CN114703125B

CN114703125B - Method for obtaining exosomes, preparation and application of exosomes in preparation of anti-aging and skin repairing products

Info

Publication number: CN114703125B
Application number: CN202210398089.6A
Authority: CN
Inventors: 王建华; 王慧敏; 王智亮; 温泉
Original assignee: Zhuhai Yimei Enterprise Management Co ltd
Current assignee: Zhuhai Yimei Enterprise Management Co ltd
Priority date: 2022-04-13
Filing date: 2022-04-13
Publication date: 2023-07-04
Anticipated expiration: 2042-04-13
Also published as: CN116515741A; CN114703125A

Abstract

The application discloses a method for obtaining exosomes, a preparation and application of the preparation in preparation of anti-aging skin repair products. According to the method, in-vitro culture is carried out by utilizing endometrial stem cells, and a special secretion medium and a loading medium are used in the secretion culture process, so that the secreted exosomes can express special RNA and simultaneously load hyaluronic acid. The animal experiments prove that the exosome has an effect of repairing the damage to the photo-aged skin of the mice, so that the exosome has a wide application prospect of applying anti-aging and skin repairing related products.

Description

Method for obtaining exosomes, preparation and application of exosomes in preparation of anti-aging and skin repairing products

Technical Field

The application relates to the technical field of exosomes, in particular to a method for obtaining exosomes, a preparation and application of the preparation in preparation of anti-aging skin repair products.

Background

Exosomes (exosomes) are endogenous extracellular vesicles (extracellular vesicles, EVs) released by cells, having a phospholipid bilayer containing cytosol, about 30150nm in size, containing various bioactive molecules such as proteins (membrane proteins and soluble proteins), carbohydrates, lipids, RNAs (mRNA, miRNA,1ncRNA, etc.), DNA, etc. These bioactive molecules are not only present in exosomes, but also can be secreted outside cells and accepted by recipient cells via secretory cells, and can transport the bioactive molecules carried by the exosomes into the recipient cells, so that intercellular substance transfer can be performed, communication between cells is promoted, and development prospects are provided for development of such exosomes in the fields of drug delivery and the like.

Disclosure of Invention

In view of the above, it is an object of the present application to provide an exosome capable of metastatic delivery with anti-aging and skin repair.

In a first aspect, the present application discloses a method for obtaining exosomes, comprising:

performing fusion culture, namely performing subculture when EnSCs are cultured to 80% -90% of fusion degree;

culturing EnSCs in the 2 nd generation after digestion treatment passage to obtain cells to be secreted with rounded and wrinkled morphology;

performing secretion culture, namely transferring the cells to be secreted to perform liquid exchange culture, wherein the liquid exchange culture is a secretion culture medium, so as to obtain a first culture solution;

and carrying out loading culture, continuously carrying out liquid exchange culture on the first culture solution, wherein the exchanged solution is a loading culture medium, so that a second culture solution secreted with exosomes can be obtained, and the exosomes can be obtained after purification.

In the examples herein, the cell seeding concentration of the fusion culture was 1X 106/mL.

In an embodiment of the present application, the components of the digestion process specifically include:

performing primary digestion treatment on the passaged 2 nd generation EnSCs culture solution by using pancreatin solution containing 0.01% EDTA, and cleaning;

performing second digestion treatment on the cells subjected to the first digestion treatment and the cleaning by using a pancreatin solution of 0.01% EDTA again to obtain cells to be secreted, wherein the cells have rounded and wrinkled forms;

wherein, the volume of pancreatin solution containing 0.01% EDTA added in the first digestion treatment is 0.5% of the culture solution, and the treatment time is 20min; the pancreatin solution containing 0.01% EDTA added in the second digestion treatment is 6.25% of the culture solution, and the treatment time is 60min.

In the examples of the present application, the secretion medium is DMEM/F12 medium containing 20-65 ng/mL TGF-alpha and 2-7.2 ng/mL HC.

In the embodiment of the application, the secretion medium is a DMEM/F12 medium containing 15-55 ng/mL of TGF-beta, 0.6-4.8 ng/mL of EGF and 2-7.2 ng/mL of HC.

In the embodiment of the application, the loading culture medium is a DMEM/F12 culture medium containing 0.2-1.7 mg/mL HA.

In this embodiment of the present application, the separation process of the exosome specifically includes:

filtering the second culture solution by 0.22 mu m, taking filtrate, and sequentially centrifuging for 10min by 300 g; centrifuging for 10min at 3000 g; centrifuging 10000g for 30min to obtain primary extract with cells and fragments removed;

treating the primary extract with an exosome extraction kit to obtain a refined extract;

and sequentially carrying out 5000g centrifugation for 30 minutes, 10000g centrifugation for 30 minutes and 30000g centrifugation for 30 minutes on the refined extract, and obtaining a precipitate which is the final exosome.

In a second aspect, the present application discloses a formulation comprising an exosome obtained by the method of obtaining of the first aspect.

In a third aspect, the present application discloses the use of exosomes obtained by the method of obtaining as described in the first aspect for the preparation of anti-aging, skin repair products.

Compared with the prior art, the application has the following beneficial effects:

according to the embodiment of the application, the endometrium stem cells are used for in-vitro culture, the exosomes secreted by the endometrium stem cells are obtained, and a special secretion culture medium and a loading culture medium are used in the secretion culture process of the stem cells, so that the exosomes secreted by the endometrium stem cells not only can express special RNA, but also are loaded with hyaluronic acid. The animal experiments prove that the exosome has an effect of repairing the damage to the photo-aged skin of the mice, so that the exosome has a wide application prospect of applying anti-aging and skin repairing related products.

Drawings

FIG. 1 is a microscopic view (200 nm) of the exosomes provided in example 1 of the present application.

FIG. 2 is a microscopic view (200 nm) of the exosomes provided in example 2 of the present application.

FIG. 3 is a microscopic view (200 nm) of the exosomes provided in example 3 of the present application.

FIG. 4 is a microscopic view (100 nm) of the exosomes provided in example 4 of the present application.

FIG. 5 is a microscopic view (100 nm) of the exosomes provided in example 5 of the present application.

FIG. 6 is a microscopic view (100 nm) of the exosomes provided in example 6 of the present application.

FIG. 7 is a microscopic view (200 nm) of the exosomes provided in example 7 of the present application.

FIG. 8 is a microscopic view (200 nm) of the exosomes provided in example 8 of the present application.

FIG. 9 is a microscopic view (200 nm) of the exosomes provided in comparative example 2 of the present application.

FIG. 10 is a microscopic view (200 nm) of the exosomes provided in comparative example 3 of the present application.

FIG. 11 is a microscopic view (200 nm) of the exosomes provided in comparative example 4 of the present application.

FIG. 12 is a microscopic view (200 nm) of the exosomes provided in comparative example 5 of the present application.

FIG. 13 is a microscopic view (200 nm) of the exosomes provided in comparative example 6 of the present application.

Detailed Description

In order to make the objects, technical solutions and advantages of the present application more apparent, the present application will be further described in detail with reference to examples. It should be understood that the specific embodiments described herein are for purposes of illustration only and are not intended to limit the present application. Reagents and equipment referred to below may be obtained commercially, unless otherwise specified, and methods are routine experimentation.

Isolation and identification of exosomes

1. Experimental materials and methods

1.1 cell line Source

The examples herein used endometrial stem cells (EnSCs) from Shenzhen Quanmei Gene as a source of cell lines for the isolation of exosomes.

1.2 secretion process of exosomes

The implementation process of the specific embodiment 1 is as follows:

1) Fusion culture

EnSCs were used at 1X 10 ⁶ A25 cm portion of complete medium (HyClone, USA) containing 16mL of DMEM/F12 was inoculated at a concentration of/mL ² T75 cell flask (Siemens) at 37℃in 5% CO ₂ Under the condition of CO ₂ Culturing in an incubator, replacing a cell culture medium every 24 hours, observing cell morphology under an inverted microscope (NIB-100, nanjing Jiangnan Yongxin optical Co., ltd.), and subculturing when the cells grow to 80% -90% fusion degree;

2) Digestion treatment

Under aseptic condition, adding 0.08mL pancreatin solution (Beijing Soy Bao technology Co., ltd.) containing 0.01% EDTA into EnSCs culture solution of 2 nd generation culture to make first digestion treatment, transferring to CO ₂ 5% CO in incubator ₂ After digestion for 20min with 2mL PBS buffer 3 times;

next, l mL of pancreatin solution (volume ratio: about 6.25% of the culture solution) containing 0.01% EDTA was added to the flask again to conduct the second digestion treatment, and CO was converted ₂ 5% CO in incubator ₂ Digesting for 60min under the condition, observing the cells under an inverted microscope, and beating the side wall of the culture flask to enable the cells to fall off when the cells start shrinking and rounding;

adding a DMEM/F12 culture medium containing 10% FBS with the volume of 2 times of the digested solution to terminate digestion, blowing a mixed cell suspension by a sterile pipette, transferring to a 15ml centrifuge tube, centrifuging at 1000r/min for 5min, and discarding the supernatant to obtain a precipitate, namely the cells to be secreted;

3) Secretory culture

The pellet of cells to be secreted was suspended in 15mL of 10% FBS in DMEM/F12 medium and placed at 25cm ² T75 cell culture flask, transfer to CO ₂ In incubator, the flask was wiped with alcohol and then placed at 37℃with 5% CO ₂ Culturing for 4 days continuously, wherein liquid is changed every 24 hours in the culturing process, and the liquid volume is not less than 10mL, so as to obtain a first culture solution;

the solution was replaced with a secretion medium which was DMEM/F12 medium containing 50ng/mL transforming growth factor-alpha (TGF-alpha, sigma-Aldrich), 5ng/mL cortisol (Hydrocritin, HC, hubei Widli chemical technologies Co.).

4) Load culture

And (3) continuously changing the liquid for culturing for 3 days, changing the liquid every 24 hours, and continuously culturing for 3 days, wherein the liquid volume of the liquid is not less than 10mL, so as to obtain a second culture liquid, and further carrying out the subsequent steps.

The culture medium was replaced with a DMEM/F12 medium containing 0.5mg/mL sodium hyaluronate (abbreviated as HA, molecular weight about 3000, jinan Lu Xin chemical technology Co., ltd.).

The exosome secretion of example 2 was performed as follows:

steps 1) to 2) are the same as in example 1, and in steps 3) to 4), the secretion medium is DMEM/F12 medium containing 20ng/mL TGF-alpha and 2ng/mL HC; the loading medium is DMEM/F12 medium containing 0.5mg/mL HA.

The exosome secretion of example 3 was performed as follows:

steps 1) to 2) were performed in the same manner as in example 1, and in steps 3) to 4), the secretion medium was DMEM/F12 medium containing 65ng/mL TGF-. Alpha.and 7.2ng/mL HC; the loading medium is DMEM/F12 medium containing 0.5mg/mL HA.

The exosome secretion of example 4 was performed as follows:

steps 1) to 2) were performed in the same manner as in example 1, and in steps 3) to 4), the secretion medium was a DMEM/F12 medium containing 35ng/mL of transforming growth factor-beta (TGF-. Beta., sigma-Aldrich), 3ng/mL of epidermal growth factor (EGF, sigma-Aldrich for short), and 5ng/mL of HC; the loading medium is DMEM/F12 medium containing 0.5mg/mL HA.

The exosome secretion of example 5 was performed as follows:

steps 1) to 2) were performed in the same manner as in example 1, and the secretion medium in steps 3) to 4) was a DMEM/F12 medium containing 15.0ng/mLTGF- β, 0.6ng/mL EGF, and 2.0ng/mL HC. The loading medium is DMEM/F12 medium containing 0.5mg/mL HA.

The exosome secretion of example 6 was performed as follows:

steps 1) to 2) were performed in the same manner as in example 1, and the secretion medium in steps 3) to 4) was DMEM/F12 medium containing 55.0 ng/mLTGF-beta, 4.8ng/mL EGF, and 7.2ng/mL HC. The loading medium is DMEM/F12 medium containing 0.5mg/mL HA.

The exosome secretion of example 7 was performed as follows:

steps 1) to 2) are the same as in example 1, and in steps 3) to 4), the secretion medium is DMEM/F12 medium containing 50ng/mL TGF-alpha and 5ng/mL HC; the loading medium is DMEM/F12 medium containing 0.2mg/mL HA.

The exosome secretion of example 8 was performed as follows:

steps 1) to 2) are the same as in example 1, and in steps 3) to 4), the secretion medium is DMEM/F12 medium containing 50ng/mL TGF-alpha and 5ng/mL HC; the loading medium was DMEM/F12 medium containing 1.7mg/mL HA.

The exosome secretion of comparative example 1 was performed as follows:

adipose-derived mesenchymal stem cells (ADSCs) were selected as cell line secretion exosomes, purchased from Gibco, and used in the same culture as in example 1.

The exosome secretion of comparative example 2 was performed as follows:

still using EnSCs as cell line secretion exosomes, implementing steps 1) to 2) as in example 1, wherein in steps 3) to 4), the secretion medium is DMEM/F12 medium of 10% FBS; the loading medium was DMEM/F12 medium containing 0.5mg/mL HA.

The exosome secretion of comparative example 3 was performed as follows:

still using EnSCs as cell line secretion exosomes, implementing steps 1) to 2) as in example 1, wherein in steps 3) to 4), the secretion medium is 50ng/mL of DMEM/F12 medium of TGF-alpha; the loading medium was DMEM/F12 medium containing 0.5mg/mL HA.

The exosome secretion of comparative example 4 was performed as follows:

still using EnSCs as cell line secretion exosomes, implementing steps 1) to 2) as in example 1, wherein in steps 3) to 4), the secretion medium is DMEM/F12 medium containing 5ng/mL HC; the loading medium was DMEM/F12 medium containing 0.5mg/mL HA.

The exosome secretion of comparative example 5 was performed as follows:

EnSCs are still used as exosomes secreted by the cell line, and the implementation steps 1) to 2) are the same as that of the example 1, and in the steps 3) to 4), the secretion medium is DMEM/F12 medium containing 35ng/mL TGF-beta and 3ng/mL EGF; the loading medium was DMEM/F12 medium containing 0.5mg/mL HA.

The exosome secretion of comparative example 6 was performed as follows:

still using EnSCs as cell line secretion exosomes, implementing steps 1) to 2) as in example 1, wherein in steps 3) to 4), the secretion medium is 50ng/mL TGF-alpha, 5ng/mL HC DMEM/F12 medium; the loading medium was DMEM/F12 medium containing 10% FBS.

1.3 separation of exosomes

The implementation procedure of example 1 is:

(1) Filtering the cell culture solution obtained by the culture with a 0.22 mu m filter, placing the filtrate into a centrifuge tube, and transferring the centrifuge tube into a desk-top ultra-high speed centrifuge for gradient centrifugation: centrifuging for 10min at 300 g; centrifuging for 10min at 3000 g; centrifuge 10000g for 30min to remove cells and cell debris.

(2) The centrifuged supernatant was transferred to another clean sterile centrifuge tube, exoquick-TC extract (SBI Co., USA) added in 1/10 of the supernatant volume, mixed well, and the mixture was frozen overnight (at least 12 hours) at 4℃and kept upright during incubation to avoid re-mixing by pouring.

(3) Transferring the test tube into a centrifuge, sequentially centrifuging at 5000g for 30min, 10000g for 30min and 30000g for 30min at 4deg.C, removing supernatant in each centrifugation, and performing next operation to obtain the precipitate which is purified exosome, and re-suspending the precipitate with sterile PBS buffer solution.

Examples 2 to 8 and comparative examples 1 to 6 were carried out in the same manner as in example 1.

1.4 analysis of exosomes

(1) Exosome particle size distribution

The obtained exosome particle size distribution was analyzed by dynamic light scattering, and the PBS buffer was filtered using a 0.1 μm microporous filter to reduce the possible particle background interference in the solution, for dilution of the concentrated exosome samples. After the exosome sample is subjected to gradient dilution, the exosome sample is tested by a Markov nanometer granularity analysis instrument, and no bubbles are ensured on the surface of the solution during the test.

The particle size was measured using a Markov nanoparticle analyzer (Nano ZS90, markov instruments Co.) at 25℃with PBS as solvent, 1.400 refractive index of the material, 0.001 absorption coefficient of the material, and back light scattering at 173 ℃. When the particle size distribution is stable and similar when the sample is close to the concentration gradient, the sample concentration is suitable for detection. The samples were tested 5 times in parallel and the data were processed through Zetasizer software and averaged.

(2) Scanning electron microscope observation

Mixing the exosome sample suspension with 5% glutaraldehyde in a volume ratio of 1:1, standing at 4deg.C for 30min to fix particle morphology, dripping onto single polished silicon wafer, and gradient dehydrating the sample with 50%, 60%, 70%, 80%, 90% methanol to remove water and salt, and preserving at 4deg.C until detection by scanning electron microscope.

(3) Identification of exosome protein markers by WesternBlot

Adding RIPA lysate (10% of the volume of the exosome suspension) into the exosome suspension at 4deg.C, and treating for 30min to completely lyse exosome; centrifuging at 12000rpm for 10min at 4deg.C, discarding the precipitate, retaining supernatant, and measuring total protein content by using BCA protein concentration kit (Abcam China).

After the quantification of the protein concentration is completed, the protein is diluted with a loading buffer solution of 5 xSDS to make the final concentration of the protein be 1 mug/mu L, finally, the protein is denatured by water bath for 5min at 95 ℃, the protein is taken as a loading solution of SDS-PAGE, the SDS-PAGE electrophoresis is carried out, the loading volume of each hole is 15 mu L, and the electrophoresis is carried out for 2.5h under the conditions of room temperature and 100mV voltage, so that markers) are separated from each other;

then placing the gel in a transfer buffer solution, oscillating for 10min by a shaking table, and transferring the gel overnight at 4 ℃ and voltage of 30mV by adopting a PVDF membrane activated by methanol for 30 s;

after the film transfer process is finished, transferring the film after the film transfer is washed for 1 time by using TBST buffer solution into TBST buffer solution containing 5% skimmed milk powder, and vibrating for 1h on a shaking table at room temperature to seal the film; then adding a primary antibody for incubation, and shaking overnight at 4 ℃; after the primary antibody incubation is completed, placing the membrane in a TBST buffer solution, shaking and eluting for 3 times, each time for 10min, then incubating the secondary antibody in a dark place, and shaking and incubating for 1h at room temperature; after the secondary antibody incubation is completed, the membrane is placed in a TBST buffer solution for shaking and eluting for 3 times, each time for 10min, and then developed by ECL luminescent developing solution, imaged by adopting an F1 ultraviolet chem HD2 system, and the grey scale of the strip is quantified by imageJ.

The primary antibodies added after the above-mentioned counter-rotating membrane closure were respectively CD90 (EPR 2949), CD63 (EPR 21151), calnexin (EPR 21205) and GADPH (EPR 16891), all purchased from Abcam company, and the secondary antibodies added were HRP-conjugated secondary antibodies, purchased from Abcam company, to perform parallel experiments, respectively, to detect the content of exosomes CD90, CD63 and Calnexin.

1.5, expression detection of miR-21-5 p:

after the cell culture and exosome secretion steps are completed, i.e., after step 8) above, the expression level of miR-21-5p in the cells and exosomes is detected by fluorescent quantitative PCR.

(1) Sample fluid preparation

First sample for test: adding RIPA lysate (10% of the volume of the exosome suspension) into the exosome suspension at 4deg.C, and treating for 30min to completely lyse exosome; centrifuging at 12000rpm for 10min at 4deg.C, discarding the precipitate, and retaining the supernatant to obtain a first sample for detecting miR-21-5p expression in exosomes.

Second sample for test: filtering the cell culture solution obtained by the culture with a 0.22 μm filter, taking filter residues, suspending with RIPA lysate, processing for 30min, centrifuging at 12000rpm for 10min at 4deg.C, discarding the precipitate, and retaining the supernatant as a second sample to be tested for detecting miR-21-5p expression in cells.

(2) The total RNA in the first and second samples was extracted by using a total RNA extraction Reagent TRIzon Reagent (available from century Corp.) respectively, according to a fluorescent quantitative PCR kit All-in-OneTM miRNA qPCR Synthesis Kit (available from GeneCopoeia Corp.) for fluorescent quantitative PCR detection.

(3) cDNA was synthesized by reverse transcription using a reverse transcription kit All-in-OneTM miRNA First-Strand cDNA Synthesis Kit (product No. QP014: available from GeneCopoeia Co.), and cDNA was synthesized by adding polyA tail to an extracted 5. Mu.L RNA solution at 42℃for 60min to 95℃for 3min and reverse transcription.

(4) The cDNA product was diluted 10-fold, 2. Mu.L of the template, 2. Mu.L of the primer, all-in-OneTM miRNA qPCR Mix. Mu.L, universal Adaptor PCR Primer. Mu.L, ROX Reference Dye 0.1.1. Mu.L of double distilled water was used to prepare a fluorescent quantitative PCR reaction system having a total volume of 20. Mu.L, and fluorescent quantitative PCR reaction was performed under conditions of starting denaturation (1 cycle) at 95℃for 15min, denaturation at 94℃for 20s, annealing at 65℃for 30s, pre-amplification (5 cycles) at 72℃for 34s, denaturation at 94℃for 20s, amplification at 61℃for 34s, and acquisition of fluorescent signals (40 cycles) according to the three-step method. The miR-21-5p primer sequence is as follows: CCGCGCGTAGCTTATCAGACTGATGTTGA; the sequence of the U6 primer is GCTTCGGCACTTATACTAAAAT; are all provided by Shanghai workers.

(5) miR-21-5p expression level adopts 2 ^-ΔΔCt The relative quantitative analysis was performed by the method in which the internal gene U6 was used as a reference gene, ct was used as a cycle threshold, each sample was repeated 5 times, and the average value was taken for statistical analysis.

1.6, determination of hyaluronic acid content

After the cell culture and exosome secretion steps are completed, i.e., after step 8), the content of hyaluronic acid in the exosomes and in the cell suspension, which is the filtrate obtained by filtration with a 0.22 μm filter in the exosome separation step, is detected by HPLC.

(1) Detection was performed by HPLC, chromatographic conditions were: MCI GEL CK08EH column (8 mm. Times.300 mm,5 μm, mitsubishi liquid phase); mobile phase: 1% phosphoric acid; flow rate: 0.6mL/min; sample injection amount: 20. Mu.L; column temperature: 40 ℃; detection wavelength: 232nm.

(2) Standard sample: precisely weighing about 5mg of sodium hyaluronate standard substance in a 50mL volumetric flask, adding 10mL of enzymolysis buffer solution (weighing 5mmol/L sodium dihydrogen phosphate and 5mmol/L disodium hydrogen phosphate, and pH 6.0), fully dissolving, fixing volume to scale, and mixing; taking 0.2mL of the solution, adding 0.5mL of hyaluronidase, uniformly mixing, sealing, performing enzymolysis for 2h at 42 ℃, boiling for 2min to inactivate the enzyme; transferring the solution into a 10mL volumetric flask, fixing the volume to a scale with a buffer solution, and filtering with a 0.22 μm filter membrane to obtain a control solution.

(3) Sample for sample

Third sample supply: taking the cell suspension (about 5 mL), centrifuging at 3000g for 10min; centrifuging 10000g for 30min, collecting supernatant 0.2mL, adding hyaluronidase 0.4mL, mixing, sealing, performing enzymolysis at 42deg.C for 2h, and boiling for 2min to inactivate enzyme; transferring the solution into a 10mL volumetric flask, fixing the volume of the mobile phase to a scale, and filtering with a 0.22 μm filter membrane to obtain a third sample.

Fourth sample supply: taking the exosomes obtained by separation, adding 10mL of RIPA lysate into the suspension of the exosomes at the temperature of 4 ℃ for 30min to fully lyse the exosomes; adding 0.5mL of hyaluronidase, mixing, sealing, performing enzymolysis at 42 ℃ for 2h, and boiling for 2min to inactivate enzyme; centrifuging at 12000rpm for 10min at 4deg.C, discarding the precipitate, and retaining the supernatant; transferring the solution into a 10mL volumetric flask, fixing the volume of the mobile phase to a scale, and filtering with a 0.22 μm filter membrane to obtain a fourth sample.

(4) Detecting a standard sample according to the chromatographic conditions to obtain the characteristic peak areas in the chromatograms, preparing a standard curve and a standard equation, detecting the sample to be tested to obtain the corresponding characteristic peak areas, substituting the characteristic peak areas into the standard equation, and calculating to obtain the sodium hyaluronate content in the third sample to be tested and the fourth sample to be tested. Wherein, the content of hyaluronic acid in the cell suspension is equal to 50 multiplied by 10/0.6 of the corresponding HA content (mg/mL) measured by the third sample; the content of hyaluronic acid in exosomes is: HA loading in exosomes = HA content in fourth test sample (μg/mL) x fourth test sample volume (20 mL)/exosome mass (μg), exosome mass is the mass of precipitate resulting from the exosome separation step.

1.7 data analysis

The experimental data are subjected to data analysis by Excel 2013 and SPSS 22.0 statistical software for statistical arrangement, each data is measured for a plurality of times and represented by an average value and a standard deviation thereof, and single-factor analysis of variance (One-way ANOVA) and DunCan's multiple comparison are respectively carried out by SPSS 22.0, and a significant difference mark is carried out.

2. Results

TABLE 1 expression level relative to GADPH

Description of the embodiments	CD90	CD63	Calnexin
				Example 1	167.2±1.3％a	152.4±12.7％a	15.7±0.6％d
Example 2	143.1±5.2％ab	148.3±8.6％a	16.2±1.4％d
				Example 3	171.2±2.4％a	147.8±7.2％a	21.3±2.1％d
Example 4	175.5±6.7％a	162.8±7.5％a	14.2±0.4％d
				Example 5	161.7±3.8％a	150.2±6.2％a	10.3±1.4％d
Example 6	168.5±2.1％a	154.3±4.2％a	13.4±2.1％d
				Example 7	164.2±3.1％a	150.7±2.8％a	8.2±1.3％de
Example 8	166.0±0.9％a	151.3±4.2％a	5.8±0.2％de
				Comparative example 1	2.7±0.3％d	12.7±2.1％d	94.2±3.7％a
Comparative example 2	32.4±5.7％c	43.2±4.1％c	76.2±5.8％b
				Comparative example 3	88.8±4.1％cd	77.7±6.2％c	64.2±7.2％b
Comparative example 4	92.1±3.2％c	85.1±1.3％b	43.1±5.2％c
				Comparative example 5	81.4±2.6％c	99.3±7.3％c	62.8±4.8％b
Comparative example 6	158.8±4.3％a	153.1±4.4％a	13.6±3.1％d

As is clear from Table 1, the relative expression amounts of CD90 and CD63 in the sample solutions prepared in examples 1 to 8 and comparative example 6 were all over 100%, positive expression, while the relative expression amount of Calnexin was less than 100%, negative expression, and it was confirmed that the cells actually secreted exosomes after the culture by the above cell line culture process according to the "minimum identification criteria" published by International extracellular vesicle society (International Society for Extracellular Vesicles ISEV) in 2014. The relative expression levels of CD90, CD63 and Calnexin in the sample solutions prepared in comparative examples 1 to 5 were not more than 100%, and it could not be confirmed that these examples secreted exosomes after cell culture or that the content of exosomes secreted was low. However, by microscopic observation of the precipitate obtained by the procedure of the above examples and comparative examples, as shown in the figure, the secretory body was obtained in each of examples 1 to 8 and comparative examples 2 to 6, whereas no apparent secretory body was found in comparative example 1.

In combination with the above step analysis of the exosome secretion process, it was found that in the exosome secretion process, the use of endometrial stem cells as secretion cells is advantageous for obtaining a high concentration of exosomes, and the addition of appropriate concentrations of TGF- α, TGF- β, EGF and HC in the secretion step 6) thereof has a significant effect on the secretion amount of exosomes.

TABLE 2

The miR-21-5p expression levels corresponding to examples 1-8 and comparative examples 1-6 are shown in Table 2. As can be seen from Table 2, the expression level of miR-21-5p in the cells corresponding to examples 1-8 and comparative example 6 is significantly lower than that in comparative examples 1-5, and the expression level of miR-21-5p in the exosomes thereof is significantly higher than that in comparative examples 1-5, which means that the cell secretion processes of examples 1-8 and comparative example 6 of the present application are more favorable for promoting the expression of miR-21-5p in the exosomes secreted by the cells. Among them, since comparative example 1 did not see a clear exogenesis by microscopic observation, no expression analysis of miR-21-5p was performed.

Table 2 also shows the relevant hyaluronic acid content measurements corresponding to examples 1-8 and comparative examples 1-6. Examples 1-8 do not differ much from comparative examples 2-5 with respect to the hyaluronic acid content in the cell suspension. Whereas examples 1-8 are significantly higher than comparative examples 2-5 for HA loading in the exosomes, demonstrating that the cell secretion process of examples 1-8 is more beneficial for promoting the transfer of hyaluronic acid into the exosomes and thus on the exosomes, where comparative example 1 was not analyzed because no exosomes were formed and comparative example 6 was not analyzed because no hyaluronic acid was added during cell secretion.

Animal experiment

In order to further clarify the specific functions and application values of the exosomes provided by the application, the application also carries out related animal experiments, and the specific experiments are as follows.

1. Materials and methods

1.1, laboratory animals

Clean Sprague-Dawley rats (Nantong Talaofe feed technology Co., ltd.) are selected, and after the temperature is kept at 22 ℃, the relative humidity is 65% -70%, the illumination period is 12h:12h, standard granular animal feed is freely fed, tap water is drunk, and the experiment is started after 1 week of feeding.

1.2, moulding

Shaving on the backs of the mice resulted in an exposed skin in the range of 3cm by 3cm, keeping the backs smooth. The mouse is placed under an ultraviolet lamp, the position of the lamp tube is adjusted, the distance between the light source and the mouse is about 3 ℃ m, the lamp tube is preheated for 5min before each irradiation, and the position of the mouse cage is rotated, so that the ultraviolet light irradiated by the mouse is balanced. The irradiation frequency is 6 times per week, total irradiation is 12 weeks, and the irradiation is carried out for 0.25 hours every day for the first 1-3 weeks; week 6-9, 1.5 hours of irradiation per day; week 10-12, 3 hours of irradiation per day; by the end of week 13, irradiation was terminated for a total of 12 weeks. The UV irradiation intensity was about 261.79J/cm ² The exposed skin of the irradiated mice is dry and dark, the mice have activities reduced, the mice are tired, the body is not curled and stretched, and the back red circular nodules are increased, the texture is thickened, and the like.

1.2, experimental grouping

Mice were divided into a blank group, a model group, an injection group and a positive control group, and all the other mice were subjected to molding treatment except for the blank group, which was not subjected to molding. Wherein, injection group: prior to molding, 100 μl of the exosome suspension prepared in each of the examples and comparative examples described above was injected daily into the exposed skin of the back of the mice 1 time a week, wherein no grouping experiment was performed since the exosome was not prepared in comparative example 1. Positive control group: prior to molding, mice were exposed to skin injection of hyaluronic acid (eli-mikane) 100 μl daily, 1 time a week. The experiment was continued for 4 weeks. The model group was not treated, and the normal group mice were not mechanically modelled.

1.3 acquisition of mouse skin tissue and cells

Killing mice, shearing skin tissues of each group of mice moulding areas on a sterile operating table, and placing the skin tissues for 1h after washing and sterilizing treatment, wherein the aim is to dissociate the tissues from a tissue source, namely 1h from the beginning to the time of enzymolysis; cutting skin tissue into small pieces, adding twice the volume of mixed enzyme solution (Primacell ^TM Serial tissue digestion enzyme liquid containing pancreatin, pancreatin-EDTA, collagenase, neutral proteinase, hyaluronidase, and degrading at 37deg.C for 45 min; the oscillator is used for fully oscillating, so that skin cells can fall off as much as possible; 1500rmp,5min, discarding the supernatant, leaving a pellet, fully suspending the pellet with sterile PBS, and washing twice; the supernatant was discarded by centrifugation again, and the pellet was suspended in DMEM medium (Thermo Fisher) and transferred to a petri dish.

1.4 cellular RNA extraction

Preparing the above mouse skin cell solution into 10 with DMEM culture medium ⁵ 10mL of each/mL suspension is added with l mL of Trizol lysate for 15min, the mixture is centrifuged, the supernatant is suspended by chloroform and isopropanol, a PureLink RNA small extraction kit is used for extracting RNA of cells, an RNA sample is obtained, and the concentration of the extracted RNA is detected on an ultraviolet spectrophotometer. The amount of intracellular miR-21-5p expression was detected by the method of the above example.

1.5 measurement of intracellular collagen content

Preparing the above mouse skin cell solution into 10 with DMEM culture medium ⁵ 10mL of each/mL suspension was added with 0.1mL of RIPA lysate containing 1% PMSF, treated for 30min, centrifuged, and the supernatant was removed, and the intracellular hydroxyproline content was detected using a hydroxyproline detection kit (Beijing Soy Bao) to indirectly detect the collagen content thereof.

1.6 measurement of intracellular elastin content

The sample of the cell lysis to be measured in the well was collected by referring to method 1.5, and the intracellular human elastin content was measured using a mouse Elastin (ELN) ELISA kit (martial arts, inc.).

1.8, intracellular hyaluronic acid content determination

Reference 1.6 method A sample of the lysed cells to be tested in the well was collected, and the content of hyaluronic acid therein was measured by HPLC by using hyaluronidase prepared by the method of the above example.

1.7, western blot detection of protein expression level

The above cells were used, LSBIO kit (T-PER ^TM Race-flier) to extract total protein and transfer to PVDF membrane, using 5% skimmed milk powder to seal for 2h at room temperature, adding antibody, incubating for 2h, using actin as reference protein, and adopting image software to calculate related expression quantity for protein gray analysis. The relative expression level was calculated.

1.9 data analysis

2. Results

TABLE 3 Table 3

Table 3 shows the collagen, elastin and hyaluronic acid contents in skin cells of the respective experimental animals. As can be seen from table 3, the collagen, elastin and hyaluronic acid contents in the skin tissue cells of the model mice were significantly reduced, and the surface modeling was successful, compared to the normal mice. Compared with the model building group, the content of collagen, elastin and hyaluronic acid in the skin cells of the mice in the positive control group is obviously improved, which indicates that the hyaluronic acid injection used in the positive control group can improve the photo-aged skin cells of the mice. After the exosomes prepared in examples 1-8 are injected into the photo-aged skin of the mice, the content of collagen, elastin and hyaluronic acid in cells of the exosomes is further improved compared with that of a positive control group, the modification effect of the exosomes on the photo-aged skin cells of the mice is very obvious, and the exosomes have obvious improvement effect compared with the existing hyaluronic acid injection. Comparative example 6, in which hyaluronic acid was not added during cell culture of the secretory body, had little effect of improving photoaged skin of mice, compared to the model group. Also, the exosomes prepared in comparative examples 2-5 showed little improvement in photoaged skin of mice relative to the model group.

TABLE 4 Table 4

Expression of miR-21-5P, P38, P-P38, P65 and P-P65 in aged skin cells of each group of mice is shown in Table 4. In Table 4, no expression of miR-21-5p was seen in the normal, model and positive control groups, indicating that only the injected group was able to provide miR-21-5p to the photoaged cells of the mice. And the expression level of the mice photo-aging cells miR-21-5p in the injection group is obviously higher than that of comparative examples 2-6, and is consistent with the results of in vitro experiments, so that exosomes provide the exogenous miR-21-5p expression level of the photo-aging cells.

In Table 4, the expression levels of P38 and P-P38 were lower in the model group than in the normal group, and the positive control group was able to increase the expression levels, indicating that modeling had an effect on the expression levels of P38 and P-P38, and the positive control group was able to promote the recovery of the expression levels of P38 and P-P38 in the photoaged skin of mice. In the injection group, examples 1 to 8 were also able to promote the restoration of the expression levels of P38 and P-P38 in the photoaged skin of mice.

In Table 4, the expression levels of P65 and P-P65 were lower in the model group than in the normal group, indicating that modeling had an effect on the expression levels of P65 and P-P65, whereas the positive control group was able to raise both expression levels and restore the damaging function to the photoaged skin of mice. The injection group of each example and the comparative example can obviously improve the expression quantity of P65 and P-P65 in the photo-aged skin cells of the mice relative to the positive control group, which shows that by injecting exosomes into the photo-aged skin of the mice, the skin aging loss of the mice can be recovered, and the expression of the two can be promoted and activated.

Because P38 and P-P38 are related proteins of the MAPK signal pathway, and P65 and P-P65 are related proteins of the NF- κB signal pathway, the exosomes provided by the embodiment of the application can promote miR-21-5P expression, activate the MAPK signal pathway and the NF- κB signal pathway, and simultaneously promote collagen and elastin expression, and by combining the conclusions, the exosomes provided by the application can possibly activate the MAPK signal pathway and the NF- κB signal pathway by providing the exogenous expression quantity of miR-21-5P, thereby achieving the effect of promoting collagen and elastin expression, realizing damage repair and protection of photoaged skin of mice, and simultaneously providing exogenous hyaluronic acid and further providing moisturizing and anti-aging effects of the skin of the mice. Thus, the exosomes provided by the embodiments of the present application have application in related products that exert anti-aging and skin protecting effects, such as skin repair products, skin rejuvenation products, and the like.

The foregoing is merely a preferred embodiment of the present application, but the scope of the present application is not limited thereto, and any changes or substitutions easily contemplated by those skilled in the art within the technical scope of the present application should be covered by the scope of the present application.

Claims

1. A method of obtaining an exosome comprising:

performing fusion culture, namely performing subculture when endometrium stem cells are cultured to 80% -90% of fusion degree; the cell inoculation concentration of the fusion culture is 1 multiplied by 10 ⁶ /mL；

Culturing endometrial stem cells in the generation 2 after the digestion treatment passage to obtain cells to be secreted with rounded and wrinkled forms;

secretion culture: transferring the cells to be secreted to perform liquid exchange culture, wherein the exchanged solution is a secretion culture medium to obtain a first culture solution; the secretion culture medium is a DMEM/F12 culture medium containing 20-65 ng/mL of TGF-alpha and 2-7.2 ng/mL of HC; and

carrying out load culture, namely continuously carrying out liquid exchange culture on the first culture solution, wherein the exchanged solution is a load culture medium, so that a second culture solution secreted with exosomes can be obtained, and the exosomes can be obtained after purification; the loading culture medium is a DMEM/F12 culture medium containing 0.2-1.7 mg/mL HA;

wherein the digestion treatment components specifically include:

performing first digestion treatment on the passaged 2 nd generation endometrium stem cell culture solution by using pancreatin solution containing 0.01% EDTA, and cleaning;

stopping digestion by using a DMEM/F12 culture medium containing 10% FBS and 2 times of the volume of the solution after the second digestion treatment, so as to obtain the cells to be secreted;

wherein, the volume of pancreatin solution containing 0.01% EDTA added in the first digestion treatment is 0.5% of the culture solution, and the treatment time is 20min; the pancreatin solution containing 0.01% EDTA was added to the second digestion treatment at a volume of 6.25% of the broth for a treatment period of 60 minutes.

2. The method according to claim 1, wherein the separation process of exosomes comprises:

3. A formulation comprising the exosomes obtained by the method of obtaining of claim 1 or 2.

4. Use of the exosomes obtained by the method of obtaining according to claim 1 or 2 for the preparation of anti-aging, skin repair products.