CN114686506A - Method for accurately and quantitatively regulating and controlling extracellular secretion level of escherichia coli recombinant protein and application - Google Patents

Abstract

The invention discloses a method for accurately and quantitatively regulating and controlling an extracellular secretion level of a recombinant protein of escherichia coli and application thereof, belonging to the field of genetic engineering and fermentation engineering. The tryptophan operon and temperature sensitive repression system (TAT) coexpression system constructed in the invention can realize stable and normal growth of escherichia coli in the early growth stage, and regulate the expression level of structural genes by controlling the fermentation temperature so as to achieve the effects of regulating and controlling the real-time expression quantity of D, D-carboxypeptidase and effectively promoting the extracellular secretion of recombinant protein. The co-expression system constructed by the invention can improve the permeability of the recombinant escherichia coli outer membrane, improves the extracellular secretion level of the recombinant protein, and has important guiding significance for the efficient secretion and production of the recombinant protein in escherichia coli.

Description

Method for accurately and quantitatively regulating and controlling extracellular secretion level of escherichia coli recombinant protein and application

Technical Field

The invention relates to a method for accurately and quantitatively regulating and controlling the extracellular secretion level of recombinant proteins of escherichia coli and application thereof, belonging to the field of genetic engineering and fermentation engineering.

Background

The colibacillus expression system is the most common recombinant protein expression system in the current genetic engineering and has the characteristics of clear genetic background, high expression level of target genes, short culture period, strong pollution resistance and the like. Coli plays an important role in gene expression technology and is an important tool in molecular biology research and the development process of biotechnology industrialization. Is one of the commonly used hosts for high-efficiency production of recombinant proteins, but in the heterologous expression of Escherichia coli, most of the recombinant proteins are secreted into periplasm space under the guidance of a signal peptide, so that a large amount of intermediates are accumulated, and the production of the proteins is hindered.

The peptidoglycan is a multi-layer reticular macromolecular structure formed by polymerizing a disaccharide unit, a tetrapeptide tail and a peptide bridge. The backbone of the peptidoglycan layer is formed by connecting N-acetylglucosamine and N-acetylmuramic acid through beta-1, 4 glycosidic bonds, and the sugar chains are cross-linked by peptide chains to form a stable network structure, thus forming the cell wall on the whole bacterial surface. As a major component of cell walls, the composition of peptidoglycan is closely related to the integrity of cell structure, the maintenance of permeability of outer membrane, desiccation resistance and heat resistance of bacteria, and the like. CN105755029A discloses a method for improving the extracellular secretion level of recombinant proteins of Escherichia coli based on dacA, but D, D-carboxypeptidase itself has the disadvantage of toxicity to bacteria. Therefore, the method provides a method which can solve the problem and has important value for further research on improving the extracellular secretion of the recombinant protein.

Disclosure of Invention

The invention provides a recombinant plasmid, which contains a first promoter, a second promoter, a tryptophan synthetase gene cluster trpeDCBA, an operation region trpO and a D, D-carboxypeptidase gene dacA; the manipulation region trpO has a binding site capable of binding to a covalent dimer formed by the repressor trpR and tryptophan; the first promoter regulates and controls the expression of trpeDCBA; the second promoter regulates the gene expression of the control region trpO; the downstream of the manipulation region trpO is connected with a D, D-carboxypeptidase gene dacA; the first promoter and the second promoter are opposite in transcription direction.

In one embodiment, the first promoter is the T7 promoter and has the nucleotide sequence shown in SEQ ID No. 6.

In one embodiment, the second promoter is a promoter having a strong ability to initiate transcription in stationary phase, and the nucleotide sequence is as shown in any one of SEQ ID NO. 7-11.

The invention also provides a tryptophan operation subsystem, comprising the Escherichia coli cell with the tryptophan synthetase gene cluster trpEDCBA knocked out and the recombinant plasmid.

The invention also provides a recombinant plasmid co-expressed by the tryptophan operon and the temperature-sensitive repression system, which contains an SPP type promoter and a low-temperature inducible promoter P_RHigh temperature inducible promoter P_LTryptophan synthetase gene cluster trpeDCBA, control region trpO, D-carboxypeptidase gene dacA and temperature sensitive repressor CI ^ts857; the manipulation region trpO has a binding site capable of binding to a covalent dimer formed by the repressor trpR and tryptophan; the promoter P_LHaving a temperature sensitive repressor CI ^ts857; the promoter P_LRegulating and controlling the expression of trpeDCBA; the promoter P_RRegulation of temperature sensitive repressor CI ^ts857 expression; the SPP type promoter regulates and controls the gene expression of an operation region trpO; the downstream of the operator region trpO has a dacA gene; the promoter P_LAnd promoter P_RThe direction of transcription of (a) is opposite.

In one embodiment, the promoter P_LThe nucleotide sequence of (A) is shown as SEQ ID No. 4; promoter P_RThe nucleotide sequence of (A) is shown as SEQ ID No. 13; the nucleotide sequence of the promoter SPP is shown in any one of SEQ ID No. 7-11; the nucleotide sequence of the manipulation region trpO is shown as SEQ ID No. 3; encoding the temperature-sensitive repressor CI ^ts857 is shown in SEQ ID NO.5, and the D, D-carboxypeptidase gene dacA is shown in SEQ ID NO. 14.

In one embodiment, the dacA gene further comprises a trpL base sequence upstream thereof; the base sequence of the trpL is shown in SEQ ID NO. 2.

The invention also provides recombinant escherichia coli capable of regulating and controlling the extracellular secretion level of the recombinant protein in escherichia coli, the recombinant escherichia coli contains a recombinant plasmid co-expressed by the tryptophan operon and a temperature-sensitive repression system, and a tryptophan synthase gene cluster trpeDCBA is knocked out on a genome.

In one embodiment, the escherichia coli may be selected from: any one of e.coli BL21, e.coli jm109, e.coli DH5 α, e.coli Rosetta, e.coli TOP10, e.coli m110, e.coli s 110.

The invention also provides a construction method of the recombinant escherichia coli, which comprises the steps of constructing the co-expressed recombinant plasmid and knocking out a gene cluster trpeddcba of an escherichia coli genome.

In one embodiment, the method for knocking out trpeddba comprises the following steps:

(1) designing and synthesizing a knockout frame containing the kana resistance gene and upstream and downstream homologous arms of a tryptophan synthetase gene cluster trpeDCBA: upstream homology arm-kanamycin resistance gene-downstream homology arm;

(2) and (2) electrically transforming the knockout frame constructed in the step (1) into an escherichia coli electrically-transformed competent cell containing a plasmid vector, screening out the escherichia coli with gene integration after homologous recombination, and eliminating the kana resistance (kan) gene.

The invention also provides a method for producing the target protein, which is to express the target gene in the recombinant Escherichia coli.

In one embodiment, the protein of interest includes, but is not limited to, amylase (Amyk), Green Fluorescent Protein (GFP), collagen, fructosyltransferase, methyl parathion hydrolase, catalase, glucose oxidase, and the like.

In one embodiment, the gene encoding the protein of interest is linked to a plasmid or integrated into the genome of recombinant E.coli.

The invention also provides a method for regulating and controlling the secretion of the recombinant protein of the escherichia coli, which comprises the following steps of fermenting the escherichia coli under the following conditions: carrying out shake culture on escherichia coli at 37 ℃ and 200bpm in the first 12h, inhibiting the expression of the DacA protein and promoting the accumulation of the recombinant protein in cells; after 12h, the temperature is controlled to be 30 ℃, and the shaking culture is carried out at 200bpm, so as to promote the expression of the DacA protein and promote the extracellular secretion of the intracellular recombinant protein.

The invention also provides the application of the recombinant plasmid or the recombinant Escherichia coli in the fields of food and biology.

In one embodiment, the application includes, but is not limited to, fermentative production of a protein of interest.

In one embodiment, the protein of interest includes, but is not limited to, amylase (Amyk), green fluorescent egg (GFP), collagen, fructosyltransferase, methyl parathion hydrolase, catalase, glucose oxidase, and the like.

Has the advantages that:

(1) the tryptophan operon and temperature sensitive repression system (TAT) coexpression system constructed in the invention can realize stable and normal growth of escherichia coli in the early growth stage and promote protein expression in the stable stage; the system also regulates the expression level of structural genes and regulates the real-time expression quantity of D, D-carboxypeptidase by controlling the fermentation temperature, increases intracellular soluble peptidoglycan, improves the permeability of the outer membrane of the recombinant escherichia coli, and more effectively promotes the extracellular secretion of recombinant proteins;

(2) the invention also adds trpL base sequence at the N-terminal of DacA, effectively solves the disadvantage of D, D-carboxypeptidase self toxicity to thallus, optimizes the application effect of tryptophan operon combined with temperature-sensitive repression system co-expression system in colon bacillus, and has important guiding significance for the efficient secretion and production of recombinant protein in colon bacillus.

Drawings

FIG. 1 is a colony PCR-verified plot of the gene-edited BL21(DE3) strain. M: 10000bp DNA Marker.

FIG. 2 shows selection and characterization of stationary phase promoters; a, a schematic expression diagram of a stationary phase promoter plasmid; b, the fermentation condition of a promoter in a stable period; c, stationary phase promoter growth curve chart.

FIG. 3 shows the construction and application effects of the tryptophan operon repression system; a, E.coli BL21(DE3) obtains an E.coli G2 strain from a tryptophan synthase gene cluster trpeDCBA by a lambda-Red homologous recombination technology, and constructs a tryptophan operon on the basis; b, constructing a tryptophan operon repression system carrying a fluorescent protein gene, and c, constructing a tryptophan operon repression system carrying a dacA gene; SPP, stationary phase promoter; trpO, tryptophan operon; t7, constitutive promoter; trpEDCBA, tryptophan synthase gene cluster; egfp, enhanced green fluorescent protein; dacA, D, D-carboxypeptidase; and d, constructing a tryptophan operon repression system in the E.coli G2 to obtain E.coli G21, and respectively supplementing high-concentration 3G/L trp and 5G/L trp through exogenous sources to explore the influence of the tryptophan concentration on the egfp expression level.

FIG. 4 shows the construction and application effects of the temperature-sensitive repression system; the construction of a temperature-sensitive repression system realizes the expression of accumulated tryptophan synthase at the early stage of bacterial growth by regulating and controlling the fermentation temperature.

FIG. 5 shows the effect of different promoters at different temperatures on the regulatory protein of the tryptophan temperature sensitive repressor system; a: the inhibition strength of TAT system to eGFP under different temperatures; b: the influence of parent tryptophan on TAT at different temperatures is researched; c: TrpL is added into a TAT system, and DacA is stably expressed. Coli G6, without trpL element E. coli G11, with trpL element added; d, e: promoter P_T7Or P_LAnd (3) regulating and controlling the trpeDCBA capability.

FIG. 6 is a graph of the effect of TAT system dynamically modulating DacA on cell morphology; a: coli M037 ℃ fermentation culture corresponding transmission electron microscopy analysis chart; b: coli M030 ℃ fermentation culture corresponding transmission electron microscope analysis chart; c: coli M737 ℃ fermentation culture corresponds to a transmission electron microscope analysis chart; d: coli M730 ℃ fermentation culture corresponds to a transmission electron microscopy analysis chart.

FIG. 7 is a graph of the effect of dynamic modulation of DacA by the TAT system on extracellular secretion of green fluorescent protein; a, the extracellular secretion of green fluorescent protein of different strains; b, the proportion of the extracellular green fluorescent protein of different strains.

FIG. 8 is a diagram showing the effect of dynamic regulation of DacA by the TAT system on the extracellular secretion expression of amylase, a, extracellular amylase activity; b, the activity of extracellular amylase accounts for the specific condition.

Detailed Description

1) Bacterial strains

Coli G0: coli BL21(DE3) contains plasmid pKD 46.

Coli G1: coli BL21(DE3) integrated the Kan gene fragment.

Coli G2: the gene cluster trpeddab is knocked out on the basis of E.coli BL21(DE 3).

Coli M6: coli G2, plasmid pETDuet-1-P_L-. DELTA.lacI-egfp and pRSFDuet-1-. DELTA.lacI-P₂₅-trpO-dacA-Ci^ts857-P_R-P_L-trpEDCBA。

Coli M7: coli G2, plasmid pETDuet-1-P_L-. DELTA.lacI-egfp and pRSFDuet-1-. DELTA.lacI-P₄₁-trpO-dacA-Ci^ts857-P_R-P_L-trpEDCBA。

Coli M8: coli G2 containing plasmid pRSFDuet-1-DeltalacI-P₅₃-trpO-dacA-Ci^ts857-P_R-P_LtrpeDCBA and pETDuet-1-PL- Δ lacI-egfp.

Coli M9: coli G2 containing plasmid pRSFDuet-1-DeltalacI-P₆₉-trpO-dacA-Ci^ts857-P_R-P_LtrpeDCBA and pETDuet-1-PL- Δ lacI-egfp.

Coli M10: coli G2 containing plasmid pRSFDuet-1-DeltalacI-P₈₄-trpO-dacA-Ci^ts857-P_R-P_L-trpeDCBA and pETDuet-1-PL-△lacI-egfp。

Coli M11: coli G2 containing plasmid pRSFDuet-1-DeltalacI-P₂₅-trpO-dacA-Ci^ts857-P_R-P_LtrpeDCBA and pETDuet-1-PL- Δ lacI-Amyk.

Coli M12: coli G2 containing plasmid pRSFDuet-1-DeltalacI-P₄₁-trpO-dacA-Ci^ts857-P_R-P_LtrpeDCBA and pETDuet-1-PL- Δ lacI-Amyk.

Coli M13: coli G2 containing plasmid pRSFDuet-1-DeltalacI-P₅₃-trpO-dacA-Ci^ts857-P_R-P_LtrpeDCBA and pETDuet-1-PL- Δ lacI-Amyk.

Coli M14: coli G2 containing plasmid pRSFDuet-1-DeltalacI-P₆₉-trpO-dacA-Ci^ts857-P_R-P_L-trpeDCBA and pETDuet-1-PL- Δ lacI-Amyk.

Coli M15: coli G2 containing plasmid pRSFDuet-1-DeltalacI-P₈₄-trpO-dacA-Ci^ts857-P_R-P_LtrpeDCBA and pETDuet-1-PL- Δ lacI-Amyk.

Coli G20: coli BL21(DE3) contains plasmid pRSFDuet-1- Δ lacI-P₅₃-trpO-egfp-P_T7-trpEDCBA。

Coli G21: coli G2 contains plasmid pRSFDuet-1- Δ lacI-P₅₃-trpO-egfp-P_T7-trpEDCBA。

Coli G22: coli G2 contains plasmid pRSFDuet-1- Δ lacI-P₅₃-trpO-egfp-CI^ts857-P_R-P_L-trpEDCBA。

Coli G23: coli BL21(DE3) contains plasmid pRSFDuet-1- Δ lacI-P₅₃-trpO-egfp-CI^ts857-P_R-P_L-trpEDCBA。

2) Culture medium

LB solid medium: 15g/L agar, 10g/L tryptone, 5g/L yeast extract powder, 10g/L NaCl, pH 7.0.

LB liquid medium: 10g/L tryptone, 5g/L yeast extract powder, 10g/L NaCl, pH 7.0.

TB liquid medium: 12g/L tryptone, 24g yeast extract powder, 4mL glycerol, 2.31g KH₂PO₄，12.54g K₂HPO₄pH 7.5, constant volume to 1L.

5хM9(200mL):Na₂PO₄·7H₂O 12.8g，KH₂PO₄ 3.0g，NaC1 0.5g，NH4Cl 1.0g。

Fermentation medium (1L): 200mL 5x M9 Medium, 2mL MgSO₄Solution (1 mol. L)^-1)、0.1mLCaC₂Bath liquid (1 mol. L)^-1) 20mL of 20% glucose solution, 1mL of thiamine solution (1 g. L)^-1) 1ml of biotin solution (1 g. L)^-1)。

3) Culture method

Seed culture: and (3) inoculating the single colony obtained by streaking the plate into an LB liquid culture medium, culturing at the rotating speed of 200r/min, and performing shaking culture at the constant temperature of 37 ℃ for 8 hours.

Fermentation culture: coli in LB medium at 37 ℃ for 8h, then inoculated into TB medium at an inoculum size of 1% (v/v), cultured at 37 ℃ to OD₆₀₀Expression was induced at 25 ℃ after 0.8 rpm. The working concentrations of ampicillin and chloramphenicol are both 50 mug.mL^-1Kanamycin working concentration was 25. mu.g.mL^-1。

4) Analytical method

Biomass determination: the absorbance at 600nm was measured.

And (3) amylase activity determination: one enzyme activity unit (U) of amylase is defined: the amount of enzyme required to hydrolyze starch at pH 9.5 and 50 ℃ to release 1. mu. mol of reducing sugars (glucose) per minute. The reducing sugars produced during hydrolysis of soluble starch were determined using a modified dinitrosalicylic acid (DNS) method.

Green fluorescent protein fluorescence assay: the bacterial solution was cultured at 4 ℃ and 1X 10⁴Centrifuging at x g for 10min, separating supernatant from cells, and subjecting the cells to centrifugation at 10 mmol.L^-1Resuspending in PBS phosphate buffer pH 7.4 and determining its OD_{600 nm}(ii) a The fluorescence intensity of GFP in the supernatant was measured using a microplate reader and 96-well plates. 10 mmol. L^-1Fluorescence value of pH 7.4PBS as blank pairAnd (6) irradiating. Excitation and emission wavelengths were 488nm and 533nm, respectively.

In the following examples of the present invention, the nucleotide sequence encoding trpeDCBA sequence is shown in SEQ ID NO. 1.

Example 1 knock-out of Tryptophan synthase Gene cluster trpeDCBA in recombinant E.coli

(1) And (3) designing a primer by taking the plasmid pKD13 as a template, and carrying out PCR amplification on a homologous fragment containing a Kan resistance gene and used for replacing a trpeDCAB sequence, wherein FRT sites are contained on two sides of the Kan resistance gene, so as to obtain a trpeDCBA sequence integration frame fragment.

(2) Transforming the pKD46 plasmid into E.coli BL21(DE3) competent cells to obtain an E.coli G0 strain, preparing the electrotransformation competent cells, electrotransforming the integration frame fragment prepared in the step (1) into the E.coli G0 competent cells, coating an LB solid culture medium containing kanamycin (Kan) and ampicillin after post-culture of a transformation solution for culture to obtain a transformant BL21, verifying whether a trpeDCBA sequence is successfully edited by colony PCR amplification by using primers TrpA-pKD13-FW and TrpE-pKD13-RW, and screening out a positive transformant E.coli G1 containing a kanamycin resistance gene. Theoretically, BL21:: kan contained 1680bp of homologous fragment, and as shown in FIG. 1, the size of the fragment obtained by colony PCR coincided with the size of the theoretically homologous fragment.

TrpA-pKD13-FW：TGCCGCCAGCGGAACTGGCGGCTGTGGGATTAACTGCGCGTCGCCGCTTTGTGTAGGCTGGAGCTGCTTC；

TrpE-pKD13-RW：CCCGCCTAATGAGCGGGCTTTTTTTTGAACAAAATTAGAGAATAACAATGATTCCGGGGATCCGTCGACC。

(3) Inoculating the E.coli G1 constructed in the step (2) to an nonresistant LB medium for culture, taking a bacterium solution to streak the nonresistant LB medium, respectively and correspondingly dotting a single colony on a kanamycin resistant plate and an ampicillin resistant plate, respectively, preparing E.coli G1 trans-competent cells by a strain growing on the kanamycin resistant plate but not growing on the ampicillin resistant plate, namely E.coli G1, transforming a pCP20 plasmid, coating the plasmid on the ampicillin resistant and chloramphenicol resistant LB medium plate to obtain a positive transformant containing the pCP20 plasmid, inoculating the positive transformant to the nonresistant LB medium for culture, eliminating the pCP20 plasmid, and obtaining E.coli G2 recombinant Escherichia coli. After the resistance gene is eliminated, the homologous fragment in the E.coli G2 strain is theoretically long 483bp, and the colony PCR amplification verification result is consistent with a theoretical value. Coli G2 strain did not grow on Kan, ampicillin (Amp) plates, but grew normally on non-resistant LB plates.

Example 2 selection and characterization of stationary phase promoters

A library of 40 promoters (partial promoter list is shown in FIG. 1) was synthesized and used to screen for different promoters of interest with a gradient of expression levels. First, the lacI gene fragment corresponding to the lac operon of plasmid pRSFDuet-1 was deleted to obtain plasmid pRSFDuet-1-DeltalacI. The original T7 promoter in plasmid pRSFDuet-1-delta lacI was replaced with 40 promoters in the promoter library, and plasmid libraries containing 40 different promoters were constructed. The green fluorescent protein (eGFP) was used as a model protein to screen different promoters with gradient expression levels. The 5 different eGFP expression intensities (see FIG. 2) were obtained by screening, and the protein expression level was concentrated in the stationary phase promoter (P)₂₅、P₄₁、P₅₃、P₆₉、P₈₄) The method is used for constructing a novel regulation and control system in subsequent research.

TABLE 1 promoters and sequences

Promoters	Nucleotide sequence
		P25	TCTTGTCAAATTCTTAATTTGGTGCTATACTGGATCG
P41	TCTTGTCAAATTTTTAATGTTGTGCTATACTGTATCG
		P53	TCTCGGCAGATACCATATTATCGGCTATACTGTATCG
P69	TCTTGCCAAATTTGCAAATTTGTTCTATACTGTATTG
		P84	TTTTGCCAGATTCCCTGTGATCTGCTATACTTTAAAG

Example 3 novel Tryptophan operator System design and applications

Design of a new tryptophan operator system: the new tryptophan operation subsystem consists of an escherichia coli cell with a tryptophan synthetase gene cluster trpeDCBA knocked out and a recombinant plasmid; the recombinant plasmid contains a T7 promoter, an SPP type promoter, a tryptophan synthetase gene cluster trpeDCBA, an operation region trpO and a D, D-carboxypeptidase gene dacA; the manipulation region trpO has a binding site capable of binding to a covalent dimer formed by the repressor trpR and tryptophan; the T7 promoter regulates expression of trpeDCBA; the SPP regulates the gene expression of the control region trpO; the dacA gene is connected with the downstream of the trpO of the control region; the transcription directions of the T7 promoter and the promoter SPP are opposite; the nucleotide sequence of the T7 promoter is shown as SEQ ID No. 6; the nucleotide sequence of the SPP type promoter is shown as SEQ ID No. 7-11; the manipulation region trpO is shown as SEQ ID No. 3; the nucleotide sequence of the dacA gene is shown as SEQ ID NO. 14.

The working principle of the novel tryptophan manipulation subsystem is as follows: the Escherichia coli genome contains a coding gene (shown in SEQ ID NO. 12) of a repressor protein trpR, the repressor protein trpR can be combined with high-concentration tryptophan to form active homodimer, and the active homodimer can be tightly combined with a specific binding site trpO of a trp operon to prevent the transcription of RNA polymerase. At lower concentrations of tryptophan, trpR exists in an inactive form and cannot bind to the trpO site, and the trp operon is transcribed by RNA polymerase.

Taking the example of using the new trp operator system to regulate the expression level of DacA (as shown in fig. 3), the new trp operator system was constructed in the engineered strain e.coli G2 of example 1 to reduce the effect of tryptophan synthesized by e.coli itself on the reconstructed trp operon. Plasmid pRSFDuet-1-delta lacI-P of the trp operator System₅₃-trpO-dacA-P_T7The trpeDCBA contains a T7 promoter, a tryptophan synthase gene cluster trpeDCBA, and a stationary phase promoter P₅₃The operator regions trpO and dacA genes. The T7 promoter is used for transcription of a tryptophan synthetase gene cluster trpECBA, the stationary phase promoter is used for transcription of a target protein gene, and the manipulation region trpO is used for regulation and control of target gene transcription. Under the control of the T7 promoter, tryptophan synthetase is transcribed and expressed, and then is combined with the suppressor trpR of the genome to form a covalent dimer, and the covalent dimer is specifically combined with the control region trpO to repress the expression of dacA controlled by the stationary phase promoter.

Example 4 validation of the feasibility of the Tryptophan operon inhibition System

The repressor protein (trpR) located on the E.coli genome can be compared with pRSFDuet-1-DeltalacI-P constructed in example 3₅₃-trpO-dacA-P_T7Tryptophan expressed by trpeDCBA forms an active repressor which can bind specifically to the trpO of the operator region, resulting in an inhibitory effect. To further verify whether the tryptophan operon repression system constructed by the episome plasmid has repression effect, the E.coli G20, E.coli G21, E.coli G213G/L (trp), E.coli G215G/L (trp) strains were selected for feasibility experiments. The constructed E.coli G20 and E.coli G21 are fermented and cultured in an M9 culture medium at 37 ℃ for 24 hours respectively, and 3G/L or 5G/L tryptophan is added aiming at the E.coli G21 to investigate whether exogenously added tryptophan can be combined with trpR repressor protein to achieve an inhibiting effect.

As shown in fig. 3d, validation of the tryptophan operon inhibition system by different tryptophan concentrations after gene editing, the fluorescence value of e.coli G20 was lower than that of e.coli G21, indicating that the initial tryptophan concentration on the genome capable of synthesizing tryptophan was higher than that of e.coli G21. Coli G21 and e.coli G213G/l (trp) show fluorescence values indicating that exogenously added trp is able to bind to trpR to form a covalent dimer repressor that binds to the tryptophan operon specific binding site and inhibits expression of eGFP protein. Coli G213G/L (trp) and E coli G215G/L (trp) have the same ability to inhibit eGFP. The above results further demonstrate that: the novel trp operator system is capable of inhibiting the expression of eGFP by tryptophan concentration and has a pronounced repression.

Example 5 Co-expression System design of Tryptophan operon suppression System and temperature sensitive repression System

A temperature-sensitive repression system is added on the basis of the embodiment 3, and a tryptophan operon and the temperature-sensitive repression system are constructed: the tryptophan operon and the temperature-sensitive repression system consist of escherichia coli cells and recombinant plasmids, wherein the tryptophan synthetase gene cluster trpeDCBA is knocked out; the recombinant plasmid contains SPP type promoter and low-temperature inducible promoter P_RHigh temperature inducible promoter P_LTryptophan synthetase gene cluster trpeDCBA, control region trpO, D-carboxypeptidase gene dacA and temperature sensitive repressor protein CI^ts857; the manipulation region trpO has a binding site capable of binding to a covalent dimer formed by the repressor trpR and tryptophan; the promoter P_LHaving a temperature sensitive repressor CI^ts857; the promoter P_LRegulating and controlling the expression of trpeDCBA; the promoter P_RRegulation of temperature sensitive repressor CI^ts857 expression; the SPP type promoter regulates and controls the gene expression of an operation region trpO; the dacA gene is connected downstream of the manipulation region trpO; the promoter P_LAnd promoter P_RThe transcription direction of (1) is opposite; promoter P_LThe nucleotide sequence of (A) is shown as SEQ ID No. 4; promoter P_RThe nucleotide sequence of (A) is shown as SEQ ID No. 13; the nucleotide sequence of the promoter SPP is shown in any one of SEQ ID No. 7-11; the nucleotide sequence of the manipulation region trpO is shown as SEQ ID No. 3; encoding the temperature-sensitive repressor CI^ts857 is shown in SEQ ID NO.5, and the D, D-carboxypeptidase gene dacA is shown in SEQ ID NO. 14.

In one embodiment, the tryptophan operon and temperature sensitive repressor system co-expression plasmid are constructed by: (1) by usingpETDuet-1-delta lacI plasmid is constructed by using pETDuet-1 as a template and using primers D-LACI-FW and D-LACI-RS. The plasmid pRSFDuet-1-DeltalacI was constructed using the primers Q-lacI-FW and Q-lacI-RS and the primer pRSFDuet-1 as a template. The SPP type Promoter primers such as Promoter-25-FW and Promoter-25-RS are adopted, and pRSFDuet-1-delta lacI is used as a template to construct and obtain the SPP type-containing pRSFDuet-1-delta lacI-P₂₅A plasmid. Using primers TrpO-FW and TrpO-RS to pRSFDuet-1-delta lacI-P₂₅As a template, pRSFDuet-1-delta lacI-P was constructed₂₅-trpO plasmid. The gene dacA was amplified using E.coli genome as template using dacA-FW and dacA-RS, ligated to plasmid pRSFDuet-1-DeltalacI-P using restriction enzyme sites Nde I and Xho I₂₅-trpO, constructing to obtain recombinant plasmid pRSFDuet-1-delta lacI-P₂₅trpO-dacA. Amplifying gene trpL-dacA by using primers TrpL-DacA-FW and TrpL-DacA-RS and E.coli genome as template, connecting to plasmid pRSFDuet-1-Deltalci-P by using restriction enzyme sites Nde I and Xho I₂₅-trpO, constructing to obtain recombinant plasmid pRSFDuet-1-delta lacI-P₂₅trpO-trpL-dacA. Amplifying gene cluster trpeDCBA by adopting primers Trp-e-FW and Trp-a-RS and E.coli genome as a template, and respectively using restriction enzyme sites Pst I and Kpn I and plasmid pRSFDuet-1-delta lacI-P₂₅trpO-dacA and pRSFDuet-1-DeltalacI-P₂₅-trpO-trpL-dacA connection, respectively constructing to obtain recombinant plasmid pRSFDuet-1-delta lacI-P₂₅trpO-dacA-trpEDCBA and pRSFDuet-1-DeltalacI-P₂₅-trpO-trpL-dacA-trpeDCBA. The primers CI857-FW and CI857-RS are adopted, pPL451 plasmid is taken as a template, and the gene Ci is amplified^ts857，P_L、P_RThe promoters are respectively connected to pRSFDuet-1-delta lacI-P by a one-step connection mode₂₅trpO-dacA-trpEDCBA and pRSFDuet-1-DeltalacI-P₂₅-trpO-trpL-dacA-trpeDCBA, and the recombinant plasmid pRSFDuet-1-DeltalacI-P was obtained by respective construction₂₅-trpO-dacA-Ci^ts857-P_R-P_L-trpeDCBA and pRSFDuet-1-Delta lacI-P₂₅-trpO-trpL-dacA-Ci^ts857-P_R-P_L-trpEDCBA。

Construction of P containing stationary phase promoter according to the same strategy as described above₄₁Plasmid pRSFDuet-1-delta lacI-P of₄₁-trpO-trpL-dacA-Ci^ts857-P_R-P_L-trpeDCBA, containing the stationary phase promoter P₅₃Plasmid pRSFDuet-1-delta lacI-P of₅₃-trpO-trpL-dacA-Ci^ts857-P_R-P_L-trpeDCBA, containing the stationary phase promoter P₆₉Plasmid pRSFDuet-1-delta lacI-P of₆₉-trpO-trpL-dacA-Ci^ts857-P_R-P_L-trpeDCBA, containing the stationary phase promoter P₈₄Plasmid pRSFDuet-1-delta lacI-P of₈₄-trpO-trpL-dacA-Ci^ts857-P_R-P_L-trpEDCBA。

(2) And (2) transforming the plasmid vector constructed in the step (1) into an escherichia coli competent cell with the tryptophan synthetase gene cluster trpeDCBA removed, and screening a positive transformant containing a resistance gene after transformation.

TrpO-FW：CGAACTAGTTAACTAGTACGCCCATCTTAGTATATTAGTTA；

TrpO-RW：GCGTACTAGTTAACTAGTTCGCCTATAGTGAGTCGTATTAA；

dacA-FW：GGAATTCCATATGATGAATACCATTTTTTCCGCTCG；

dacA-RW：CGGGGTACCTTAACCAAACCAGTGATG；

TrpL-DacA-FW：GGAATTCCATATGATGAAAGCAATTTTCGTACTGAAAGGTTGGTGGCGCACTTCCTGAATGAATACCATTTTTTCCGCTC；

TrpL-DacA-RW：CGGGGTACCTTAACCAAACCAGTGATGGAACA；

Trp-e-FW：AACTGCAGAGAGAATAACAATGCAAACACAAAAACCGACTCTC；

Trp-a-RW：CGGGGTACCCGGGGTAAGCGAAACGGTAAAAAGATAAATATTAAATGA；

CI857-FW：GGTCGAGATCCCGGTGCCTAGTTTATTGAGCGCTTATCTT；

CI857-RW：GTGATACGAAACGAAGCATTTTTGTTTAACTTTAAGAAGGAGAGGAATTC。

Promoter-25-FW：AATTCTTAATTTGGTGCTATACTGGATCGCCCCATCTTAGTATA

Promoter-25-RS：ATAGCACCAAATTAAGAATTTGACAAGAATTTCCTAATGCAGGPromoter-41-FW：AATTTTTAATGTTGTGCTATACTGTATCGCCCCATCTTAGTATA

Promoter-41-RS：ATAGCACAACATTAAAAATTTGACAAGAATTTCCTAATGCAGG

Q-LAI-FW：CTTACATTAATTGCGTTGCGCGGGATCTCGACGCTCTCC

Q-LACI-RS：GGAGAGCGTCGAGATCCCGCGCAACGCAATTAATGTAAG

D-LACI-FW：ATACGACTCACTATAGGCCTCTAGAAATAATTTTGTTTAACT

D-LACI-RS：AATTATTTCTAGAGGCCTATAGTGAGTCGTATTAATTTCG

Working principle of the temperature-sensitive repression system: the system can "turn on" or "turn off" the reconstructed trp operon and be used to dynamically adjust the expression level of DacA. Temperature sensitive repressor CI ^ts857 promoter P inducible by low temperature_RRegulated, temperature sensitive repressor CI when the temperature does not exceed 30 DEG C ^ts857 is expressed and binds to the protein at P_LBinding a temperature-sensitive repressor protein binding site on the promoter, and inhibiting the expression of the tryptophan gene cluster trpeDCBA. When the temperature reaches 42 ℃, is combined in P_LThe temperature sensitive repressor protein on the promoter can be automatically shed to not repress the P_LThe transcription level of (a).

Coli is 37 ℃ and a temperature sensitive inhibition system needs to set the culture temperature to 42 ℃ in order to increase the expression level of the regulated tryptophan synthesis gene cluster trpeddcba. Coli G22 was cultured in TB medium at 42 ℃ for the first 12h with shaking at 200rpm, and then at 30 ℃ with shaking at 200 rpm. A temperature-sensitive repression system element is added into a novel tryptophan operation subsystem, so that the bacteria can grow rapidly in the early stage, and DacA can be expressed in a low-temperature stable expression environment in the later stage. Simultaneous CI ^ts857 expression can be regulated by temperature induction, and tryptophan synthesis can be indirectly regulated by a tryptophan operon, so that the expression of the target protein is realized. This example also determined the effect of the first 12h culture temperature of 37 ℃ and 42 ℃ on cell growth of the E.coli BL21(DE3) strain. The results show that even at 42 ℃, e.coli growth is not severely inhibited and the system is capable of steady state expression in e.coli. Compared with the condition of 30 ℃, the tryptophan synthesis gene cluster can be promoted to accumulate at 42 ℃ and is combined with trpR to form covalent dimer, and the specific binding is blocked at trpOegfp transcription. Exogenously added 0.5g/L trp can provide sufficient tryptophan concentration for the early growth stage of bacteria, and the expression of the target protein eGFP is inhibited. The efficient expression of the target protein is realized by regulating and controlling the temperature of the bacterial growth environment, and compared with a mode of expressing the protein by using an IPTG reagent, the method is greener and safer.

Whether the combination of the tryptophan operon and the temperature-sensitive inhibition system accords with theoretical prediction and achieves inhibition effect is tested by fermentation culture under different temperature conditions (30 ℃,37 ℃ and 42 ℃). The research results at 3 different temperatures show that the high temperature of 42 ℃ indeed conforms to the TAT system principle, promotes the expression of trpeDCBA and inhibits the transcription of eGFP (48h, each OD₆₀₀The fluorescence value at the time of incubation was 1946.1a.u.), and the inhibitory effect at 37 ℃ was very close to 42 ℃ (48 hours per OD₆₀₀Fluorescence value under (b) 1475.3 a.u.). Compared with the OD at the temperature of 30 ℃ at 48h₆₀₀Fluorescence value under (b) 7908.1 a.u.). This example also explores the ability of endogenous tryptophan synthesized by the e. The results show that when the system environment is at the optimal growth temperature of E.coli, 37 ℃, the regulating capacity of the system by the tryptophan synthesized by E.coli G23 is more considerable than that of E.coli G22, and when the system environment is at 42 ℃, the difference of the fluorescence values is the same. And the endogenous tryptophan synthesized by the parents is not regulated and controlled by the system, so that the tryptophan of the system is always in a high concentration condition in the later growth stage of the bacteria, and the target protein cannot be efficiently expressed in the later growth stage of the bacteria.

Example 6 Effect of TAT System on DacA expression

Adding a trpL base sequence (shown as SEQ ID No. 2) at the N end of DacA, and specifically comprising the following steps: the pRSFDuet-1-trpO plasmid was constructed using the primers TrpO-FW and TrpO-RW and pRSFDuet-1 as a template. The gene trpL-dacA is amplified by using primers TrpL-DacA-FW and TrpL-DacA-RW and E.coli genome as a template, and is connected to a plasmid pRSFDuet-1-trpO by using restriction enzyme sites Nde I and Xho I to construct a recombinant plasmid pRSFDuet-1-trpO-trpL-dacA.

TrpO-FW：CGAACTAGTTAACTAGTACGCCCATCTTAGTATATTAGTTA；

TrpO-RW：GCGTACTAGTTAACTAGTTCGCCTATAGTGAGTCGTATTAA；

TrpL-DacA-FW：GGAATTCCATATGATGAAAGCAATTTTCGTACTGAAAGGTTGGTGGCGCACTTCCTGAATGAATACCATTTTTTCCGCTC；

TrpL-DacA-RW：CGGGGTACCTTAACCAAACCAGTGATGGAACA；

The recombinant plasmids were transformed into JM109 to obtain recombinant bacteria e.coli G6 and e.coli G11. The recombinant bacteria were cultured in a 37 ℃ incubator for 12h, and the results showed that no matter DacA was expressed on the high copy plasmid pRSFDuet-1 or pETDuet-1, as shown in FIG. 5c, E.coli G6 caused the bacteria to be unable to passage without adding a tryptophan attenuator, and thus the correct transformants could not be obtained, while after adding a trpL base sequence at the N-terminal of DacA, the bacteria could be normally passaged, and thus the correct transformants could be obtained. By adding the trpL element into the TAT, the problem that active dimer cannot be formed with trpR due to low tryptophan concentration in a microbial environment in the initial production stage of bacteria is solved, the DacA is expressed by a self-induced TAT system, and a foundation is laid for improving the research of recombinant protein exocytosis.

Example 7 Effect of DacA overexpression on cell morphology

In this example, strains E.coli M0 and E.coli M7 containing TAT systems were cultured in a 37 ℃ incubator for 12 hours and then in a 30 ℃ incubator for 12 hours, respectively, and cell morphology was observed. The results show (fig. 6a, 6c) that there is no significant difference in morphology between strains e.coli M0 and e.coli M7 at 37 ℃. As shown in fig. 6b and 6d, there was a clear difference in morphology between strains e.coli M0 and e.coli M7 at 30 ℃.

Example 8 Regulation of expression of proteins of interest Using temperature sensitive repression System and Trp operator System

Enhanced Green fluorescent protein (eGFP for short) and amylase Amyk are taken as target proteins to verify the regulation and control capability of the temperature-sensitive repression system and the trp operator system on the secretion of the target proteins.

Coli G2, plasmid pRSFDuet-1-DeltalacI-P₂₅-trpO-dacA-Ci^ts857-P_R-P_L-trpeDCBA and plasmid pETDuet-1-P modified to express eGFP_L-. DELTA.lacI-egfp, obtaining strains E.coli M6-E.coli M10。

The strains E.coli M6-E.coli M10 were subjected to shake culture at 37 ℃ and 200rpm for 0-12 h and 30 ℃ and 200rpm for 12-36 h, respectively, to detect the influence of DacA on the exocytosis capacity of the protein. Coli M7 per OD₆₀₀The extracellular fluorescence value reaches 11488(a.u.), and the extracellular fluorescence ratio reaches 89.8%. Compared with the extracellular fluorescence ratio of a negative control strain, the strain added with the TAT system has obvious increase, reduces the excessive accumulation of recombinant protein in cells, eliminates the defect of reduced tolerance capability of thalli, strengthens the secretion of extracellular protein, and also enhances the healthy growth capability of the strain.

The gene shown in Genbank accession number KF751392.1 is connected to the downstream of the trpO manipulation region of the co-expression system, and recombinant bacteria E.coli M11-M17 are constructed. The recombinant bacteria are respectively cultured for 12h at 37 ℃, then are transferred to 30 ℃ for culturing for 36h, and the result of detecting the enzyme activity of the amylase shows that the enzyme activity of E.coli M13 cultured for 36h at 30 ℃ after 12h can reach 813.3 U.g^-1The extracellular amylase activity accounts for 82.3%, and compared with a control strain, the accumulation amount of extracellular Amyk is obviously improved.

The proportion of extracellular secretion of the protein decreased slightly with the increase in protein mass, indicating that although DacA promotes extracellular secretion of the recombinant protein, the ability of DacA to cleave peptide glycan chains cannot be amplified indefinitely.

Comparative example:

primers were designed and a homologous fragment containing the Kan resistance gene for replacing the objective gene dacD was PCR-amplified, and the gene dacA in E.coli was knocked out by the method for knocking out dacA or dacB as described in example 1 to obtain mutant strain BL 21-. DELTA.dacD. After the recombinant plasmid pETDuet-GFP was transformed into mutant strain BL 21-delta dacD, the extracellular GFP fluorescence value of the mutant strain was 88.1A.U. L.g^-1While the control strain BL21-pETDuet-gfp was 87.5A.U. L.g^-1. It can be seen that the knockout of the D, D-carboxypeptidase dacD gene had little effect on the production of extracellular proteins of E.coli.

Although the present invention has been described with reference to the preferred embodiments, it should be understood that various changes and modifications can be made therein by those skilled in the art without departing from the spirit and scope of the invention as defined in the appended claims.

SEQUENCE LISTING

<110> university of south of the Yangtze river

<120> method for accurately and quantitatively regulating and controlling escherichia coli recombinant protein exocytosis level and application

<130> BAA220253A

<160> 14

<170> PatentIn version 3.3

<210> 1

<211> 6648

<212> DNA

<213> Artificial sequence

<400> 1

agagaataac aatgcaaaca caaaaaccga ctctcgaact gctaacctgc gaaggcgctt 60

atcgcgacaa tcccaccgcg ctttttcacc agttgtgtgg ggatcgtccg gcaacgctgc 120

tgctggaatc cgcagatatc gacagcaaag atgatttaaa aagcctgctg ctggtagaca 180

gtgcgctgcg cattacagct ttaggtgaca ctgtcacaat ccaggcactt tccggcaacg 240

gcgaagccct cctggcacta ctggataacg ccctgcctgc gggtgtggaa agtgaacaat 300

caccaaactg ccgtgtgctg cgcttccccc ctgtcagtcc actgctggat gaagacgccc 360

gcttatgctc cctttcggtt tttgacgctt tccgtttatt gcagaatctg ttgaatgtac 420

cgaaggaaga acgagaagcc atgttcttcg gcggcctgtt ctcttatgac cttgtggcgg 480

gatttgaaga tttaccgcaa ctgtcagcgg aaaataactg ccctgatttc tgtttttatc 540

tcgctgaaac gctgatggtg attgaccatc agaaaaaaag cacccgtatt caggccagcc 600

tgtttgctcc gaatgaagaa gaaaaacaac gtctcactgc tcgcctgaac gaactacgtc 660

agcaactgac cgaagccgcg ccgccgctgc cagtggtttc cgtgccgcat atgcgttgtg 720

aatgtaatca gagcgatgaa gagttcggtg gcgtagtgcg tttgttgcaa aaagcgattc 780

gcgctggaga aattttccag gtggtgccat ctcgccgttt ctctctgccc tgcccgtcac 840

cgctggcggc ctattacgtg ctgaaaaaga gtaatcccag cccgtacatg ttttttatgc 900

aggataatga tttcacccta tttggcgcgt cgccggaaag ctcgctcaag tatgatgcca 960

ccagccgcca gattgagatc tacccgattg ccggaacacg cccacgcggt cgtcgcgccg 1020

atggttcact ggacagagat ctcgacagcc gtattgaact ggaaatgcgt accgatcata 1080

aagagctgtc tgaacatctg atgctggttg atctcgcccg taatgatctg gcacgcattt 1140

gcacccccgg cagccgctac gtcgccgatc tcaccaaagt tgaccgttat tcctatgtga 1200

tgcacctcgt ctctcgcgta gtcggcgaac tgcgtcacga tcttgacgcc ctgcacgctt 1260

atcgcgcctg tatgaatatg gggacgttaa gcggtgcgcc gaaagtacgc gctatgcagt 1320

taattgccga ggcggaaggt cgtcgccgcg gcagctacgg cggcgcggta ggttatttca 1380

ccgcgcatgg cgatctcgac acctgcattg tgatccgctc ggcgctggtg gaaaacggta 1440

tcgccaccgt gcaagcgggt gctggtgtag tccttgattc tgttccgcag tcggaagccg 1500

acgaaacccg taacaaagcc cgcgctgtac tgcgcgctat tgccaccgcg catcatgcac 1560

aggagacttt ctgatggctg acattctgct gctcgataat atcgactctt ttacgtacaa 1620

cctggcagat cagttgcgca gcaatgggca taacgtggtg atttaccgca accatattcc 1680

ggcgcaaacc ttaattgaac gcctggcgac catgagcaat ccggtgctga tgctttctcc 1740

tggccccggt gtgccgagcg aagccggttg tatgccggaa ctcctcaccc gcttgcgtgg 1800

caagctgccc attattggca tttgcctcgg acatcaggcg attgtcgaag cttacggggg 1860

ctatgtcggt caggcgggcg aaattctcca cggtaaagcc tccagcattg aacatgacgg 1920

tcaggcgatg tttgccggat taacaaaccc gctgccggtg gcgcgttatc actcgctggt 1980

tggcagtaac attccggccg gtttaaccat caacgcccat tttaatggca tggtgatggc 2040

agtacgtcac gatgcggatc gcgtttgtgg attccagttc catccggaat ccattctcac 2100

cacccagggc gctcgcctgc tggaacaaac gctggcctgg gcgcagcaga aactagagcc 2160

agccaacacg ctgcaaccga ttctggaaaa actgtatcag gcgcagacgc ttagccaaca 2220

agaaagccac cagctgtttt cagcggtggt gcgtggcgag ctgaagccgg aacaactggc 2280

ggcggcgctg gtgagcatga aaattcgcgg tgagcacccg aacgagatcg ccggggcagc 2340

aaccgcgcta ctggaaaacg cagcgccgtt cccgcgcccg gattatctgt ttgctgatat 2400

cgtcggtact ggcggtgacg gcagcaacag tatcaatatt tctaccgcca gtgcgtttgt 2460

cgccgcggcc tgtgggctga aagtggcgaa acacggcaac cgtagcgtct ccagtaaatc 2520

tggttcgtcc gatctgctgg cggcgttcgg tattaatctt gatatgaacg ccgataaatc 2580

gcgccaggcg ctggatgagt taggtgtatg tttcctcttt gcgccgaagt atcacaccgg 2640

attccgccac gcgatgccgg ttcgccagca actgaaaacc cgcaccctgt tcaatgtgct 2700

ggggccattg attaacccgg cgcatccgcc gctggcgtta attggtgttt atagtccgga 2760

actggtgctg ccgattgccg aaaccttgcg cgtgctgggg tatcaacgcg cggcggtggt 2820

gcacagcggc gggatggatg aagtttcatt acacgcgccg acaatcgttg ccgaactgca 2880

tgacggcgaa attaaaagct atcagctcac cgcagaagac tttggcctga caccctacca 2940

ccaggagcaa ctggcaggcg gaacaccgga agaaaaccgt gacattttaa cacgtttgtt 3000

acaaggtaaa ggcgacgccg cccatgaagc agccgtcgct gcgaacgtcg ccatgttaat 3060

gcgcctgcat ggccatgaag atctgcaagc caatgcgcaa accgttcttg aggtactgcg 3120

cagtggttcc gcttacgaca gagtcaccgc actggcggca cgagggtaaa tgatgcaaac 3180

cgttttagcg aaaatcgtcg cagacaaggc gatttgggta gaagcccgca aacagcagca 3240

accgctggcc agttttcaga atgaggttca gccgagcacg cgacattttt atgatgcgct 3300

acagggtgcg cgcacggcgt ttattctgga gtgcaagaaa gcgtcgccgt caaaaggcgt 3360

gatccgtgat gatttcgatc cagcacgcat tgccgccatt tataaacatt acgcttcggc 3420

aatttcggtg ctgactgatg agaaatattt tcaggggagc tttaatttcc tccccatcgt 3480

cagccaaatc gccccgcagc cgattttatg taaagacttc attatcgacc cttaccagat 3540

ctatctggcg cgctattacc aggccgatgc ctgcttatta atgctttcag tactggatga 3600

cgaccaatat cgccagcttg ccgccgtcgc tcacagtctg gagatggggg tgctgaccga 3660

agtcagtaat gaagaggaac aggagcgcgc cattgcattg ggagcaaagg tcgttggcat 3720

caacaaccgc gatctgcgtg atttgtcgat tgatctcaac cgtacccgcg agcttgcgcc 3780

gaaactgggg cacaacgtga cggtaatcag cgaatccggc atcaatactt acgctcaggt 3840

gcgcgagtta agccacttcg ctaacggttt tctgattggt tcggcgttga tggcccatga 3900

cgatttgcac gccgccgtgc gccgggtgtt gctgggtgag aataaagtat gtggcctgac 3960

gcgtgggcaa gatgctaaag cagcttatga cgcgggcgcg atttacggtg ggttgatttt 4020

tgttgcgaca tcaccgcgtt gcgtcaacgt tgaacaggcg caggaagtga tggctgcggc 4080

accgttgcag tatgttggcg tgttccgcaa tcacgatatt gccgatgtgg tggacaaagc 4140

taaggtgtta tcgctggcgg cagtgcaact gcatggtaat gaagaacagc tgtatatcga 4200

tacgctgcgt gaagctctgc cagcacatgt tgccatctgg aaagcattaa gcgtcggtga 4260

aaccctgccc gcccgcgagt ttcagcacgt tgataaatat gttttagaca acggccaggg 4320

tggaagcggg caacgttttg actggtcact attaaatggt caatcgcttg gcaacgttct 4380

gctggcgggg ggcttaggcg cagataactg cgtggaagcg gcacaaaccg gctgcgccgg 4440

acttgatttt aattctgctg tagagtcgca accgggcatc aaagacgcac gtcttttggc 4500

ctcggttttc cagacgctgc gcgcatatta aggaaaggaa caatgacaac attacttaac 4560

ccctattttg gtgagtttgg cggcatgtac gtgccacaaa tcctgatgcc tgctctgcgc 4620

cagctggaag aagcttttgt cagtgcgcaa aaagatcctg aatttcaggc tcagttcaac 4680

gacctgctga aaaactatgc cgggcgtcca accgcgctga ccaaatgcca gaacattaca 4740

gccgggacga acaccacgct gtatctcaag cgtgaagatt tgctgcacgg cggcgcgcat 4800

aaaactaacc aggtgctggg gcaggcgttg ctggcgaagc ggatgggtaa aaccgaaatc 4860

atcgccgaaa ccggtgccgg tcagcatggc gtggcgtcgg cccttgccag cgccctgctc 4920

ggcctgaaat gccgtattta tatgggtgcc aaagacgttg aacgccagtc gcctaacgtt 4980

tttcgtatgc gcttaatggg tgcggaagtg atcccggtgc atagcggttc cgcgacgctg 5040

aaagatgcct gtaacgaggc gctgcgcgac tggtccggta gttacgaaac cgcgcactat 5100

atgctgggca ccgcagctgg cccgcatcct tatccgacca ttgtgcgtga gtttcagcgg 5160

atgattggcg aagaaaccaa agcgcagatt ctggaaagag aaggtcgcct gccggatgcc 5220

gttatcgcct gtgttggcgg cggttcgaat gccatcggca tgtttgctga tttcatcaat 5280

gaaaccaacg tcggcctgat tggtgtggag ccaggtggtc acggtatcga aactggcgag 5340

cacggcgcac cgctaaaaca tggtcgcgtg ggtatctatt tcggtatgaa agcgccgatg 5400

atgcaaaccg aagacgggca gattgaagaa tcttactcca tctccgccgg actggatttc 5460

ccgtctgtcg gcccacaaca cgcgtatctt aacagcactg gacgcgctga ttacgtgtct 5520

attaccgatg atgaagccct tgaagccttc aaaacgctgt gcctgcacga agggatcatc 5580

ccggcgctgg aatcctccca cgccctggcc catgcgttga aaatgatgcg cgaaaacccg 5640

gataaagagc agctactggt ggttaacctt tccggtcgcg gcgataaaga catcttcacc 5700

gttcacgata ttttgaaagc acgaggggaa atctgatgga acgctacgaa tctctgtttg 5760

cccagttgaa ggagcgcaaa gaaggcgcat tcgttccttt cgtcacgctc ggtgatccgg 5820

gcattgagca gtcattgaaa attatcgata cgctaattga agccggtgct gacgcgctgg 5880

agttaggtat ccccttctcc gacccactgg cggatggccc gacgattcaa aacgccactc 5940

tgcgcgcctt tgcggcaggt gtgactccgg cacaatgttt tgaaatgctg gcactgattc 6000

gccagaaaca cccgaccatt cccattggcc tgttgatgta tgccaatctg gtgtttaaca 6060

aaggcattga tgagttttat gcccagtgcg aaaaagtcgg cgtcgattcg gtgctggttg 6120

ccgatgtgcc agttgaagag tccgcgccct tccgccaggc cgcgttgcgt cataatgtcg 6180

cacctatctt catctgcccg ccaaatgccg atgacgacct gctgcgccag atagcctctt 6240

acggtcgtgg ttacacctat ttgctgtcac gagcaggcgt gaccggcgca gaaaaccgcg 6300

ccgcgttacc cctcaatcat ctggttgcga agctgaaaga gtacaacgct gcacctccat 6360

tgcagggatt tggtatttcc gccccggatc aggtaaaagc agcgattgat gcaggagctg 6420

cgggcgcgat ttctggttcg gccattgtta aaatcatcga gcaacatatt aatgagccag 6480

agaaaatgct ggcggcactg aaagtttttg tacaaccgat gaaagcggcg acgcgcagtt 6540

aatcccacag ccgccagttc cgctggcggc attttaactt tctttaatga agccggaaaa 6600

atcctaaatt catttaatat ttatcttttt accgtttcgc ttaccccg 6648

<210> 2

<211> 45

<212> DNA

<213> Artificial sequence

<400> 2

atgaaagcaa ttttcgtact gaaaggttgg tggcgcactt cctga 45

<210> 3

<211> 21

<212> DNA

<213> Artificial sequence

<400> 3

cgaactagtt aactagtacg c 21

<210> 4

<211> 29

<212> DNA

<213> Artificial sequence

<400> 4

ttgacataaa taccactggc ggtgatact 29

<210> 5

<211> 714

<212> DNA

<213> Artificial sequence

<400> 5

atgagcacaa aaaagaaacc attaacacaa gagcagcttg aggacgcacg tcgccttaaa 60

gcaatttatg aaaaaaagaa aaatgaactt ggcttatccc aggaatctgt cgcagacaag 120

atggggatgg ggcagtcagg cgttggtgct ttatttaatg gcatcaatgc attaaatgct 180

tataacgccg cattgcttac aaaaattctc aaagttagcg ttgaagaatt tagcccttca 240

atcgccagag aaatctacga gatgtatgaa gcggttagta tgcagccgtc acttagaagt 300

gagtatgagt accctgtttt ttctcatgtt caggcaggga tgttctcacc taagcttaga 360

acctttacca aaggtgatgc ggagagatgg gtaagcacaa ccaaaaaagc cagtgattct 420

gcattctggc ttgaggttga aggtaattcc atgaccgcac caacaggctc caagccaagc 480

tttcctgacg gaatgttaat tctcgttgac cctgagcagg ctgttgagcc aggtgatttc 540

tgcatagcca gacttggggg tgatgagttt accttcaaga aactgatcag ggatagcggt 600

caggtgtttt tacaaccact aaacccacag tacccaatga tcccatgcaa tgagagttgt 660

tccgttgtgg ggaaagttat cgctagtcag tggcctgaag agacgtttgg ctga 714

<210> 6

<211> 19

<212> DNA

<213> Artificial sequence

<400> 6

taatacgact cactatagg 19

<210> 7

<211> 37

<212> DNA

<213> Artificial sequence

<400> 7

tcttgtcaaa ttcttaattt ggtgctatac tggatcg 37

<210> 8

<211> 37

<212> DNA

<213> Artificial sequence

<400> 8

tcttgtcaaa tttttaatgt tgtgctatac tgtatcg 37

<210> 9

<211> 37

<212> DNA

<213> Artificial sequence

<400> 9

tctcggcaga taccatatta tcggctatac tgtatcg 37

<210> 10

<211> 37

<212> DNA

<213> Artificial sequence

<400> 10

tcttgccaaa tttgcaaatt tgttctatac tgtattg 37

<210> 11

<211> 37

<212> DNA

<213> Artificial sequence

<400> 11

ttttgccaga ttccctgtga tctgctatac tttaaag 37

<210> 12

<211> 327

<212> DNA

<213> Artificial sequence

<400> 12

atggcccaac aatcacccta ttcagcagcg atggcagaac agcgtcacca ggagtggtta 60

cgttttgtcg acctgcttaa gaatgcctac caaaacgatc tccatttacc gttgttaaac 120

ctgatgctga cgccagatga gcgcgaagcg ttggggactc gcgtgcgtat tgtcgaagag 180

ctgttgcgcg gcgaaatgag ccagcgtgag ttaaaaaatg aactcggcgc aggcatcgcg 240

acgattacgc gtggatctaa cagcctgaaa gccgcgcccg tcgagctgcg ccagtggctg 300

gaagaggtgt tgctgaaaag cgattga 327

<210> 13

<211> 28

<212> DNA

<213> Artificial sequence

<400> 13

ttatcaccgc cagaggtaaa atagtcaa 28

<210> 14

<211> 1212

<212> DNA

<213> Artificial sequence

<400> 14

atgaatacca ttttttccgc tcgtatcatg aagcgcctgg cgctcaccac ggctctttgc 60

acagccttta tctctgctgc acatgccgat gacctgaata tcaaaactat gatcccgggt 120

gtaccgcaga tcgatgcgga gtcctacatc ctgattgact ataactccgg caaagtgctc 180

gccgaacaga acgcagatgt ccgccgcgat cctgccagcc tgaccaaaat gatgaccagt 240

tacgttatcg gccaggcaat gaaagccggt aaatttaaag aaactgattt agtcactatc 300

ggcaacgacg catgggccac cggtaacccg gtgtttaaag gttcttcgct gatgttcctc 360

aaaccgggca tgcaggttcc ggtttctcag ctgatccgcg gtattaacct gcaatcgggt 420

aacgatgctt gtgtcgccat ggctgatttt gccgctggta gccaggacgc ttttgttggc 480

ttgatgaaca gctacgttaa cgccctgggc ctgaaaaaca cccacttcca gacggtacat 540

ggtctggatg ctgatggtca gtacagctcc gcgcgcgata tggcgctgat cggccaggcg 600

ttgatccgtg acgtaccgaa tgaatactcg atctataaag aaaaagaatt tacgtttaac 660

ggtattcgcc agctgaaccg taacggcctg ttatgggata acagcctgaa tgtcgacggc 720

atcaaaaccg gacacactga caaagcaggt tacaaccttg ttgcttctgc gactgaaggc 780

cagatgcgct tgatctctgc ggtgatgggc ggacgtactt ttaaaggccg tgaagccgaa 840

agtaaaaaac tgctgacctg gggcttccgt ttcttcgaaa ccgttaaccc actgaaagta 900

ggtaaagagt tcgcctctga accggtttgg tttggtgatt ctgatcgcgc ttcgttaggg 960

gttgataaag acgtgtacct gaccattccg cgtggccgca tgaaagatct gaaagccagc 1020

tatgtgctga acagcagtga attgcatgcg ccgctgcaaa agaatcaggt cgtcggtact 1080

atcaacttcc agcttgatgg caaaacgatc gaacaacgcc cgttggttgt actgcaagaa 1140

atcccggaag gtaacttctt cggcaaaatc attgattaca ttaaattaat gttccatcac 1200

tggtttggtt aa 1212

Claims (10)

1. A recombinant plasmid comprising a first promoter, a second promoter, a tryptophan synthase gene cluster trpEDCBA, an operator region trpO and a D, D-carboxypeptidase gene dacA; the manipulation region trpO has a binding site capable of binding to a covalent dimer formed by the repressor trpR and tryptophan; the first promoter regulates and controls the expression of trpeDCBA; the second promoter regulates the gene expression of the control region trpO; the downstream of the manipulation region trpO is connected with a D, D-carboxypeptidase gene dacA; the first promoter and the second promoter are opposite in transcription direction.

2. A tryptophan operon comprising an E.coli cell from which the tryptophan synthase gene cluster trpeDCBA has been knocked out and the recombinant plasmid of claim 1.

3. A recombinant plasmid co-expressed by tryptophan operon and a temperature-sensitive repression system, which is characterized by comprising an SPP-type promoter and a low-temperature inducible promoter P_RHigh temperature inducible promoter P_LTryptophan synthetase gene cluster trpeDCBA, control region trpO, D-carboxypeptidase gene dacA and temperature sensitive repressor CI^ts857; the manipulation region trpO has a binding site capable of binding to a covalent dimer formed by the repressor trpR and tryptophan; the promoter P_LHaving a temperature sensitive repressor CI^ts857; the promoter P_LRegulating and controlling the expression of trpeDCBA; the promoter P_RRegulation of temperature sensitive repressor CI^ts857 expression; the SPP type promoter regulates and controls the gene expression of an operation region trpO; the manipulation region trpO has a dacA gene downstream thereof; the promoter P_LAnd promoter P_RThe direction of transcription of (2) is opposite.

4. The recombinant plasmid of claim 3, wherein the dacA gene further comprises a trpL base sequence upstream thereof; the base sequence of the trpL is shown in SEQ ID NO. 2.

5. Recombinant E.coli comprising the recombinant plasmid of claim 3 or 4, wherein the tryptophan synthase gene cluster trpeDCBA is knocked out of the genome of the recombinant E.coli.

6. The recombinant E.coli of claim 5, wherein said E.coli is selected from the group consisting of: coli BL21, e.coli jm109, e.coli DH5 α, e.coli Rosetta, e.coli TOP10, e.coli m110, e.coli S110.

7. Use of the recombinant E.coli of claim 5 or 6 for producing a protein of interest.

8. The use according to claim 7, wherein the protein of interest includes, but is not limited to, amylase, green fluorescent egg, collagen, fructosyltransferase, methyl parathion hydrolase, catalase, or glucose oxidase.

9. A method for controlling the secretion of recombinant proteins of Escherichia coli, comprising fermenting the Escherichia coli of claim 5 or 6 under the following conditions: culturing for the first 12h at 37-42 ℃; after 12h, the temperature is between 28 and 32 ℃.

10. The recombinant plasmid according to any one of claims 1 to 4, or the recombinant Escherichia coli according to claim 5 or 6, or the method according to claim 9, for use in food or biological fields.

Images