

(1) Inoculating aeromonas hydrophila with LB medium at the amount of 0.1% v/v, and shaking in a 28 ℃ incubator at 220 r/min;

(2) When the culture is carried out for 8 hours, the concentration of the aeromonas hydrophila liquid reaches a higher level, and the coating flat plate method is used for detecting the concentration of the aeromonas hydrophila at the moment. Diluting Aeromonas hydrophila mother liquor with sterilized deionized water 10 ⁶ Taking 100 mu L of the diluted bacterial liquid, coating LB plates, culturing the three plates in parallel in a 28 ℃ incubator, calculating the number of single bacterial colonies the next day, and taking an average value to obtain the actual concentration of the bacterial liquid;

experimental pathogen Aeromonas hydrophila has an LC50 of 10 for zebra fish ¹⁰ CFU/mL

(3) Diluting aeromonas hydrophila with sterilized deionized water, adjusting the concentration of aeromonas hydrophila, and preparing aeromonas hydrophila liquid with different gradient concentrations. In this experiment, 3 aeromonas hydrophila solutions with different concentration gradients were prepared, the concentrations were respectively: 10 ⁸ CFU/mL、10 ⁷ CFU/mL、10 ⁶ CFU/mL. Collecting the wild type, epc1 obtained in example 1 ^-/- 、epc2 ^-/- 、epc1 ^-/- epc2 ^-/- Double mutant and mutant cox17 ^-/- Zebra fish embryos (Zhang et al 2020), young zebra fish developed to 68hpf were each rib forced into different concentrations of aeromonas hydrophila fluid, 3 replicates per group, 50 replicates per group.

(4) Counting the death rate of the juvenile zebra fish every 12 or 24 hours;

(5) And (5) finishing the death rate of the young zebra fish, and drawing a line graph.

The results show that: epc1 compared to wild type juvenile fish ^-/- 、epc2 ^-/- And epc1 ^-/- epc2 ^-/- Mutant pair 10 ⁶ CFU/mL (A in FIG. 2), 10 ⁷ CFU/mL (B in FIG. 2), 10 ⁸ Different concentrations of CFU/mL (C in FIG. 2) were sensitive to aeromonas hydrophila stress, and epc1 ^-/- epc2 ^-/- Double mutants are more sensitive than single mutants. cox17 ^-/- Mutant pair 10 ⁶ CFU/mL (A in FIG. 3), 10 ⁷ The concentration of CFU/mL (B in FIG. 3) was not sensitive to aeromonas hydrophila stress.

Mortality (%) = (number of deaths per repeat/total number of replicates (50)) × 100% per repeat

Average mortality (%) = (mortality of repetition 1 + mortality of repetition 2 + mortality of repetition 3)/3 for each group

Example 3:

hypoxia stress experiment

(1) Regulating the oxygen concentration of the low-oxygen bin to 2%, the nitrogen concentration to 93%, the carbon dioxide concentration to 5% and the temperature to 28.5 ℃;

(2) Putting a proper amount of zebra fish culture circulating water into a hypoxia chamber in advance for 12 hours, and stirring to ensure that the oxygen content of the circulating water is 2%;

(3) Collection of wild-type, mutant (epc 1) ^-/- 、epc2 ^-/- And epc1 ^-/- epc2 ^-/- ) 72hpf juvenile fish. Each set of 3 replicates of 50 samples each placed at 6Replacing water in the culture dish with water with oxygen content of 2% prepared in the step (2) in a culture dish with 0mm, and then placing the sample in a hypoxia chamber; the same treated fish was used as a control at normal oxygen concentration.

(4) Counting and recording the death number once every two hours;

(5) The statistical data is analyzed and the significance calculated.

Survival per repeat (%) = (number of survival per repeat/total number of replicates (50)) × 100%

Average survival (%) = (survival of repeat 1 + survival of repeat 2 + survival of repeat 3)/3 for each group

The results show that: for young zebra fish of 72hpf, epc2 relative to the 72hpf wild type ^-/- (FIG. 4B) and epc1 ^-/- epc2 ^-/- The hypoxia tolerance of the mutants (C in fig. 4) were significantly down-regulated. And epc1 ^-/- The mutant had no significant change in hypoxia tolerance (a in fig. 4).

Sequence listing

<110> university of agriculture in China

<120> application of epc1epc2 mutant in construction of environment-susceptible zebra fish model

<160> 17

<170> SIPOSequenceListing 1.0

<210> 1

<211> 23

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 1

ggtctggcag atcctcgcag cgg 23

<210> 2

<211> 23

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 2

cggcgtctag cgctcgcgcg cgg 23

<210> 3

<211> 12

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 3

ggtctgcagc gg 12

<210> 4

<211> 19

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 4

cggcgtctag cgctcgcgg 19

<210> 5

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 5

ggtctggcag atcctcgcag 20

<210> 6

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 6

gggcgtctag cgctcgcgcg 20

<210> 7

<211> 58

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 7

gtaatacgac tcactatagg tctggcagat cctcgcaggt tttagagcta gaaatagc 58

<210> 8

<211> 58

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 8

gtaatacgac tcactatagg gcgtctagcg ctcgcgcggt tttagagcta gaaatagc 58

<210> 9

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 9

aaaagcaccg actcggtgcc 20

<210> 10

<211> 19

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 10

tttctcattc tccacctcc 19

<210> 11

<211> 18

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 11

acaaaataaa tcccagca 18

<210> 12

<211> 21

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 12

tcagagatgc ctttaaccgt c 21

<210> 13

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 13

gccagtgatt cagaagggct 20

<210> 14

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 14

tgaaaccgct gcccatattc 20

<210> 15

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 15

atggtgttcc agttcctcgt 20

<210> 16

<211> 21

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 16

ccgaatgatc cgtgttctgt g 21

<210> 17

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 17

gttgatggag acgcagtcgg 20

Claims

1.epc1 ^-/- epc2 ^-/- Application of mutant zebra fish in construction of environment-susceptible zebra fish modelepc1 ^-/- epc2 ^-/- Mutant zebra fish is double-deleted in wild zebra fishepc1Andepc2the application process of the homozygote transgenic fish of the gene is respectively constructedepc1Andepc2the homozygous mutant zebra fish with single gene deletion is hybridized to obtain the homozygous double mutantepc1 ^-/- epc2 ^-/- Zebra fish; CRISPR/Cas9 gene editing technology adopted by constructing single-gene deletion homozygous mutant zebra fish,epc1the gRNA target sites were: 5'-ggtctggcagatcctcgcag-3' the number of the individual pieces of the plastic, epc2the gRNA target sites were: 5'-gggcgtctagcgctcgcgcg-3';

the said processepc1The gene ID of the gene is 566686,epc2gene ID of the gene 394050;

the environmental susceptibility is aeromonas hydrophila susceptibility or/and hypoxia stress susceptibility.