CN104862316A - MiRNA-2400 with biological function of significantly promoting bovine preadipocyte proliferation - Google Patents

Abstract

The invention provides miRNA-2400 with a biological function of significantly promoting bovine preadipocyte proliferation, and belongs to the technical field of cell biology. Bovine preadipocytes are identified by performing in vitro isolated culture on the bovine preadipocytes and using an immunofluorescent staining method, the expression quantity of the miRNA-2400 is tested by using stem-loop fluorescent quantitation RT-PCR, and the influence of the miRNA-2400 to the bovine preadipocyte proliferation is tested by using EdU; the influence of the miRNA-2400 to the bovine preadipocyte proliferation is characterized in that in a process that the bovine preadipocytes are differentiated to fat cells, with the increase of the differentiation days and differentiation degree, the expression quantity of the miRNA-2400 is significantly decreased; after the overexpression of miRNA-2400, the proliferation rate of the preadipocytes is significantly increased, and the expression quantity of proliferation-related CCND1 genes is significantly increased; the result shows that the miRNA-2400 is a small RNA capable of significantly promoting bovine preadipocyte proliferation in the fat cell development adjustment process.

Description

There is the miRNA-2400 significantly promoting ox PECTORAL LIMB SKELETON proliferative biological function

Technical field

The present invention relates to the miRNA-2400 having and significantly promote ox PECTORAL LIMB SKELETON proliferative biological function, belong to technical field of cell biology.

Background technology

The differentiation of PECTORAL LIMB SKELETON and propagation are the direct factors of causeing fat.Utilizing the reproduction restraint rule of the PECTORAL LIMB SKELETON research cell of vitro culture, is the method commonly used of scientific research personnel in recent years.The cultivation of external PECTORAL LIMB SKELETON is the ideal model of research fatty tissue.Research domestic animal lipopexia situation, for discussion metabolism of fat relative disease, optimizes domestic animal meat quality and has important value.The PECTORAL LIMB SKELETON of this research to ox is separated, set up the method for its vitro culture, and the differentiation-inducing adipocyte becoming maturation, to significant molecule lipoproteinesterase (the lipoprotein lipase in adipocyte, LPL) and peroxisome proliferators activated receptor γ (PPAR γ) carry out immunofluorescence dyeing, to prove the character of PECTORAL LIMB SKELETON that is separated and purity.Lipoproteinesterase (lipoprotein lipase, LPL) is a kind of characteristic protein of adipocyte, is the marker gene (Couturier et al, 1998) of adipocyte early differentiation.Triglyceride level entrained by chylomicron in blood and vldl can be resolved into glycerine and lipid acid by LPL, the raw material needed for synthetic glycerine three ester is provided to related organization, important regulating and controlling effect (Mead et al, 2002) is played to fatty deposits.Peroxisome proliferation-activated receptors (PPAR) family be affecting lipocyte differentiation and lipid metabolism main core in Transcriptional Reporter, there are 3 kinds of hypotypes, i.e. PPAR α, PPAR β (also known as PPAR δ) and PPAR γ, they are all variant in structure, function and tissue distribution.Its family member PPAR γ is the transcription factor of known unique high level expression in fatty tissue at present, has important regulative to the differentiation of adipocyte.Namely namely PPAR γ have expression at the early stage of Adipocyte Differentiation before most of adipocyte gene transcriptional activation, and in Adipocyte Differentiation process, PPAR γ expression level constantly raises, and expresses the highest (Cheng Anwei etc., 2009) to mature fat cell.MicroRNA (miRNA) is the tiny RNA raw in a class, length is about 20-24 Nucleotide, is that the single stranded RNA precursor of about 70-90 base size of hairpin structure generates after the processing of Dicer enzyme.It has multiple important regulating effect in cell.Each miRNA can have multiple target gene, and several miRNAs also can regulate same gene.The regulating networks of this complexity both can regulate and control the expression of multiple gene by a miRNA, also can be carried out the expression of certain gene of finely regulating by the combination of several miRNAs.Along with miRNA regulate gene expression research progressively deeply, the genomic complicacy of higher eucaryote and complicated gene expression regulation network will be helped us understand.MiRNA is extensively present in eukaryote, is the short data records RNA of one group of not coded protein, itself does not have open reading frame (ORF).Ripe miRNA, 5 ' end has a phosphate group, and 3 ' holds as hydroxyl.The gene of coding miRNAs produces a long pri-RNA molecule at first, and this initial stage molecule also must be sheared into about 70-90 base size, tool hairpin structure single stranded RNA precursor (pre-miRNA) generation after the processing of Dicer enzyme.The phosphate group that ripe miRNA 5 ＇ holds and 3 ' terminal hydroxy group are then the diacritics of the function RNA degradation fragment of it and equal length.MiRNA 5 ＇ holds first base pair U (uridine) to have strong proneness, and repels G, but the second to the four base lacks U.In general, except the 4th base, other position bases all lack C usually.These molecules can combine with those mRNA molecules with its complementary, sometimes even can be combined with specific DNA segment.The result of this combination is exactly the silence causing gene.This mode is the Critical policies that health regulatory gene is expressed.By inference, miRNA regulates the gene of one of trichotomy.The nucleotide sequence of ripe miRNA-2400 is: CCAGCACAGGCAGCUCGGACUGA, does not also have miRNA-2400 whether to have the relevant report promoting ox PECTORAL LIMB SKELETON proliferative biological function at present both at home and abroad.How to study miRNA-2400 to have and promote that the biological function of ox PECTORAL LIMB SKELETON propagation becomes a great problem being badly in need of solving? so, invention has the miRNA-2400 significantly promoting ox PECTORAL LIMB SKELETON proliferative biological function, and whether research miRNA-2400 has the biological function promoting ox PECTORAL LIMB SKELETON propagation is necessary.

Summary of the invention

Whether there is to study miRNA-2400 a difficult problem for the biological function promoting ox PECTORAL LIMB SKELETON propagation, the invention provides the miRNA-2400 having and significantly promote ox PECTORAL LIMB SKELETON proliferative biological function, the present invention carries out Isolation and culture to ox PECTORAL LIMB SKELETON, and adopt immunofluorescence staining to identify beef fat precursor cell, be divided in the process of adipocyte at the PECTORAL LIMB SKELETON of ox, stem ring fluorescence quantitative RT-RCR is adopted to detect the expression amount of miRNA-2400, structure can make the carrier for expression of eukaryon of miRNA-2400 process LAN, adopt the impact that EdU detection miRNA-2400 breeds PECTORAL LIMB SKELETON, result is: be divided in the process of adipocyte at the PECTORAL LIMB SKELETON of ox, along with the increase breaking up number of days and differentiation degree, the expression amount of miRNA-2400 obviously declines, after miRNA-2400 process LAN, the proliferation rate of PECTORAL LIMB SKELETON significantly improves, after miRNA-2400 process LAN, the gene C CND1 expression amount relevant to propagation obviously rises, result shows: miRNA-2400 is a kind of tiny RNA in conciliation adipocyte growth course with significantly promotion PECTORAL LIMB SKELETON proliferation function.

The technical solution adopted for the present invention to solve the technical problems is:

Have and significantly promote that the miRNA-2400 of ox PECTORAL LIMB SKELETON proliferative biological function is by carrying out Isolation and culture to ox PECTORAL LIMB SKELETON, adopt immunofluorescence staining qualification beef fat precursor cell, be divided in the process of adipocyte at the PECTORAL LIMB SKELETON of ox, adopt stem ring fluorescence quantitative RT-RCR to detect the expression amount of miRNA-2400, adopt the impact that EdU detection miRNA-2400 breeds PECTORAL LIMB SKELETON; Result is: be divided in the process of adipocyte at the PECTORAL LIMB SKELETON of ox, along with the increase breaking up number of days and differentiation degree, the expression amount of miRNA-2400 obviously declines, after miRNA-2400 process LAN, the proliferation rate of PECTORAL LIMB SKELETON significantly improves, after miRNA-2400 process LAN, the gene C CND1 expression amount relevant to propagation obviously rises; Result shows: miRNA-2400 is reconciling the effect having in adipocyte growth course and significantly promote PECTORAL LIMB SKELETON propagation.

The qualification result of described immunofluorescence staining qualification beef fat precursor cell: the dexamethasone that the Regular Insulin adopting 50 nmoles often to rise and 100 nmoles often rise, carry out the differentiation-inducing of Preadipocyte, after differentiation-inducing 7 days, under fluorescent microscope, observe the expression of PPAR γ and LPL in cell.Result shows, after PECTORAL LIMB SKELETON is divided into adipocyte, PPAR γ and LPL has positive expression signal at cell, thus prove this research separation and Culture for PECTORAL LIMB SKELETON, and there is the ability being divided into adipocyte.

Described is divided in the process of adipocyte at the PECTORAL LIMB SKELETON of ox, stem ring fluorescence quantitative RT-RCR is adopted to detect the expression amount of miRNA-2400, method is choose the PECTORAL LIMB SKELETON for logarithmic phase, carried out passage and cultivated operation, reach 12 porocyte culture plates, break up 4 days, 7 days, 10 days with Regular Insulin and induced by dexamethasone, collecting cell, detect miRNA-2400 expression amount.Experimental result: be divided in the process of adipocyte at the PECTORAL LIMB SKELETON of ox, along with the increase breaking up number of days and differentiation degree, the expression amount of miRNA-2400 obviously declines.Show that miRNA-2400 tool in conciliation adipocyte growth course has certain effect.

Described EdU detects the impact that miRNA-2400 breeds PECTORAL LIMB SKELETON: choose the PECTORAL LIMB SKELETON for logarithmic phase, carried out passage and cultivated operation, reach 24 orifice plates, after cell attachment, PEI method is adopted to carry out the transfection of PECTORAL LIMB SKELETON, pcDNA3.1 (+), pcDNA3.1 (+)-miRNA-2400 (over-express vector containing miRNA-2400), the inhibitor of miRNA-2400, after 48h, EdU detects its proliferative conditions.Adopt the method for fluorescence quantitative RT-RCR to detect relevant important gene CCND1 [the G1/S-specificity cyclin-D1 of propagation simultaneously, the protein of this genes encoding belongs to the cyclin family of high conservative, the notable feature of this family member runs through the cell cycle, and its protein abundance periodically sharply changes.Cyclin is as the regulatory factor of CDK (cyclin-dependent kinase).EdU result shows, after miRNA-2400 process LAN, the proliferation rate of PECTORAL LIMB SKELETON significantly improves, and proves that miRNA-2400 can significantly promote that PECTORAL LIMB SKELETON is bred.The fluorescence quantitative RT-RCR detected result of CCND1 expression amount shows: after miRNA-2400 process LAN, and the gene C CND1 expression amount relevant to propagation obviously rises.Demonstrate the propagation that miRNA-2400 can promote PECTORAL LIMB SKELETON.

Beneficial effect of the present invention is: miRNA-2400 is miRNA specific expressed in ox, its sequence signature is announced, but its biological function is unknown, this research finds that miRNA-2400 expression amount in the atomization of the PECTORAL LIMB SKELETON of ox declines, its propagation that can regulate and control adipocyte and differentiation are described, this research proves that miRNA-2400 can promote the propagation of PECTORAL LIMB SKELETON by experiment, it as the new miRNA of the sedimentation of fat in research bovinederived materials, can have certain meaning to the production reconciling livestock meat matter.

Accompanying drawing explanation

Below in conjunction with accompanying drawing, the present invention is further described.

Fig. 1 is the essential information figure of miR-2400 in miRBase database that miR-2400 promotes the research of ox PECTORAL LIMB SKELETON proliferative biological function.

Fig. 2 is the stem ring sequence information figure that miR-2400 promotes the miR-2400 of the research of ox PECTORAL LIMB SKELETON proliferative biological function.

Fig. 3 is the ripe miR-2400 sequence specifying information figure that miR-2400 promotes the research of ox PECTORAL LIMB SKELETON proliferative biological function.

Fig. 4 observes the expression figure of PPAR γ and LPL in cell (magnification 200 times) under miR-2400 promotes the fluorescent microscope of the research of ox PECTORAL LIMB SKELETON proliferative biological function.In figure, the expression of 1.PPAR γ in mature fat cell, the expression of 2.LPL in mature fat cell.

Fig. 5 is that miR-2400 promotes that the stem ring fluorescence quantitative RT-RCR of the research of ox PECTORAL LIMB SKELETON proliferative biological function detects the experimental result picture of the expression amount of miR-2400.In figure, I is control group, and II is miR-2400.

Fig. 6 is the EdU experimental result observation figure that miR-2400 promotes the research of ox PECTORAL LIMB SKELETON proliferative biological function.

Fig. 7 is the EdU experimental result picture that miR-2400 promotes the research of ox PECTORAL LIMB SKELETON proliferative biological function.

Fig. 8 is the fluorescence quantitative RT-RCR detected result figure that miR-2400 promotes the CCND1 expression amount of the research of ox PECTORAL LIMB SKELETON proliferative biological function.In figure, I: blank, II:pcDNA3.1 (+), III:pcDNA3.1 (+)-miR-2400.

Embodiment

In the context of the present specification, unless specifically stated otherwise otherwise this specification sheets any term used has the implication that those skilled in the art understand in the art usually, and the experimental technique of unreceipted detailed conditions is conveniently test method or carry out according to the process specifications that supplier advises.

Embodiment one

1. the concrete steps of the Isolation and culture of ox PECTORAL LIMB SKELETON: (1) get 5-10 gram of new calves subcutaneus adipose tissue, tissue is cut into rotten shape (about 1 cubic millimeter of size) after rinsing by PBS phosphate buffered saline buffer, PBS phosphate buffered saline buffer is blown and beaten repeatedly, leaves standstill 1 minute.Sucking-off floating tissue, centrifugal 10 minutes, obtains the rotten throw out of flesh by 1000 revs/min.(2) to organizing in throw out the type i collagen enzyme adding 50 milliliter 0.2%, jog (about 100 revs/min) digestion 1 hour in 37 DEG C of shaking baths.Backward Digestive system in add 40 milliliters PBS phosphate buffered saline buffer type i collagen enzymic digestion liquid is diluted, blow even rear immigration centrifuge tube, 1000 revs/min, centrifugal 10 minutes, thus eliminate type i collagen enzymic digestion liquid, obtain the mixture containing Preadipocyte.(3) with PBS phosphate buffered saline buffer, the mixture that the 5th step obtains is carried out piping and druming resuspended.Re-suspension liquid 400 order copper mesh filter, and collect filtrate and move in centrifuge tube, 1000 revs/min, centrifugal 10 minutes, obtaining the precipitation of Preadipocyte.(4) discard the supernatant liquor in centrifuge tube, cell precipitation is blown and beaten gently with Preadipocyte grown cultures liquid (foetal calf serum: the volume ratio of commercialization cell culture fluid DMEM is 2:8), and moved into Tissue Culture Flask (through the Tissue Culture Flask of L-poly-lysine process, treatment process is take concentration as the poly-lysine of 20-30 micrograms per millilitre, add culture plate or culturing bottle and bottom uniform fold bottle, be placed in aseptic operating platform and spend the night, use front distilled water to rinse three times and get final product inoculating cell).(5) Tissue Culture Flask is placed in 37 DEG C, 5%CO ₂cultivate in the cell culture incubator of concentration, after 3-5 days, Preadipocyte is adherent bottom Tissue Culture Flask, subsequently Growth of Cells and propagation, when the degree of converging of cell reaches 90%, carries out the Secondary Culture of cell.(6) when the Preadipocyte that (5) walk separation and Culture is in logarithmic phase, by cell with 2 × 10 ⁴the density of individual every milliliter is passaged to 24 porocyte culture plates, 12 hours after cell attachment, Regular Insulin that 50 nmoles often rise and the dexamethasone that 100 nmoles often rise is added in cell culture well, carry out the differentiation-inducing of Preadipocyte, after differentiation-inducing 7 days, Adipocyte Differentiation is ripe adipocyte.Fig. 1 is after adopting the method for immunofluorescence dyeing qualification PECTORAL LIMB SKELETON to be divided into mature fat cell, the expression of PPAR γ and LPL in cell.

2. the concrete grammar of the immunofluorescence dyeing of the qualification of beef fat precursor cell: (1) exhaust the Growth of Cells nutrient solution in 24 porocyte culture plates, clean 2 times with PBS phosphate buffered saline buffer.(2) under-20 DEG C of conditions, in 24 cell culture well, add the methyl alcohol (analytical pure) of 1 milliliter, act on 20 minutes, cell is fixed.(3) remove methyl alcohol, add 1 milliliter of PBS phosphate buffered saline buffer and rinse cell, and remove PBS phosphate buffered saline buffer.(4) with containing 5% bovine serum albumin (bovine serum albumin, BSA) and 0.2% triton x-100 (TritonX-100, it act as destruction cytolemma, and exogenous antibodies molecule is entered in cell) PBS phosphate buffered saline buffer incubated cell 1 hour.(5) remove the Incubating Solution of the 4th step, with the rare antibody molecule diluting PPAR γ and LPL respectively of PBS phosphate buffered saline buffer.The volume ratio of PBS phosphate buffered saline buffer and antibody molecule is 100:1.Antibody molecule after dilution is added in cell culture well, is covered in cell surface.1 hour is hatched at 37 DEG C.(6) suck the antibody molecule of cell surface with filter paper, then in every porocyte, put into 1 milliliter of PBS phosphate buffered saline buffer, jiggle (carrying out on shaking table) Tissue Culture Plate 5 minutes, to clean cell surface, remove the slow middle liquid of PBS phosphoric acid salt afterwards.This cleaning step carries out three times continuously.(7) remove PBS phosphate buffered saline buffer, fluorescein isothiocyanate (FITC is added respectively in each cell hole, Fluorescein Isothioc2400ate) immunoglobulin molecules that marks, its effect is that this molecule can be combined with the antibody molecule of PPAR γ or LPL, thus under the exciting of fluorescent microscope, make PPAR γ or LPL present green fluorescence in cell.(8) the immunoglobulin molecules of the marked by fluorescein isothiocyanate of cell surface is sucked with filter paper, then in every porocyte, 1 milliliter of PBS phosphate buffered saline buffer is put into, jiggle (carrying out on shaking table) Tissue Culture Plate 5 minutes, to clean cell surface, remove the slow middle liquid of PBS phosphoric acid salt afterwards.This cleaning step carries out three times continuously.(9) add the nuclear fluorescence dye DAPI (4,6-diamino-2-phenyl indole) of 300 microlitres to every hole, incubated cell 3 minutes.(10) remove DAPI, then in every porocyte, put into 1 milliliter of PBS phosphate buffered saline buffer, jiggle (carrying out on shaking table) Tissue Culture Plate 5 minutes, to clean cell surface, remove the slow middle liquid of PBS phosphoric acid salt afterwards.This cleaning step carries out three times continuously.(11) remove PBS phosphate buffered saline buffer, add anti-quenching of fluorescence mountant to cell surface, it does to be the fluorescence intensity keeping cell sample, makes it can carry out Fluirescence observation for more time.(12) cell sample is placed under causing fluorescent microscope and carries out observing and taking pictures.

The qualification result of beef fat precursor cell: the dexamethasone that the Regular Insulin adopting 50 nmoles often to rise and 100 nmoles often rise, carry out the differentiation-inducing of Preadipocyte, after differentiation-inducing 7 days, under fluorescent microscope, observe the expression of PPAR γ and LPL in cell.As shown in figure (Fig. 1) (magnification 200 times).Result shows, after PECTORAL LIMB SKELETON is divided into adipocyte, PPAR γ and LPL has positive expression signal at cell, thus prove this research separation and Culture for PECTORAL LIMB SKELETON, and there is the ability being divided into adipocyte.

3. the PECTORAL LIMB SKELETON of ox is divided in the process of adipocyte, adopts stem ring fluorescence quantitative RT-RCR to detect the expression amount of miRNA-2400

Choose the PECTORAL LIMB SKELETON for logarithmic phase, carried out passage and cultivate operation, reach 12 orifice plates, break up 4 days, 7 days, 10 days with Regular Insulin and induced by dexamethasone, collecting cell, detect miRNA-2400 expression amount.

Stem ring fluorescence quantitative RT-PCR detecting method concrete steps are as follows:

1. RNA extraction step: 1) discard the old nutrient solution cultivated and produce, with PBS phosphate wash cell surface 2-3 time of precooling.2) the 6 every holes of porocyte culture plate add 1 milliliter of Trizol reagent (RNA extracts reagent), with the light cell scraping culture plate of rifle head with collecting cell.3) add the chloroform of 0.2mL precooling, leave standstill 10min on ice, 4 DEG C 12000 rpms centrifugal 10 minutes.4), in the EP pipe after careful Aspirate supernatant to new DEPC process, 500 μ microliters isopropanol are added.Put upside down mixing and leave standstill 10 minutes on ice.4 DEG C 12000 rpms centrifugal 5 minutes.5) abandon supernatant, 75% ethanol purge RNA precipitates, and 10000 rpms centrifugal 5 minutes, and room temperature volatilization ethanol precipitates with dry RNA.6) according to precipitation number, add the DEPC water that 20-50 microlitre is preheated to 65 DEG C and dissolved.Measure OD260 and OD280 numerical value, with checking R NA purity and concentration; Agarose gel electrophoresis identifies its degraded situation, and gel imaging instrument record electrophoresis result ,-80 DEG C of preservations are continued to employ.

2. transcriptive process,reversed: the RNA of extraction and Reverse Transcription are all as thawing on ice, operate according to reverse transcription specification sheets after thawing, its reaction system is in table 1, and the cDNA (product of RNA reverse transcription) obtained carries out real-time quantitative PCR according to the reaction system of table 2.

Table 1 reverse transcription system

Reverse transcription reaction condition is as follows: 65 DEG C of 5 minutes chillings on ice.In above-mentioned PCR pipe, continue to add reagent shown in table 2.

The reagent that table 2 reverse transcription reaction condition adds

Reverse transcription reaction condition is as follows: 50 DEG C, 50 minutes, 70 DEG C, 10 minutes, and cooled on ice, obtains cDNA.

3. PCR reaction system and step: 2. walk the cDNA of acquisition for touching plate with the, adopts the method for fluorescence dye SYBR Green I, uses ABI 7300 quantitative real time PCR Instrument to carry out the detection of real-time quantitative PCR.Reaction system is as shown in table 3.Simultaneously with β-actin gene for reference gene, application ABI 7300 System analyzes last pcr amplification experimental data.

Table 3 PCR reaction system

Reaction conditions: two-step approach pcr amplification standard program:

Stage1: denaturation stage Reps:1 95 DEG C 30 seconds

Stage2: step of reaction Reps:40 95 DEG C 5 seconds, 60 DEG C 31 seconds

4. stem ring fluorescence quantitative RT-RCR detects the experimental result of the expression amount of miRNA-2400: experimental result as shown in Figure 2, be divided in the process of adipocyte at the PECTORAL LIMB SKELETON of ox, along with the increase breaking up number of days and differentiation degree, the expression amount of miRNA-2400 obviously declines.Show that miRNA-2400 tool in conciliation adipocyte growth course has certain effect.(control group in figure carries out the expression amount of miRNA-2400 in the PECTORAL LIMB SKELETON processed for not adding Regular Insulin and dexamethasone).

4.EdU detects the impact that miRNA-2400 breeds PECTORAL LIMB SKELETON

EdU is a kind of thymidine analog, and its alkyne groups be connected with is rarely found in natural compounds, thymus pyrimidine (T) can be replaced to infiltrate in the DNA molecular synthesized period at DNA replication dna, by based on the specific reaction of fluorescence dye and EdU directly also can detect that DNA replication dna is active exactly, be widely used in the research of the aspects such as cell proliferation, cytodifferentiation, growth and growth, DNA repair, virus replication, (is above word from Rui Bo biotech firm website http://www.ribobio.com/sitecn/product.aspx to be especially applicable to carrying out the cell proliferation screening experiment of siRNA, miRNA, micromolecular compound and medicine? id=92).

The impact that this research adopts EdU detection miRNA-2400 to breed PECTORAL LIMB SKELETON: choose the PECTORAL LIMB SKELETON for logarithmic phase, carried out passage and cultivated operation, reach 24 orifice plates, after cell attachment, PEI method is adopted to carry out the transfection of PECTORAL LIMB SKELETON, pcDNA3.1 (+), pcDNA3.1 (+)-miRNA-2400 (over-express vector containing miRNA-2400), the inhibitor of miRNA-2400, after 48 hours, EdU detects its proliferative conditions.Adopt the method for fluorescence quantitative RT-RCR to detect relevant important gene CCND1 [the G1/S-specificity cyclin-D1 of propagation simultaneously, the protein of this genes encoding belongs to the cyclin family of high conservative, the notable feature of this family member runs through the cell cycle, and its protein abundance periodically sharply changes.Cyclin is as the regulatory factor of CDK (cyclin-dependent kinase).Different cyclins shows separately unique expression and degradation characteristic, and this contributes to each mitotic division event Harmony in time, is more than selected from wikipedia] expression change.(noting: the cell that this step adopts is the PECTORAL LIMB SKELETON of the ox of vitro culture, makes it remain differentiation state and be in the vegetative state of cell all the time).

1. PEI method carries out the step of cell transfecting: 1) with not being seeded to by bovine muscle satellite cell in 24 porocyte culture plates containing dual anti-growth medium, when cell confluency is about 70%, carry out transfection.2) test is divided into 1 experimental group and 1 control group, often organizes three holes, i.e. three revision tests.1 g plasmid and 2 microlitre PEI are added in experimental group and the every hole of control group.3) get 4 aseptic 1.5 milliliters of EP pipes, often pipe adds each 75 microlitres of Opti-MEM Incubating Solution.Respectively getting 3 μ g plasmids adds in the EP pipe containing Incubating Solution, and 2 pipes in addition add 6 microlitre PEI respectively.Stationary incubation 5 minutes.4) by the 75 microlitre Incubating Solutions containing PEI and the 75 μ l Incubating Solution Homogeneous phase mixing containing plasmid, pressure-vaccum mixing (30 ~ 50 times) room temperature stationary incubation 15 minutes afterwards gently), the old substratum of the cell surface in 6 orifice plates is removed during stationary incubation, with serum-free without dual anti-DMEM substratum cleaning cell twice, experimental group and the every Kong Jun of control group add 450 microlitres serum-free without dual anti-substratum.After hatching end, the above-mentioned Opti-MEM Incubating Solution containing PEI and plasmid composite is dropped in each group of hole, every hole 50 microlitre, gently shake mixing.6) in 37 DEG C, cultivate the nutrient solution changing PECTORAL LIMB SKELETON growth after 4 hours in 5%CO2 cell culture incubator and continue to cultivate and the detection carrying out cell proliferative conditions.

2. the fluorescence quantitative RT-RCR carrying out EdU and CCND1 after cell transfecting detects: (1) EdU step: 1) EdU mark: with the dilution proportion EdU solution (reagent A) of cell culture medium by 5000:1, prepare appropriate 10 μMs of EdU substratum; It is that 10 micromoles often rise EdU nutrient solution night incubation that every hole adds 500 lli, abandons substratum; PBS cleans cell 1 ~ 2 time, each 5 minutes.2) cell fixation: every hole adds 250 microlitres of cells stationary liquids (namely containing the PBS of 4% paraformaldehyde) incubated at room 30 minutes; Every hole adds the glycine solution of 250 microlitre 2 milligrams every milliliter, and decolorization swinging table abandons glycine solution after hatching 5 minutes; Every hole adds 250 microlitre PBS, and decolorization swinging table cleans 5 minutes, abandons PBS; Every hole adds 250 microlitre permeate agents (PBS of 0.5%TritonX-100) decolorization swinging table and hatches 10 minutes, and PBS cleans 1 time, 5 minutes.3) Apollo dyeing: every hole adds 250 microlitres staining reaction liquid, lucifuge, room temperature, decolorization swinging table hatches 30 minutes, abandons staining reaction liquid; Add 250 microlitre permeate agents (PBS of 0.5%TritonX-100) decolorization swinging table cleaning 2 ~ 3 times, each 10 minutes, abandon permeate agent; Every hole adds 250 μ L washed with methanol 1 ~ 2 time at every turn, and each 5 minutes, PBS cleaned 1 time, each 5 minutes.4) DNA dyeing: the dilution proportion reagent F pressing 100:1 with deionized water, prepares appropriate 1 × Hoechst33342 reaction solution, keeps in Dark Place; Every hole adds 250 microlitre 1 × Hoechst33342 reaction solutions, lucifuge, and room temperature, after decolorization swinging table hatches 30 minutes, abandons staining reaction liquid; Every hole adds 250 microlitre PBS at every turn and cleans 1 ~ 3 time.5) Image Acquisition and analysis: namely observe after having dyeed.(if condition limits, and lucifuge 4 DEG C of moistening preservations are to be measured, but not should exceed 3 days).EdU experimental result: EdU result shows (Fig. 3 and Fig. 4), after miRNA-2400 process LAN, the proliferation rate of PECTORAL LIMB SKELETON significantly improves, and proves that miRNA-2400 can significantly promote that PECTORAL LIMB SKELETON is bred.(2) the fluorescence quantitative RT-RCR of CCND1 expression amount detects: the method that fluorescence quantitative RT-RCR detects CCND1 expression amount is identical with the method above about stem ring fluorescence quantitative RT-RCR detection miRNA-2400.The fluorescence quantitative RT-RCR detected result (Fig. 5) of CCND1 expression amount shows: after miRNA-2400 process LAN, and the gene C CND1 expression amount relevant to propagation obviously rises.Demonstrate the propagation that miRNA-2400 can promote PECTORAL LIMB SKELETON.

More than show and describe ultimate principle of the present invention and principal character and advantage of the present invention.The technician of the industry should be appreciated that; the present invention is not restricted to the described embodiments; what describe in above-described embodiment and specification sheets just illustrates principle of the present invention; without departing from the spirit and scope of the present invention; the present invention also has various changes and modifications; these changes and improvements all fall in the claimed scope of the invention, and application claims protection domain is defined by its equivalent of appending claims.

Claims (1)

1. there is the miRNA-2400 significantly promoting ox PECTORAL LIMB SKELETON proliferative biological function, by carrying out Isolation and culture to ox PECTORAL LIMB SKELETON, adopt immunofluorescence staining qualification beef fat precursor cell, be divided in the process of adipocyte at the PECTORAL LIMB SKELETON of ox, adopt stem ring fluorescence quantitative RT-RCR to detect the expression amount of miRNA-2400, adopt the impact that EdU detection miRNA-2400 breeds PECTORAL LIMB SKELETON; It is characterized in that: be divided in the process of adipocyte at the PECTORAL LIMB SKELETON of ox, along with the increase breaking up number of days and differentiation degree, the expression amount of miRNA-2400 obviously declines, after miRNA-2400 process LAN, the proliferation rate of PECTORAL LIMB SKELETON significantly improves, after miRNA-2400 process LAN, the gene C CND1 expression amount relevant to propagation obviously rises; Result shows: miRNA-2400 is a kind of tiny RNA in conciliation adipocyte growth course with significantly promotion PECTORAL LIMB SKELETON proliferation function.