CN114703125A

CN114703125A - Method for obtaining exosome, preparation and application of exosome in preparation of anti-aging and skin repair products

Info

Publication number: CN114703125A
Application number: CN202210398089.6A
Authority: CN
Inventors: 王智亮; 温泉
Original assignee: Jiangxi Longqingtang Technology Co ltd
Current assignee: Zhuhai Yimei Enterprise Management Co ltd
Priority date: 2022-04-13
Filing date: 2022-04-13
Publication date: 2022-07-05
Anticipated expiration: 2042-04-13
Also published as: CN114703125B; CN116515741A

Abstract

The application discloses an obtaining method of exosome, a preparation and application thereof in preparing anti-aging and skin repair products. The method is characterized in that the endometrial stem cells are used for in-vitro culture, and a special secretion culture medium and a load culture medium are used in the secretion culture process, so that the secreted exosome not only can express special RNA, but also is loaded with hyaluronic acid. Animal experiments prove that the exosome has the effect of repairing the damage of mouse photoaging skin, so that the exosome has the application prospect of being widely applied to products related to aging resistance and skin repair.

Description

Method for obtaining exosome, preparation and application of exosome in preparation of anti-aging and skin repair products

Technical Field

The application relates to the technical field of exosomes, in particular to an obtaining method and a preparation of exosomes and application of exosomes in preparation of anti-aging and skin repair products.

Background

Exosomes are endogenous Extracellular Vesicles (EVs) released from cells, having a phospholipid bilayer containing cytosol, about 30150nm in size, containing various bioactive molecules such as proteins (membrane proteins and soluble proteins), carbohydrates, lipids, RNA (mRNA, miRNA, 1ncRNA, etc.), DNA, etc. The bioactive molecules are not only present in exosomes, but also can be secreted to the outside of cells through secretory cells and received by receptor cells, and the loaded bioactive molecules can be conveyed into the receptor cells, so that substance transfer among the cells can be carried out, communication among the cells is promoted, and development prospects are provided for development of the exosomes in the fields of drug delivery and the like.

Disclosure of Invention

In view of the above, the present application aims to provide an exosome capable of metastatic delivery with anti-aging and skin repair.

In a first aspect, the present application discloses a method for obtaining exosomes, comprising:

performing fusion culture, namely culturing EnSCs to 80-90% fusion degree, and performing subculture;

digesting and culturing EnSCs in the 2 nd generation after passage to obtain cells to be secreted with rounded and wrinkled shapes;

performing secretory culture, namely transferring the cells to be secreted for liquid changing culture, wherein the changed liquid is a secretory culture medium to obtain a first culture solution;

and (3) carrying out load culture, continuously carrying out liquid changing culture on the first culture solution, taking the changed solution as a load culture medium, obtaining a second culture solution secreting exosomes, and purifying to obtain the exosomes.

In the examples of the present application, the cell seeding concentration of the fusion culture was 1X 106/mL.

In an embodiment of the present application, the digestion processing component specifically includes:

carrying out first digestion treatment on the 2 nd generation EnSCs culture solution after passage by using a pancreatin solution containing 0.01% of EDTA, and cleaning;

carrying out second digestion treatment on the cells subjected to the first digestion treatment and cleaning by using a pancreatin solution of 0.01% EDTA to obtain cells to be secreted with rounded and wrinkled shapes;

wherein, the volume of the pancreatin solution containing 0.01 percent of EDTA added in the first digestion treatment is 0.5 percent of the culture solution, and the treatment time is 20 min; the pancreatin solution containing 0.01% of EDTA added in the second digestion treatment was 6.25% of the culture solution, and the treatment time was 60 min.

In the embodiment of the application, the secretion medium is DMEM/F12 medium containing 20-65 ng/mL of TGF-alpha and 2-7.2 ng/mL of HC.

In the embodiment of the application, the secretion medium is DMEM/F12 medium containing 15-55 ng/mL of TGF-beta, 0.6-4.8 ng/mL of EGF and 2-7.2 ng/mL of HC.

In the embodiment of the application, the loading culture medium is DMEM/F12 culture medium containing 0.2-1.7 mg/mL HA.

In an embodiment of the present application, the separation process of exosomes specifically includes:

filtering the second culture solution by 0.22 mu m, taking filtrate, and sequentially centrifuging for 10min at 300 g; centrifuging at 3000g for 10 min; centrifuging at 10000g for 30min to obtain primary extract solution with cells and fragments thereof removed;

treating the primary extract with an exosome extraction kit to obtain a refined extract;

and then carrying out centrifugal treatment on the refined extract liquid for 30 minutes at 5000g, 30 minutes at 10000g and 30 minutes at 30000g in sequence to obtain a precipitate, namely the final exosome.

In a second aspect, the present application discloses a formulation comprising exosomes obtained by the obtaining method described in the first aspect.

In a third aspect, the application discloses the application of the exosome obtained by the obtaining method of the first aspect in preparing an anti-aging and skin-repairing product.

Compared with the prior art, the application has at least the following beneficial effects:

in the embodiment of the application, the endometrial stem cells are used for in-vitro culture, the secreted exosomes are obtained, and a special secretion culture medium and a loading culture medium are used in the secretion culture process of the stem cells, so that the secreted exosomes not only can express special RNA, but also can be loaded with hyaluronic acid. Animal experiments prove that the exosome has the effect of repairing the damage of mouse photoaging skin, so that the exosome has the application prospect of being widely applied to products related to aging resistance and skin repair.

Drawings

FIG. 1 is a micrograph (200nm) of exosomes provided in example 1 of the present application.

FIG. 2 is a micrograph (200nm) of exosomes provided in example 2 of the present application.

FIG. 3 is a micrograph (200nm) of exosomes provided in example 3 of the present application.

FIG. 4 is a micrograph (100nm) of exosomes provided in example 4 of the present application.

FIG. 5 is a micrograph (100nm) of exosomes provided in example 5 of the present application.

FIG. 6 is a micrograph (100nm) of exosomes provided in example 6 of the present application.

FIG. 7 is a micrograph (200nm) of exosomes provided in example 7 of the present application.

FIG. 8 is a micrograph (200nm) of exosomes provided in example 8 of the present application.

FIG. 9 is a micrograph (200nm) of exosomes provided in comparative example 2 of the present application.

FIG. 10 is a micrograph (200nm) of exosomes provided in comparative example 3 of the present application.

FIG. 11 is a micrograph (200nm) of exosomes provided in comparative example 4 of the present application.

FIG. 12 is a micrograph (200nm) of exosomes provided in comparative example 5 of the present application.

FIG. 13 is a micrograph (200nm) of exosomes provided in comparative example 6 of the present application.

Detailed Description

In order to make the objects, technical solutions and advantages of the present application more clearly understood, the present application is further described in detail with reference to the following embodiments. It should be understood that the specific embodiments described herein are merely illustrative of the present application and are not intended to limit the present application. Reagents and equipment referred to below are commercially available unless otherwise specified, and conventional experimental methods are used unless otherwise specified.

Isolation and characterization of exosomes

1. Experimental materials and methods

1.1 cell line sources

In the embodiment of the application, endometrial stem cells (EnSCs) are used as a cell line source for separating exosomes, and the EnSCs are purchased from Shenzhen Quanmei gene company.

1.2 secretion Process of exosomes

The specific implementation process of the embodiment 1 is as follows:

1) fusion culture

EnSCs at 1 × 10⁶The cells were inoculated at a concentration of/mL into 25cm containing 16mL of DMEM/F12 complete medium (HyClone, USA)²T75 cell culture flasks (Saimerfi) at 37 ℃ with 5% CO₂Under the condition of CO₂Culturing in an incubator, replacing the cell culture medium every 24h, observing the cell morphology under an inverted microscope (NIB-100, Yongxin optics Limited in south of south Jing) during the period, and carrying out subculture when the cells grow to 80-90% fusion degree;

2) digestion treatment

Under aseptic conditions, 0.08mL of pancreatin solution (Beijing Soilebao Tech. Co., Ltd.) containing 0.01% EDTA was added to EnSCs culture medium cultured in the 2 nd generation for the first digestion treatment, and CO was added₂5% CO in incubator₂Digesting for 20min under the condition, and gently washing the cells for 3 times by using 2mL of PBS buffer solution;

the flask was again charged with l mL of a pancreatin solution containing 0.01% EDTA (about 6.25% by volume of the culture solution) for a second digestion treatment, and the CO was switched to₂5% CO in incubator₂Digesting for 60min under the condition, observing cells under an inverted microscope, and beating the side wall of the culture bottle to enable the cells to fall off when the cells begin to shrink and become round;

adding DMEM/F12 culture medium containing 10% FBS in an amount which is 2 times the volume of the digested solution to terminate the digestion, blowing and beating the mixed cell suspension by using an aseptic pipette, transferring the cell suspension to a 15ml centrifuge tube, centrifuging the cell suspension for 5min at a speed of 1000r/min, and removing the supernatant to obtain a precipitate, namely the cell to be secreted;

3) secretion culture

The pellet of the cells to be secreted was suspended in 15mL of 10% FBS DMEM/F12 medium and then placed at 25cm²T75 cell culture flask, transferred to CO₂In the incubator, the flask is wiped with alcohol and then placed at 37 ℃ under 5% CO₂Performing downward culture, wherein in the culture process, every 24 hours, the volume of the changed solution is not less than 10mL, and continuously culturing for 4 days to obtain a first culture solution;

the solution used was a secretion medium, which was DMEM/F12 medium containing 50ng/mL transforming growth factor-alpha (TGF-. alpha., Sigma-Aldrich), 5ng/mL cortisol (Hydrocortisone, HC, Hubei Wildri chemical science and technology, Inc.).

4) Load culture

And continuously culturing the first culture solution for 3 days by changing the solution, wherein the volume of the changed solution is not less than 10mL every 24h, and continuously culturing for 3 days to obtain a second culture solution so as to carry out subsequent steps.

The changed culture solution load culture medium is a DMEM/F12 culture medium containing 0.5mg/mL sodium hyaluronate (HA for short, molecular weight is about 3000, and Jinan Luxin chemical technology Co., Ltd.).

The implementation of the exosome secretion of example 2 is:

steps 1) to 2) are the same as in example 1, and in steps 3) to 4), the secretion medium is DMEM/F12 medium containing 20ng/mL of TGF-alpha and 2ng/mL of HC; the loading culture medium is DMEM/F12 culture medium containing 0.5mg/mL HA.

The implementation of the exosome secretion of example 3 is:

steps 1) to 2) were the same as in example 1, and the secretion medium in steps 3) to 4) was DMEM/F12 medium containing 65ng/mL of TGF-. alpha.and 7.2ng/mL of HC; the loading culture medium is DMEM/F12 culture medium containing 0.5mg/mL HA.

The implementation of the exosome secretion of example 4 is:

steps 1) to 2) are the same as example 1, and in steps 3) to 4), the secretion medium is DMEM/F12 medium containing 35ng/mL transforming growth factor-beta (TGF-beta, Sigma-Aldrich), 3ng/mL epidermal growth factor (EGF for short, Sigma-Aldrich) and 5ng/mL HC; the loading culture medium is DMEM/F12 culture medium containing 0.5mg/mL HA.

The implementation of the secretion of exosomes of example 5 is:

steps 1) to 2) are the same as example 1, and in steps 3) to 4), the secretion medium is DMEM/F12 medium containing 15.0ng/mL of EGF-beta, 0.6ng/mL of EGF and 2.0ng/mL of HC; the loading culture medium is DMEM/F12 culture medium containing 0.5mg/mL HA.

The implementation of the exosome secretion of example 6 is:

steps 1) to 2) are the same as example 1, and in steps 3) to 4), the secretion medium is DMEM/F12 medium containing 55.0ng/mL of EGF-beta, 4.8ng/mL of EGF and 7.2ng/mL of HC; the loading culture medium is DMEM/F12 culture medium containing 0.5mg/mL HA.

The implementation of the exosome secretion of example 7 was:

steps 1) to 2) are the same as in example 1, and in steps 3) to 4), the secretion medium is DMEM/F12 medium containing 50ng/mL of TGF-alpha and 5ng/mL of HC; the loading culture medium is DMEM/F12 culture medium containing 0.2mg/mL HA.

The implementation of the exosome secretion of example 8 is:

steps 1) to 2) are the same as in example 1, and in steps 3) to 4), the secretion medium is DMEM/F12 medium containing 50ng/mL of TGF-alpha and 5ng/mL of HC; the loading medium was DMEM/F12 medium containing 1.7mg/mL HA.

The implementation of the exosome secretion of comparative example 1 was:

adipose-derived mesenchymal stem cells (ADSCs) are selected as cell line secretion exosomes purchased from Gibco, Saimer Fei, and the culture process is approximately the same as that of example 1.

The implementation of the secretion of exosomes of comparative example 2 was:

EnSCs are still taken as a cell line secretion exosome, the steps 1) to 2) are carried out as the same as the example 1, and in the steps 3) to 4), the secretion culture medium is 10% FBS DMEM/F12 culture medium; the loading medium was DMEM/F12 medium containing 0.5mg/mL HA.

The implementation of exosome secretion of comparative example 3 was:

still taking EnSCs as a cell line secretion exosome, the steps 1) to 2) are carried out as the same as the example 1, and in the steps 3) to 4), the secretion culture medium is DMEM/F12 culture medium with 50ng/mL TGF-alpha; the loading medium was DMEM/F12 medium containing 0.5mg/mL HA.

The implementation of exosome secretion of comparative example 4 was:

still taking EnSCs as a cell line secretion exosome, the steps 1) to 2) are the same as the example 1, and in the steps 3) to 4), the secretion culture medium is DMEM/F12 culture medium containing 5ng/mL HC; the loading medium was DMEM/F12 medium containing 0.5mg/mL HA.

The implementation of the exosome secretion of comparative example 5 was:

still taking EnSCs as a cell line secretion exosome, the steps 1) to 2) are carried out as the same as the example 1, and in the steps 3) to 4), the secretion culture medium is DMEM/F12 culture medium containing 35ng/mL of TGF-beta and 3ng/mL of EGF; the loading medium was DMEM/F12 medium containing 0.5mg/mL HA.

The implementation of exosome secretion of comparative example 6 was:

still taking EnSCs as a cell line secretion exosome, the steps 1) to 2) are carried out as the same as the example 1, and in the steps 3) to 4), the secretion culture medium is DMEM/F12 culture medium with 50ng/mL TGF-alpha and 5ng/mL HC; the loading medium was DMEM/F12 medium containing 10% FBS.

1.3 isolation of exosomes

The implementation process of example 1 is as follows:

(1) filtering the cell culture solution obtained by the above culture with a 0.22 μm filter, placing the filtrate in a centrifuge tube, and transferring to a desk-top ultra-high speed centrifuge for gradient centrifugation: centrifuging at 300g for 10 min; centrifuging at 3000g for 10 min; 10000g for 30min to remove cells and cell debris.

(2) The centrifuged supernatant was transferred to another clean sterile centrifuge tube, and ExoQuick-TC extract (SBI, usa) was added in a volume of 1/10 supernatant and mixed, and the mixture was incubated overnight (at least 12 hours) at 4 ℃ under freezing, and the tube was kept upright during incubation to avoid re-mixing by pouring.

(3) And transferring the test tube into a centrifuge, centrifuging for 30 minutes at 5000g, 30 minutes at 10000g and 30 minutes at 30000g in sequence at 4 ℃, discarding supernatant fluid during each centrifugation, obtaining a precipitate, performing the next operation, and finally obtaining the precipitate, namely the purified exosome, and carrying out heavy suspension precipitation by using sterile PBS buffer solution.

Examples 2 to 8 and comparative examples 1 to 6 were carried out in the same manner as in example 1 for the isolation of exosomes.

1.4 analysis of exosomes

(1) Exosome particle size distribution

The resulting exosome size distribution was analyzed by dynamic light scattering and the PBS buffer was filtered using a 0.1 μm microfiltration membrane to reduce the particle background interference that may be present in the solution and used to dilute the concentrated exosome samples. And (3) diluting the exosome sample in a gradient manner, and testing the exosome sample by a Malvern nanometer particle size analyzer to ensure that no bubbles exist on the surface of the solution during sample testing.

The particle size was measured with a Malvern nanometer particle size analyzer (Nano ZS90, Malvern instruments, Inc.) at 25 deg.C in PBS, refractive index of 1.400, absorption coefficient of 0.001, and back light scattering at 173 deg.C. When the measured particle size distribution of the sample close to the concentration gradient is stable and similar, the sample concentration is the sample concentration suitable for detection. The samples were tested in parallel 5 times, the data were processed through Zetasizer software, and averaged.

(2) Observation by scanning electron microscope

Mixing the exosome sample suspension with 5% glutaraldehyde according to the volume ratio of 1:1, standing for 30min at 4 ℃ to fix the particle morphology, dropwise adding the mixture onto a single-polished silicon wafer, then performing gradient dehydration on the sample by respectively using 50%, 60%, 70%, 80% and 90% methanol to remove water, salt and the like of the sample sufficiently, and storing at 4 ℃ until the detection by a scanning electron microscope.

(3) WesternBlot identification of exosome protein markers

Taking the exosome obtained by the separation, adding RIPA lysate (the added RIPA lysate is 10% of the volume of the exosome suspension) into the exosome suspension at the temperature of 4 ℃ for treatment for 30min so as to fully split and decompose the exosome; then, the resulting mixture was centrifuged at 12000rpm for 10min at 4 ℃ to discard the precipitate, and the supernatant was retained and subjected to total protein content measurement using BCA protein concentration kit (Abcam China).

After the quantification of the protein concentration is completed, diluting with a loading buffer solution of 5 xSDS to make the final concentration of the protein be 1 mug/muL, finally bathing for 5min at 95 ℃ to denature the protein, taking the protein as the loading solution of SDS-PAGE, carrying out SDS-PAGE electrophoresis with the loading volume of 15 muL per hole, and carrying out electrophoresis for 2.5h under the conditions of room temperature and 100mV of voltage to separate a Marker);

then placing the gel in a membrane transferring buffer solution, shaking the gel for 10min by a shaking table, then adopting a PVDF membrane activated by methanol for 30s, and transferring the membrane overnight at the temperature of 4 ℃ and the voltage of 30 mV;

after the membrane transferring process is finished, washing the transferred membrane for 1 time by using a TBST buffer solution, transferring the washed membrane into a TBST buffer solution containing 5% skimmed milk powder, and oscillating the membrane for 1 hour at room temperature on a shaking table to seal the membrane; then adding primary antibody for incubation, and shaking the mixture on a shaker at the temperature of 4 ℃ for overnight; after the primary antibody incubation is finished, placing the membrane in TBST buffer solution, shaking and eluting for 3 times, each time for 10min, then incubating the secondary antibody in a dark place, and shaking and incubating for 1h at room temperature; after the secondary antibody incubation is finished, the membrane is placed in TBST buffer solution to be shaken and eluted for 3 times, each time is 10min, then the membrane is developed by ECL luminescence developing solution, an F1uorChem HD2 system is adopted to shoot images, and ImageJ quantifies the gray level of the strip.

The primary antibodies added after the sealing of the rotating membrane are respectively CD90(EPR2949), CD63(EPR21151), Calnexin (EPR21205) and GADPH (EPR16891) and are all purchased from Abcam company, the added secondary antibodies are all HRP-conjugated secondary antibodies and are purchased from Abcam company, so that parallel experiments are respectively carried out to detect the contents of exosomes CD90, CD63 and Calnexin.

1.5, detecting the expression of miR-21-5 p:

after the steps of culturing the cells and secreting the exosomes are completed, namely the step 8), detecting the expression level of the miR-21-5p in the cells and the exosomes by a fluorescence quantitative PCR method.

(1) Sample liquid preparation

First test sample: taking the exosome obtained by the separation, adding RIPA lysate (the added RIPA lysate is 10% of the volume of the exosome suspension) into the exosome suspension at the temperature of 4 ℃ for treatment for 30min so as to fully split and decompose the exosome; and centrifuging at 4 ℃ and 12000rpm for 10min, discarding the precipitate, and keeping the supernatant as a first test sample for detecting the miR-21-5p expression quantity in the exosome.

A second test sample: and (3) filtering the cell culture solution obtained by the culture by using a 0.22-micron filter, taking filter residues, suspending the filter residues by using a RIPA lysate, treating the suspension for 30min, centrifuging the suspension at 4 ℃ and 12000rpm for 10min, removing precipitates, and keeping a supernatant to serve as a second test sample for detecting the miR-21-5p expression quantity in the cells.

(2) The fluorescent quantitative PCR detection was performed according to the fluorescent quantitative PCR Kit All-in-one miRNA qPCR Synthesis Kit (product No. QPO11, available from GeneCopoeia Co., Ltd.), and total RNAs in the first sample and the second sample were extracted with a total RNA extraction Reagent TRIzon Reagent (available from Kangji Co., Ltd.), respectively.

(3) cDNA was synthesized by reverse transcription using the reverse transcription Kit All-in-one (TM) miRNA First-Strand cDNA Synthesis Kit (cat # QP014: purchased from GeneCopoeia) and cDNA was synthesized by adding polyA tail to 5. mu.L of the extracted RNA solution and reverse transcription under the conditions of 42 ℃ for 60min → 95 ℃ for 3 min.

(4) Diluting the cDNA product by 10 times, taking 2 mu L as a template, taking 2 mu L of Primer, 2 mu L of All-in-OneTM miRNA qPCR Mix10 mu L, 2 mu L of Universal adapter PCR Primer, 0.1 mu L of ROX Reference Dye, preparing a fluorescent quantitative PCR reaction system with the total volume of 20 mu L by double distilled water, and carrying out fluorescent quantitative PCR reaction according to the conditions of three steps, namely initial denaturation at 95 ℃ for 15min (1 cycle) → 94 ℃ for 20s denaturation, annealing at 65 ℃ for 30s, pre-amplification at 72 ℃ for 34s extension (5 cycles) → 94 ℃ for 20s denaturation, annealing at 61 ℃ for 34s extension for amplification, and collecting fluorescent signals (40 cycles). Wherein the miR-21-5p primer sequence is as follows: CCGCGCGTAGCTTATCAGACTGATGTTGA, respectively; the sequence of the U6 primer is GCTTCGGCACTTATACTAAAAT; all provided by Shanghai workers.

(5) The expression level of miR-21-5p adopts 2^-ΔΔCtThe method is used for relative quantitative analysis, wherein an internal reference gene U6 is used as a reference gene, Ct is used as a cycle threshold value, each sample is repeated for 5 times, and an average value is taken for statistical analysis.

1.6 measurement of hyaluronic acid content

After the cell culture and secretion steps are completed, namely the step 8), the hyaluronic acid content in the exosomes and in the cell suspension is detected by an HPLC method, and the cell suspension is a filtrate obtained by filtering the cell suspension by using a 0.22 mu m filter in the exosome separation step.

(1) HPLC is adopted for detection, and the chromatographic conditions are as follows: MCI GEL CK08EH chromatography column (8mm × 300mm, 5 μm, Mitsubishi liquid phase); mobile phase: 1% phosphoric acid; flow rate: 0.6 mL/min; sample injection amount: 20 mu L of the solution; column temperature: 40 ℃; detection wavelength: 232 nm.

(2) Standard samples: precisely weighing about 5mg of sodium hyaluronate standard in a 50mL volumetric flask, adding 10mL of enzymolysis buffer solution (weighing 5mmol/L sodium dihydrogen phosphate and 5mmol/L disodium hydrogen phosphate, and having pH of 6.0), fully dissolving, fixing the volume to scale, and mixing uniformly; taking 0.2mL of the solution, adding 0.5mL of hyaluronidase, mixing, sealing, performing enzymolysis at 42 ℃ for 2h, and boiling for 2min to inactivate the enzyme; transferring the solution into a 10mL volumetric flask, fixing the volume to the scale with a buffer solution, and filtering with a 0.22-micron filter membrane to obtain a control solution.

(3) Test sample

Third test sample: taking the cell suspension (about 5mL), and centrifuging at 3000g for 10 min; centrifuging at 10000g for 30min, collecting supernatant 0.2mL, adding hyaluronidase 0.4mL, mixing, sealing, performing enzymolysis at 42 deg.C for 2 hr, and boiling for 2min to inactivate enzyme; transferring the solution into a 10mL volumetric flask, fixing the volume to the scale by using a mobile phase, and filtering by using a 0.22 mu m filter membrane to obtain a third test sample.

Fourth test sample: taking the exosome obtained by separation, and adding 10mL of RIPA lysate into the suspension of the exosome to treat for 30min at the temperature of 4 ℃ so as to fully split and dissolve the exosome; adding 0.5mL hyaluronidase, mixing, sealing, performing enzymolysis at 42 deg.C for 2h, boiling for 2min to inactivate enzyme; centrifuging at 4 deg.C and 12000rpm for 10min, discarding precipitate, and keeping supernatant; transferring the solution into a 10mL volumetric flask, fixing the volume to the scale by using a mobile phase, and filtering by using a 0.22 mu m filter membrane to obtain a fourth sample.

(4) And detecting the standard sample according to the chromatographic conditions to obtain the characteristic peak area in the chromatogram, making a standard curve and a standard equation, detecting the sample to be tested in the same way to obtain the corresponding characteristic peak area, substituting the characteristic peak area into the standard equation, and calculating to obtain the content of the sodium hyaluronate in the third sample to be tested and the fourth sample to be tested. Wherein the hyaluronic acid content of the cell suspension is equal to the corresponding HA content (mg/mL) determined for the third sample, 50X 10/0.6; the hyaluronic acid content in exosomes was: the HA loading in exosomes was the HA content in the fourth test sample (μ g/mL) x the fourth test sample volume (20 mL)/exosome mass (μ g), which was the final precipitate mass obtained in the exosome separation step.

1.7, data analysis

The experimental data are subjected to data analysis by using Excel 2013 and SPSS 22.0 statistical software for statistical arrangement, each data is measured for multiple times and is represented by a mean value and a standard deviation thereof, single-way ANOVA (One-way ANOVA) and DunCan's multiple comparison are respectively carried out by using SPSS 22.0, and significance difference marking is carried out.

2. Results

TABLE 1 expression levels relative to GADPH

Detailed description of the preferred embodiments	CD90	CD63	Calnexin
				Example 1	167.2±1.3％a	152.4±12.7％a	15.7±0.6％d
Example 2	143.1±5.2％ab	148.3±8.6％a	16.2±1.4％d
				Example 3	171.2±2.4％a	147.8±7.2％a	21.3±2.1％d
Example 4	175.5±6.7％a	162.8±7.5％a	14.2±0.4％d
				Example 5	161.7±3.8％a	150.2±6.2％a	10.3±1.4％d
Example 6	168.5±2.1％a	154.3±4.2％a	13.4±2.1％d
				Example 7	164.2±3.1％a	150.7±2.8％a	8.2±1.3％de
Example 8	166.0±0.9％a	151.3±4.2％a	5.8±0.2％de
				Comparative example 1	2.7±0.3％d	12.7±2.1％d	94.2±3.7％a
Comparative example 2	32.4±5.7％c	43.2±4.1％c	76.2±5.8％b
				Comparative example 3	88.8±4.1％cd	77.7±6.2％c	64.2±7.2％b
Comparative example 4	92.1±3.2％c	85.1±1.3％b	43.1±5.2％c
				Comparative example 5	81.4±2.6％c	99.3±7.3％c	62.8±4.8％b
Comparative example 6	158.8±4.3％a	153.1±4.4％a	13.6±3.1％d

As can be seen from table 1, the relative expression amounts of CD90 and CD63 in the sample solutions prepared in examples 1 to 8 and comparative example 6 are both more than 100%, and are positive expression, while the relative expression amount of Calnexin is less than 100%, and are negative expression, and it is proved that the cells actually secrete exosomes after the cell line culture process according to the "minimum identification standard" published in 2014 by International Society for Extracellular vectors ISEV. The relative expression levels of CD90, CD63 and Calnexin in the sample solutions prepared in comparative examples 1-5 did not exceed 100%, and it could not be confirmed that these examples secreted exosomes or secreted low levels of exosomes after cell culture. However, as shown in the figure, secretion was obtained in examples 1 to 8 and comparative examples 2 to 6, and no obvious secretion was found in comparative example 1, by microscopic observation of the precipitates obtained in the above-described examples and comparative examples.

Combining the step analysis of the secretion process of the exosome, the discovery shows that the endometrium stem cell is adopted as the secretory cell in the secretion process of the exosome, which is beneficial to obtaining high-concentration exosome, and the addition of proper concentrations of TGF-alpha, TGF-beta, EGF and HC in the secretion step 6) has obvious influence on the secretion amount of the exosome.

TABLE 2

The expression levels of miR-21-5p in examples 1-8 and comparative examples 1-6 are shown in Table 2. As can be seen from Table 2, the expression level of miR-21-5p in the cells corresponding to examples 1-8 and comparative example 6 is significantly lower than that of comparative examples 1-5, and the expression level of miR-21-5p in exosomes thereof is significantly higher than that of comparative examples 1-5, which shows that the cell secretion process of examples 1-8 and comparative example 6 of the application is more favorable for promoting the expression of miR-21-5p in the exosomes secreted by the cells. Among them, comparative example 1 was not subjected to expression analysis of miR-21-5p, since no significant exosome formation was observed by microscopic observation.

Table 2 also shows the relevant hyaluronic acid content measurements corresponding to examples 1-8 and comparative examples 1-6. The hyaluronic acid content in the cell suspension is not much different from that in the comparative examples 2 to 5 in examples 1 to 8. Whereas, with respect to the HA loading in the exosomes, examples 1 to 8 were significantly higher than comparative examples 2 to 5, illustrating that the cell secretion process of examples 1 to 8 was more favorable for promoting the transfer of hyaluronic acid into the exosomes to be loaded on the exosomes, wherein comparative example 1 was not analyzed since the exosomes were not formed, and comparative example 6 was not analyzed since hyaluronic acid was not added during the cell secretion process.

Animal experiments

In order to further clarify the specific functions and application values of the exosomes provided by the application, the application also carries out related animal experiments, and the details are as follows.

1. Materials and methods

1.1 Experimental animals

Selecting clean Sprague-Dawlay rats (Nantong Tetroffe fodder science and technology Co., Ltd.), freely feeding standard granular animal feed at a constant temperature of 22 ℃, a relative humidity of 65% -70% and a light period of 12h:12h, drinking tap water, and starting the experiment after adapting to feeding for 1 week.

1.2, making a mold

The mice were shaved on their backs to form exposed skin in the range of 3cm x 3cm, keeping the backs smooth. The mouse is placed under an ultraviolet lamp, the position of a lamp tube is adjusted to ensure that the distance between a light source and the mouse is about 3 ℃, the lamp tube is preheated for 5min before each irradiation, and the position of a mouse cage is rotated, so that the ultraviolet ray irradiated by the mouse is balanced. The irradiation frequency is 6 times per week for 12 weeks, and the irradiation time is 0.25 hr per day for the first 1-3 weeks; irradiating for 1.5 hr every day in 6-9 weeks; irradiating for 3 hr every day in 10-12 weeks; irradiation was terminated for 12 weeks by week 13. The UV irradiation intensity is about 261.79J/cm²Small after irradiationThe exposed skin of the mouse is dry and dark, the mouse has the symptoms of reduced activity, listlessness, fatigue, body rolling and non-stretching, increased red and round spots on the back, thickened texture and the like.

1.2 Experimental groups

The mice are divided into a blank group, a model group, an injection group and a positive control group, and the molding treatment is carried out on the mice of other groups except the blank group without molding. Wherein, the injection group: 100 μ L of the exosome suspension prepared in each example and comparative example was injected daily to the exposed skin on the back of the mouse 1 time per week before molding, wherein no grouping experiment was performed since no exosome was prepared in comparative example 1. Positive control group: before molding, hyaluronic acid (alue) was injected into the exposed skin of the back of the mouse at a dose of 100 μ L per day, 1 time per week. The experiment was treated continuously for 4 weeks. Model groups were left untreated, and normal mice were not mechanically modelled.

1.3 obtaining mouse skin tissue and cells

Killing the mice, shearing skin tissues of each group of mouse modeling areas on a sterile operating table, washing and sterilizing, and then placing the skin tissues for 1h, wherein the purpose is to dissociate the tissues from a tissue source, and the time from the beginning to enzymolysis is 1 hour; cutting skin tissue into small pieces, adding mixed enzyme solution (PrimaCell) with double volume^TMA series of tissue digestive enzyme solutions containing pancreatin, pancreatin-EDTA, collagenase, neutral protease, and hyaluronidase) and degraded at 37 deg.C for 45 min; the oscillator is used for fully oscillating, so that skin cells can fall off as much as possible; 1500rmp, 5min, abandoning the supernatant, leaving the precipitate, fully suspending the precipitate with sterile PBS, and washing twice; the cells were centrifuged again, the supernatant was discarded, and the pellet was suspended in DMEM medium (Thermo Fisher) and transferred to a petri dish.

1.4 extraction of cellular RNA

Preparing the mouse skin cell solution into 10 by using a DMEM medium⁵Adding 10mL of suspension into l mL of Trizol lysate for treating for 15min, centrifuging, suspending the supernatant with chloroform and isopropanol, extracting RNA of cells with PureLink RNA miniprep kit to obtainAnd taking an RNA sample, and detecting the concentration of the extracted RNA on an ultraviolet spectrophotometer. And detecting the expression level of the miR-21-5p in the cells by referring to the method of the embodiment.

1.5 determination of intracellular collagen content

Preparing the mouse skin cell solution into 10 by using a DMEM medium⁵Adding 0.1mL of RIPA lysate containing 1% PMSF into 10mL of suspension per mL, treating for 30min, centrifuging, removing supernatant, and detecting the content of hydroxyproline in cells by using a hydroxyproline detection kit (Beijing Solibao) to indirectly detect the content of collagen.

1.6 determination of intracellular elastin content

The test cell lysate samples were collected from the wells according to the method 1.5, and the intracellular human elastin content was measured using the mouse Elastin (ELN) ELISA kit (GmbH Biotech, Inc., of Emma-Lehri).

1.8 determination of the content of hyaluronic acid in cells

The cell lysis sample to be tested in the well was collected by the method of reference 1.6, and the sample was prepared by using hyaluronidase and the hyaluronic acid content thereof was measured by HPLC in accordance with the method of the above example.

1.7 Western blot detection of protein expression level

Using the above cells, LSBIO kit (T-PER)^TMSaimerfi) extracting total protein and transferring the total protein to a PVDF membrane, sealing the PVDF membrane for 2 hours at room temperature by using 5% skimmed milk powder, adding an antibody, incubating for 2 hours, taking actin as internal reference protein, and calculating the related expression quantity by using image software to perform protein gray analysis. Relative expression levels were calculated.

1.9, data analysis

2. Results

TABLE 3

Table 3 shows the collagen, elastin and hyaluronic acid contents in the skin cells of the respective experimental animals. As can be seen from table 3, the contents of collagen, elastin, and hyaluronic acid in skin tissue cells of the model group mice were significantly reduced compared to the normal group, and surface modeling was successful. Compared with a modeling group, the content of collagen, elastin and hyaluronic acid in the skin cells of the mice in the positive control group is obviously improved, and the hyaluronic acid injection used in the positive control group can improve the photoaged skin cells of the mice. After the exosomes prepared in the embodiments 1-8 are injected into the mouse photoaging skin, the contents of intracellular collagen, elastin and hyaluronic acid are further improved relative to a positive control group, the exosomes have a very obvious modification effect on the mouse skin photoaging skin cells, and the exosomes have a remarkable improvement effect relative to the existing hyaluronic acid injection. Comparative example 6 hyaluronic acid was not added during cell culture of secretor, and it had almost no improving effect on mouse photoaged skin compared to the model group. Also, the exosomes prepared in comparative examples 2-5 were much less improved in mouse photoaged skin than the model group.

TABLE 4

The expression of miR-21-5P, P38, P-P38, P65 and P-P65 in the photo-aged skin cells of each group of mice is shown in Table 4. In Table 4, no expression of miR-21-5p is seen in the normal group, the model group and the positive control group, which indicates that only the injection group can provide miR-21-5p for the mouse photoaging cells. And the expression quantity of the mouse photoaging cells miR-21-5p in the injection group is obviously higher in examples 1-8 than in comparative examples 2-6, and is consistent with the results of in vitro experiments, which shows that the exosomes provide the exogenous miR-21-5p expression quantity of the photoaging cells.

In Table 4, the expression levels of P38 and P-P38 in the model group are lower than those in the normal group, while the expression levels of the positive control group can be increased, which indicates that the model has an effect on the expression levels of P38 and P-P38, and the expression levels of P38 and P-P38 in the photoaged skin of the mouse can be restored to be normal in the positive control group. In the injection group, examples 1-8 can also promote the normal expression of P38 and P-P38 in mouse photoaging skin.

In Table 4, the expression levels of P65 and P-P65 in the model group are lower than those in the normal group, which indicates that the modeling has an effect on the expression levels of P65 and P-P65, while the positive control group can improve the expression levels of the P65 and the P-P65 and restore the damaged function of the mouse photoaging skin. And the examples and comparative examples of the injection group can obviously improve the expression quantity of P65 and P-P65 in the mouse photoaging skin cells relative to the positive control group, which shows that the exosome is injected into the mouse photoaging skin, so that the skin aging loss caused by light can be recovered, and the expression of the exosome and the exosome can be promoted and activated.

Since P38 and P-P38 are related proteins of MAPK signal path, and P65 and P-P65 are related proteins of NF-kB signal path, therefore, the exosome provided by the embodiment of the application can promote miR-21-5p expression, activate a MAPK signal pathway and a NF-kB signal pathway, meanwhile, the expression of collagen and elastin can be promoted, and the conclusion shows that the exosome provided by the application can activate a MAPK signal path and a NF-kB signal path by providing the exogenous expression quantity of miR-21-5p, thereby achieving the effect of promoting the expression of collagen and elastin, realizing the effects of repairing and protecting the damage of the mouse photoaging skin, meanwhile, the exosome can provide exogenous hyaluronic acid, and further provides the moisturizing and anti-aging effects of the skin of the mouse. Therefore, the exosome provided by the embodiment of the application has the application in related products playing anti-aging and skin protection effects, such as skin repair products, skin regeneration products and the like.

The above description is only for the preferred embodiment of the present application, but the scope of the present application is not limited thereto, and any changes or substitutions that can be easily conceived by those skilled in the art within the technical scope of the present application should be covered within the scope of the present application.

Claims

1. A method of obtaining exosomes, comprising:

and (3) carrying out load culture, continuously carrying out liquid changing culture on the first culture solution, taking the changed solution as a load culture medium to obtain a second culture solution secreting the exosomes, and purifying to obtain the exosomes.

2. The method of claim 1, wherein the cell culture is cultured in a concentration of 1X 10⁶/mL。

3. The method for obtaining as claimed in claim 1, characterized in that said means of digestive treatment comprise in particular:

carrying out second digestion treatment on the cells subjected to the first digestion treatment and cleaning by using a pancreatin solution of 0.01 percent EDTA to obtain cells to be secreted with rounded and wrinkled shapes;

then, the DMEM/F12 culture medium containing 10% FBS and with the volume 2 times of the volume of the solution after the second digestion treatment is used for terminating the digestion, and the cells to be secreted can be obtained;

4. The method for obtaining a recombinant human factor according to claim 1, wherein the secretion medium is DMEM/F12 medium containing 20-65 ng/mL of TGF-alpha and 2-7.2 ng/mL of HC.

5. The method for obtaining a recombinant human factor of claim 1, wherein the secretion medium is DMEM/F12 medium containing 15-55 ng/mL of TGF-beta, 0.6-4.8 ng/mL of EGF and 2-7.2 ng/mL of HC.

6. The method for obtaining a peptide according to claim 1, wherein the loading medium is DMEM/F12 medium containing 0.2-1.7 mg/mL HA.

7. The obtaining method according to claim 1, wherein the exosome isolation process specifically comprises:

filtering the second culture solution by 0.22 mu m, taking filtrate, and sequentially centrifuging for 10min at 300 g; centrifuging at 3000g for 10 min; centrifuging at 10000g for 30min to obtain primary extract solution with cells and fragments removed;

and then carrying out 5000g centrifugation for 30 minutes, 10000g centrifugation for 30 minutes and 30000g centrifugation for 30 minutes on the fine extract in sequence to obtain precipitates, namely the final exosome.

8. A preparation comprising exosomes obtained by the obtaining method of any one of claims 1-7.

9. Use of the exosomes obtained by the obtaining method according to any one of claims 1 to 7 for the preparation of anti-aging, skin-rejuvenating preparations.