CN110184204B

CN110184204B - Method for adjusting torulopsis glabrata to resist low pH stress

Info

Publication number: CN110184204B
Application number: CN201910497267.9A
Authority: CN
Inventors: 刘立明; 吴承晋; 陈修来; 刘佳; 罗秋玲
Original assignee: Jiangnan University
Current assignee: Jiangnan University
Priority date: 2019-06-10
Filing date: 2019-06-10
Publication date: 2020-09-04
Anticipated expiration: 2039-06-10
Also published as: CN110184204A

Abstract

The invention discloses a method for adjusting Torulopsis glabrata to resist low pH stress, and belongs to the technical field of bioengineering. The invention regulates the capability of the Torulopsis glabrata to resist low pH stress by deleting or over-expressing the CgRDS2 encoding gene of the native transcription factor. The result shows that after the Torulopsis glabrata lacks CgRDS2 gene, compared with the original strain, the cell concentration can be reduced by 32.6 percent, the cell survival rate can be reduced by 56.9 percent, the intracellular ATP content can be reduced by 33.5 percent, and the cell membrane permeability can be reduced by 23.6 percent under the condition of low pH stress; after the CgRDS2 gene is over-expressed, compared with the original strain, the cell concentration of the strain is not obviously changed under the condition of low pH stress, the cell survival rate is improved by 17.6%, the intracellular ATP content is improved by 41.5%, and the cell membrane permeability is improved by 18.8%.

Description

Method for adjusting torulopsis glabrata to resist low pH stress

Technical Field

The invention relates to a method for adjusting Torulopsis glabrata to resist low pH stress, and belongs to the technical field of bioengineering.

Background

In the process of producing organic acid by fermentation, along with the accumulation of extracellular organic acid, the pH value of a culture medium is reduced, the cell growth is seriously inhibited, and the yield of the organic acid is reduced₃And the like, but the addition of the substances can lead to the continuous increase of the osmotic pressure of the fermentation system, form osmotic pressure stress and also lead to the reduction of the growth and production capacity of cells.

At present, research shows that the transcription factor CgCrz1 in Torulopsis glabrata resists acid stress environment by regulating lipid synthesis and metabolism of cell membranes; in saccharomyces cerevisiae, the transcription factor Smp1 responds to osmotic stress by participating in the HOG signaling pathway; the transcription factor Mga2 makes lipid composition change to resist oxygen stress environment by regulating lipid metabolism gene; transcription factor Cip1 addresses hyperosmotic stress by down-regulating cyclin-dependent kinase Cdk1 such that the cell cycle is arrested; the transcription factor Gcn4 extends the life of yeast by down-regulating ribosomal protein synthesis genes, causing impaired protein synthesis ability and thereby inhibiting translation. It can be seen that the transcription factors involved, and the metabolic pathways or pathways regulated by the transcription factors, are different when the strain is protected against different stresses. Therefore, the mechanisms of strains to resist different environmental stresses are different, and there is no necessary connection between the regulation of cells under different environmental stresses.

Through literature research in the early period of the laboratory, a large number of transcription factors possibly participating in stress response are excavated, and the growth condition of the Torulopsis glabrata lacking some transcription factors is found not to be changed obviously compared with the starting strain under the stress condition. Meanwhile, because the research on the transcription factor in the Torulopsis glabrata is very limited at present, the specific mechanism for regulating and controlling the resistance of microorganisms to external environmental stress is not very clear, and when the transcription factor is deleted or overexpressed, the integrity of cells can be influenced, so that the growth of the cells under normal conditions is influenced. Therefore, the research on the transcription factor capable of regulating the resistance of the Torulopsis glabrata to low pH stress, the deletion or the overexpression of the transcription factor has no influence on the normal growth of cells, and the transcription factor has very important significance for improving the performance of producing organic acid by fermenting the Torulopsis glabrata.

Disclosure of Invention

In order to solve the problems, the invention reduces the low pH stress resistance of the Torulopsis glabrata by deleting the coding gene CgRDS2 of the transcription factor; the viability of the Torulopsis glabrata under the condition of low pH stress is improved by over-expressing the coding gene CgRDS2 of the transcription factor; meanwhile, under normal conditions, the CgRDS2 knockout or overexpression does not affect the growth of the strain, and a potential strategy is provided for improving the performance of organic acid production by Torulopsis glabrata fermentation.

The first object of the present invention is to provide a method for regulating the resistance of Torulopsis glabrata against low pH stress by deleting the CgRDS2 gene to reduce the low pH stress resistance of the strain or overexpressing the CgRDS2 gene to enhance the low pH stress resistance of the strain.

In one embodiment, the method enhances the resistance of Torulopsis glabrata to osmotic stress by overexpressing the gene encoding the native transcription factor CgRDS 2.

In one embodiment, the strain has reduced biomass and cell activity under osmotic stress conditions by deleting the gene CgRDS2 of Torulopsis glabrata, thereby reducing the growth capacity of the strain.

In one embodiment, the CgRDS2 gene comprises the nucleotide sequence of gene ID: 2891470.

In one embodiment, the strain is Candida glabrata HTU Δ, and has the genotype his3 Δ trp1 Δ ura3 Δ.

In one embodiment, the strain is Candida glabrata HTU.DELTA.with the genotype his 3. DELTA. trp 1. DELTA. ura 3. DELTA.as disclosed in Yan DN, Lin XB, Qi YL, Liu H, Chen XL, Liu LM, Chen J.2016. Crz1preparations pH homeostatis in Candida glabrata by alkaline alteration membrane lipid composition. applied Environ Microb 82:6920-6929.

In one embodiment, the deletion mutation is specifically: (1) connecting the marker gene with the left arm and the right arm of the gene CgRDS2 to construct a knockout frame; (2) introducing the knockout frame in the step (1) into a torulopsis glabrata competent cell, replacing the gene CgRDS2 with a marker gene through homologous arm recombination, and (3) screening to obtain a strain lacking the CgRDS2 gene.

In one embodiment, the deletion mutation is specifically: connecting left and right arms of a marker gene CgHIS3 isogene CgRDS2, constructing a knockout frame, introducing the knockout frame with correct sequencing into a torulopsis glabrata competent cell, replacing the gene CgRDS2 with CgHIS3 through homologous arm recombination, screening a mutant strain lacking the CgRDS2 gene by utilizing the characteristic that the recombined strain contains the CgHIS3 gene and can synthesize histidine, and verifying the correct strain through genome PCR and sequencing to obtain the CgRDS2 delta strain lacking the CgRDS2 gene.

In one embodiment, the overexpression is in particular: transcription of the CgRDS2 gene is initiated with a strong promoter.

In one embodiment, the strong promoter is P_TEF。

In one embodiment, the overexpression is achieved by ligating the CgRDS2 gene to plasmid pY26 to obtain recombinant plasmids pY26-CgRDS2, and then transforming the recombinant plasmids into yeast.

It is a second object of the present invention to provide a method for altering the intracellular ATP content of Torulopsis glabrata by knocking out or overexpressing the gene CgRDS 2.

It is a third object of the present invention to provide a method for altering the permeability of a cell membrane of Torulopsis glabrata by knocking out or overexpressing the gene CgRDS 2.

The invention also provides application of the method in producing organic acid by using the Torulopsis glabrata.

In one embodiment, the organic acid includes, but is not limited to, pyruvic acid, malic acid, fumaric acid, alpha-ketoglutaric acid.

The invention has the beneficial effects that:

(1) after the Torulopsis glabrata lacks CgRDS2 gene, compared with the original strain, the cell concentration can be reduced by 32.6 percent under the condition of low pH stress, the cell survival rate is reduced by 56.9 percent, the intracellular ATP content is reduced by 33.5 percent, and the cell membrane permeability is reduced by 23.6 percent;

(2) after the Torulopsis glabrata overexpresses CgRDS2 gene, compared with the original strain, the cell concentration of the strain is not obviously changed under the condition of low pH stress, the cell survival rate is improved by 17.6 percent, the intracellular ATP content is improved by 41.5 percent, and the cell membrane permeability is improved by 18.8 percent;

(3) under normal conditions, knocking out or overexpressing CgRDS2 did not affect the growth of the strain.

Drawings

FIG. 1: construction of Gene-deleted Strain gel electrophoresis Panels: a is a gene fragment electrophoresis image for constructing a knockout frame, wherein M is 2000bp marker, LM is gene CgRDS2 left arm and histidine gene, LMR is gene CgRDS2 left arm, histidine gene and gene CgRDS2 right arm; b is colony PCR verification, wherein M is 5000bp marker and + is positive control; lane 1 represents the colony PCR fragment of the positive transformant, as a negative control.

FIG. 2: construction of Gene-overexpressing strains gel electrophoresis Panels: a is plasmid pY26-CgRds2 double enzyme digestion verification, wherein M is 5000bp marker, lanes 1-4 are double enzyme digestion verification bands of plasmids pY26-CgRds2 in different positive transformants, the upper part is a pY26 fragment with the size of 7430bp, the lower part is CgRds2 with the size of 1389 bp; b is a colony PCR assay containing plasmid pY26-CgRds2, where M is 2000bp marker, lanes 1-5 are colony PCR fragments of positive transformants and + is a positive control.

FIG. 3: experimental graphs for plate growth of each strain under normal conditions and different pH conditions.

FIG. 4: growth curves of each strain under normal conditions and pH 2.0 conditions: a is the growth curve of each strain under normal conditions; b is the growth curve of each strain at pH 2.0.

FIG. 5: cell viability of each strain was measured under normal conditions and pH 2.0 conditions.

FIG. 6: the intracellular ATP content of each strain was measured under normal conditions and pH 2.0 conditions.

FIG. 7: results of cell membrane permeability measurement of each strain under normal conditions and pH 2.0 conditions.

FIG. 8: experimental graphs for plate growth of deletion strains Cgrlm1 delta, Cgusv1 delta and Cgcst6 delta under normal conditions and pH 2.0 conditions.

FIG. 9: deletion Strain Cdrs 2 Delta at 5% ethanol, 10mM H under Normal conditions₂O₂Experimental picture of plate growth under the condition.

Detailed Description

Example 1: construction of deletion strains

A left arm (L), a histidine gene (M) and a right arm (R) of a gene to be knocked out are amplified by taking a wild type Torulopsis glabrata ATCC 2001 genome as a template and respectively taking P1/P2, P3/P4 and P5/P6 as primers, and a knock-out frame CgRDS2-LMR (figure 1) is constructed by fusion PCR. A knockout frame with correct sequencing was introduced into the starting strain Candida glabrata HTU delta (with the genotype of his 3. delta. trp 1. delta. ura 3. delta. by electroporation, as described in Yan DN, Lin XB, Qi YL, LiuH, Chen XL, Liu LM, Chen J.2016.Crz1p regulations pH homomutasis in Candida glabrata by alkaline membrane plasmid composition. applied Environ Microb 82:6920-6929. published in 2016-12-31), positive transformants were selected by using histidine marker gene, and genomic PCR sequencing verification was extracted. The correct strain was identified as the deletion strain Cgrds2 Δ.

P1：ATTCGAAGGCCCACTGTA

P2：ACCCTCTTAACAAACGCCATGTCAAAAATATGATGCTGTGCTTAG

P3：CACAGCATCATATTTTTGACATGGCGTTTGTTAAGAGGGT

P4：ACTTGTCTATGCATATGTGTCTATGCTAGGACACCCTTAGT

P5：CTAAGGGTGTCCTAGCATAGACACATATGCATAGACAAGTTATATACA

P6：CCACTATTAGTGGCCCTAAATAAGT

Example 2: construction of overexpression strains

Amplifying a target gene CgRDS2(gene ID:2891470) by using a wild type Torulopsis glabrata ATCC 2001 genome as a template and P7/P8 as primers, digesting an amplification product and a plasmid pY26 by using the same restriction enzymes NotI and BglII, connecting the gene CgRDS2 with the plasmid pY26 by T4 ligase, wherein the plasmid pY26 is a bidirectional expression plasmid and contains two promoters of TEF and GPD, connecting the gene CgRDS2 to the rear of a TEF promoter on the plasmid pY26, and amplifying the gene CgRDS2 by using the wild type Torulopsis glabrata ATCC 2001 genome as a template and P7/P8 as primers_TEFTranscription was initiated, positive transformants were screened using the URA3 gene on the recombinant plasmid, and finally plasmid extraction was verified to yield the over-expressed strain Cdrs 2. delta./CgRDS 2 (FIG. 2).

P7：AAGGAAAAAAGCGGCCGCATGGAAGAACCAGCAGC

P8：GGAAGATCTTTAGTTGGAATGATCTCTTGTAGGA

Example 3: determination of growth Performance of Each Strain

(1) Plate growth experiment: inoculating a single colony of a strain to be detected into 20mL YNB (0.67% Yeast Nitrogen Base without Amino Acids, 2% Glucose) liquid culture medium for overnight activation, then transferring the activated single colony into the YNB culture medium for culture to logarithmic phase, measuring the thallus concentration and adjusting the bacterial suspension to OD₆₆₀With this concentration as the initial concentration, 5 times of 10-fold gradient dilution was performed, and 4. mu.L of each of the bacterial solutions was inoculated in the corresponding solid YNB medium in this order, cultured at 30 ℃ for 2 to 3 days, and the growth of the cells was observed and photographed (FIG. 3).

(2) Growth curve measurement: inoculating a single colony of a strain to be detected in 20mL YNB (0.67% Yeast Nitrogen Base without Amino Acids, 2% Glucose) liquid culture medium for overnight activation, then switching the activated single colony into 100mL YNB or YNB liquid culture medium with pH of 2.0, and controlling initial OD₆₆₀The cells were incubated at 30 ℃ and 200rpm with shaking at 0.1, and the OD was measured at 2-hour intervals to plot the growth curve (FIG. 4).

Plate growth experiments and growth curves the effect of pH 2.0 on growth of strains wt (starting strain Candida glabrata HTU. DELTA.), Cdrs 2. DELTA., Cdrs 2. DELTA./CgRDS 2 was analyzed. Under normal conditions, knocking out or over-expressing CgRDS2 does not affect the growth of the strain; under the condition of pH 2.0, compared with the original strain wt, the cell concentration of the knockout strain Cdrs 2 delta is reduced by 32.6 percent, and the cell concentration of the over-expression strain Cdrs 2 delta/CgRDS 2 is complemented back to the level of the original strain. The above results indicate that gene CgRDS2 is capable of regulating the tolerance of cells to low pH stress.

Example 4: determination of cell viability for Each Strain

Inoculating single colony of strain wt, Cgrs 2 delta, Cgrs 2 delta/CgRDS 2 in YNB liquid culture medium overnight for culture, transferring into 100mL YNB liquid culture medium, and controlling initial OD₆₆₀Shaking culture at 30 deg.C and 200rpm for logarithmic phase at 0.1, adding hydrochloric acid of different concentrations to adjust pH of the culture medium, culturing at 30 deg.C and 200rpm for 1 hr, centrifuging, collecting thallus, washing thallus with sterile water for 2 times, resuspending and diluting thallus. Spreading the same amount of bacterial liquid under different conditions on YNB plate, culturing at 30 deg.C for 2-4 days, observing growth state of each strain, and countingDefining the cell survival rate under normal conditions as 100%, the cell survival rate under stress conditions is × 100% of the number of colonies on the stress plate/the number of colonies on the normal plate, and finally plotting a cell survival line graph, as shown in fig. 5, the cell survival rate of the knockout strain Cgrds2 Δ is reduced by 56.9% and the cell survival rate of the overexpression strain Cgrds2 Δ/Cgrds2 is improved by 17.6% compared to the original strain wt under the condition of pH 2.0, the results show that the gene Cgrds2 is beneficial to the growth of torulopsis glabrata at pH 2.0.

Example 5: determination of intracellular ATP content in each strain

Inoculating single colony of strain wt, Cgrs 2 delta, Cgrs 2 delta/CgRDS 2 in YNB liquid culture medium overnight for culture, transferring into 100mL YNB liquid culture medium, and controlling initial OD₆₆₀Shaking culture at 30 ℃ and 200rpm at 0.1 for logarithmic phase, treating for 1h under the conditions of no stress or pH 2.0 stress, putting 500 mu L of bacterial liquid with the same concentration into a precooled ceramic mortar, adding 500 mu L of LATP lysis buffer into the mortar, immediately adding liquid nitrogen for grinding, collecting the grinding liquid into a 1.5mL centrifuge tube, centrifuging at 4 ℃ and 12000rpm, and taking supernatant for ATP detection. The specific detection steps are carried out according to the instructions of an ATP detection kit (S0026, Biyun Tian).

The results show that: as shown in FIG. 6, under the condition of pH 6.0, compared with the original strain wt, the intracellular ATP content in the knockout strain Cdrs 2 delta is reduced by 18.4%; the intracellular ATP content in the anaplerotic strain Cgrs 2 delta/CgRDS 2 is increased by 17.4 percent; under the condition of pH 2.0, compared with the original strain wt, the intracellular ATP content in the knockout strain Cdrs 2 delta is reduced by 33.5 percent; the intracellular ATP content of the complementation strain Cgrs 2 delta/CgRDS 2 is improved by 41.5 percent. The fact that the transcription factor CgRds2 in Torulopsis glabrata can regulate the intracellular ATP level is shown, and the regulation effect under the acid stress condition is more obvious.

Example 6: measurement of cell Membrane Permeability of Each Strain

Inoculating single colony of strain wt, Cgrs 2 delta, Cgrs 2 delta/CgRDS 2 in YNB liquid culture medium overnight for culture, transferring into 100mL YNB liquid culture medium, and controlling initial OD₆₆₀Shaking at 200rpm at 0.1 deg.C and 30 deg.C until logarithmic phaseThen treating under the conditions of no stress or pH 2.0 stress for 1h, centrifuging at 4 deg.C and 6000rpm to collect thallus, and passing the bacterial sludge through PBS (NaCl8.0g/L, KH)₂PO₄0.2g/L，Na₂HPO₄·H₂O2.9 g/L, KCl 0.2g/L) buffer solution, and then the suspension is resuspended and diluted to a proper concentration. Taking 5mL of diluted sample, evenly dividing the sample into two parts, adding 5 mu L of Propidium Iodide (PI) into one part, immediately reacting for 5min in a dark place, collecting and washing bacteria, and then resuspending cells by using 2.5mL of PBS; the other part was not treated. The fluorescence spectrophotometer was calibrated with PBS buffer, followed by detection of fluorescence in unstained and stained cells at excitation 536nm and emission 617nm, and analysis of cell membrane permeability using the following equation: PI uptake factor ═ F (PBS + cells + PI) -F (PBS + cells)]/[F(PBS+PI)-F(PBS)]Wherein F represents a fluorescence value.

The results show that: as shown in fig. 7, there was no significant difference in cell membrane permeability between the three strains at pH 6.0; under the condition of pH 2.0, compared with the original strain wt, the cell membrane permeability of the knockout strain Cdrs 2 delta is reduced by 23.6 percent, and the cell membrane permeability of the anaplerotic strain Cdrs 2 delta/CdrS 2 is improved by 18.8 percent. Indicating that CgRds2 helps maintain cell membrane permeability under acid stress.

Comparative example 1: growth of other transcription factors under acid stress conditions

The same strategy as in example 1 was used, except that the CgRDS2 gene was replaced with other factors CgRLM1(gene ID: 2888539), CgUSV1(gene ID: 2887354) and CgCST6(gene ID: 2889195) to construct deletion strains CgRLm1 delta, Cgusv1 delta and Cgcst6 delta, respectively. The growth of the corresponding deletion strain under acidic conditions was examined.

The results show that: as shown in fig. 8: under the conditions of no stress and pH 2.0 stress, compared with the original strain wt, the growth conditions of the deletion strains Cgrlm1 delta, Cgusv1 delta and Cgcst6 delta are not changed significantly.

Comparative example 2: growth of the deletion strain Cgrs 2 Delta under other stress conditions

The same strategy as in the plate growth experiment in example 3 was used, except that the inoculum was seeded at a concentration of 5% and no stressEthanol and 10mM H₂O₂The cells were cultured in the solid YNB medium at 30 ℃ for 2 to 3 days, and the growth of the cells was observed and photographed.

The results show that: as shown in FIG. 9, the growth conditions of the deletion strain Cdrs 2 delta and the original strain wt are basically the same on a stress-free YNB plate, which shows that the knockout gene CgRDS2 has no significant influence on the growth of Torulopsis glabrata; after addition of 5% ethanol and 10mM H₂O₂The growth of deletion strain Cgrs 2 delta was only slightly inhibited on YNB plates compared to the original strain wt, indicating that the effect of the transcription factor Cgrs 2 in combating ethanol and oxygen stress was not significant.

Although the present invention has been described with reference to the preferred embodiments, it should be understood that various changes and modifications can be made therein by those skilled in the art without departing from the spirit and scope of the invention as defined in the appended claims.

SEQUENCE LISTING

<110> university of south of the Yangtze river

<120> a method for regulating Torulopsis glabrata to resist low pH stress

<160>8

<170>PatentIn version 3.3

<210>1

<211>18

<212>DNA

<213> Artificial Synthesis

<400>1

attcgaaggc ccactgta 18

<210>2

<211>45

<212>DNA

<213> Artificial Synthesis

<400>2

accctcttaa caaacgccat gtcaaaaata tgatgctgtg cttag 45

<210>3

<211>40

<212>DNA

<213> Artificial Synthesis

<400>3

cacagcatca tatttttgac atggcgtttg ttaagagggt 40

<210>4

<211>41

<212>DNA

<213> Artificial Synthesis

<400>4

acttgtctat gcatatgtgt ctatgctagg acacccttag t 41

<210>5

<211>48

<212>DNA

<213> Artificial Synthesis

<400>5

ctaagggtgt cctagcatag acacatatgc atagacaagt tatataca 48

<210>6

<211>25

<212>DNA

<213> Artificial Synthesis

<400>6

ccactattag tggccctaaa taagt 25

<210>7

<211>35

<212>DNA

<213> Artificial Synthesis

<400>7

aaggaaaaaa gcggccgcat ggaagaacca gcagc 35

<210>8

<211>34

<212>DNA

<213> Artificial Synthesis

<400>8

ggaagatctt tagttggaat gatctcttgt agga 34

Claims

1. A method of modulating the resistance of torulopsis glabrata against low pH stress by deleting the CgRDS2 gene to reduce the low pH stress resistance of the strain or overexpressing the CgRDS2 gene to enhance the low pH stress resistance of the strain.

2. The method of claim 1 wherein the CgRDS2 gene comprises the nucleotide sequence of gene ID 2891470.

3. The method according to claim 1 or 2, wherein the strain is Candida glabrata HTU Δ, and the genotype is his3 Δ trp1 Δ ura3 Δ.

4. The method according to claim 1, characterized in that said deletion mutation is in particular: (1) connecting a marker gene for screening with the left arm and the right arm of the gene CgRDS2 to construct a knockout frame; (2) introducing the knockout frame in the step (1) into a torulopsis glabrata competent cell, replacing the gene CgRDS2 with a marker gene through homologous arm recombination, and (3) screening to obtain a strain lacking the CgRDS2 gene.

5. The method according to claim 1, wherein the overexpression is in particular: transcription of the CgRDS2 gene is initiated with a strong promoter.

6. The method of claim 5, wherein the strong promoter is P_TEF。

7. The method of claim 5, wherein the over-expression is carried out by ligating the CgRDS2 gene to plasmid pY26 to obtain recombinant plasmid pY26-CgRDS2, and then transforming the recombinant plasmid into yeast.

8. A method for changing the intracellular ATP content of Torulopsis glabrata, which is characterized in that the gene CgRDS2 is knocked out or over-expressed.

9. Use of the method according to any one of claims 1 to 8 for the production of organic acids by Torulopsis glabrata.