CN110184204B - Method for adjusting torulopsis glabrata to resist low pH stress - Google Patents

Abstract

The invention discloses a method for adjusting the resistance to low pH stress of Toluobacillus glabrata, and belongs to the technical field of biological engineering. The invention regulates the ability of T. glabrata to resist low pH stress by deleting or overexpressing the gene CgRDS2 encoding the original transcription factor. The results showed that after the deletion of the CgRDS2 gene in T. glabrata, compared with the starting strain, the cell concentration was reduced by 32.6%, the cell viability was reduced by 56.9%, the intracellular ATP content was reduced by 33.5%, and the cell membrane permeability was reduced by 33.5% under low pH stress conditions. After overexpression of CgRDS2 gene, compared with the starting strain, the cell concentration of the strain did not change significantly under low pH stress conditions, the cell survival rate increased by 17.6%, the intracellular ATP content increased by 41.5%, and the cell membrane permeability increased 18.8%.

Description

A method for regulating T. glabrata to resist low pH stress

technical field

The invention relates to a method for regulating the resistance to low pH stress of Toluobacillus glabrata, and belongs to the technical field of biological engineering.

Background technique

As the only industrial microorganism that produces pyruvic acid, T. glabrata is also used to produce other organic acids, such as malic acid, fumaric acid, α-ketoglutaric acid, etc. During the production of organic acids by fermentation, the accumulation of extracellular organic acids will cause the pH of the medium to drop, which will seriously inhibit cell growth and reduce the production of organic acids. Therefore, effectively solving the low pH stress is an urgent problem to be solved in the fermentation process of T. glabrata to produce organic acids. At present, the solution to low pH stress is to add alkaline substances such as _NaOH and CaCO to the fermentation medium. Growth and productivity decline.

At present, studies have shown that the transcription factor CgCrz1 in T. glabrata resists acid stress by regulating lipid synthesis and metabolism in the cell membrane; in Saccharomyces cerevisiae, the transcription factor Smp1 responds to osmotic stress by participating in the HOG signaling pathway; transcription The factor Mga2 responds to hyperosmotic stress by regulating lipid metabolism genes to change lipid composition in response to oxidative stress; the transcription factor Cip1 responds to hyperosmotic stress by downregulating the cyclin-dependent kinase Cdk1 to arrest the cell cycle; the transcription factor Gcn4 downregulating the ribosome Protein synthesis genes that impair protein synthesis, which in turn inhibits translation and prolongs yeast lifespan. It can be seen that when the strain resists different stresses, the involved transcription factors and the metabolic pathways or pathways regulated by the transcription factors are different. Therefore, the mechanisms by which strains resist different environmental stresses are different, and there is no necessary connection between the regulation of cells under different environmental stresses.

Through literature research in the early stage, the inventor's laboratory excavated a large number of transcription factors that may be involved in stress response, and found that under stress conditions, compared with the starting strain, the growth of T. glabrata without some transcription factors did not change significantly. At the same time, due to the limited research on transcription factors in T. glabrata, the specific mechanism of their regulation of microbial resistance to external environmental stress is not very clear. When the transcription factor is deleted or overexpressed, it may affect the integrity of the cell and Its growth under normal conditions is affected. Therefore, finding a transcription factor that can regulate the resistance of T. glabrata to low pH stress, and its deletion or overexpression has no effect on the normal growth of cells, is of great significance for improving the performance of T. glabrata to produce organic acids by fermentation .

SUMMARY OF THE INVENTION

In order to solve the above problems, the present invention reduces the ability of T. glabrata to resist low pH stress by deleting the transcription factor encoding gene CgRDS2; and overexpressing the transcription factor encoding gene CgRDS2 makes T. glabrata under low pH stress conditions At the same time, under normal conditions, knockout or overexpression of CgRDS2 did not affect the growth of the strain, providing a potential strategy for improving the performance of organic acid production by T. glabrata fermentation.

The first object of the present invention is to provide a method for regulating the resistance of T. glabrata to low pH stress, the method is to delete the CgRDS2 gene to reduce the low pH stress resistance of the strain, or to overexpress the CgRDS2 gene to enhance the low pH of the strain Stress resistance.

In one embodiment, the method enhances the ability of T. glabrata to resist osmotic stress by overexpressing the gene CgRDS2 encoding the native transcription factor.

In one embodiment, the present invention reduces the biomass and cell activity of the strain under osmotic stress conditions by deleting the T. glabrata CgRDS2 gene, thereby reducing the growth ability of the strain.

In one embodiment, the CgRDS2 gene contains the nucleotide sequence of gene ID: 2891470.

In one embodiment, the strain is Candida glabrata HTUΔ and the genotype is his3Δtrp1Δura3Δ.

In one embodiment, the strain is Candida glabrata HTUΔ, genotype his3Δtrp1Δura3Δ, described in Yan DN, Lin XB, Qi YL, Liu H, Chen XL, Liu LM, Chen J. 2016. Crz1pregulates pH homeostasis in Candida glabrata by altering membrane lipid composition. Appl Environ Microb 82:6920-6929. Published in the paper (published date: 2016-12-31).

In one embodiment, the deletion mutation is specifically: (1) linking the marker gene with the left and right arms of the gene CgRDS2 to construct a knockout frame; (2) introducing the knockout frame of step (1) into a smooth ball simulation In yeast competent cells, the gene CgRDS2 was replaced by a marker gene through homologous arm recombination, and (3) a strain lacking the CgRDS2 gene was obtained by screening.

In one embodiment, the deletion mutation is specifically: connecting the left and right arms of the marker gene CgHIS3 with the gene CgRDS2, constructing a knockout frame, and introducing the correctly sequenced knockout frame into a T. glabrata competent cell, by Homologous arm recombination replaces the gene CgRDS2 with CgHIS3, and uses the feature that the recombined strain contains the CgHIS3 gene and can synthesize histidine to screen for mutant strains that lack the CgRDS2 gene, and the correct strains verified by genomic PCR and sequencing are CgRDS2 deletions gene of strain Cgrds2Δ.

In one embodiment, the overexpression is specifically: transcription of the CgRDS2 gene with a strong promoter.

In one embodiment, the strong promoter is _PTEF .

In one embodiment, the overexpression is by ligating the CgRDS2 gene to plasmid pY26 to obtain a recombinant plasmid pY26-CgRDS2, and then transforming the recombinant plasmid into yeast.

The second object of the present invention is to provide a method for changing the intracellular ATP content of T. glabrata, and the method is to knock out or overexpress the gene CgRDS2.

The third object of the present invention is to provide a method for changing the cell membrane permeability of T. glabrata, which is to knock out or overexpress the gene CgRDS2.

The invention also provides the application of the method in the production of organic acid by T. glabrata.

In one embodiment, the organic acid includes, but is not limited to, pyruvic acid, malic acid, fumaric acid, alpha-ketoglutaric acid.

Beneficial effects of the present invention:

(1) After the deletion of the CgRDS2 gene in T. glabrata, compared with the starting strain, the cell concentration can be reduced by 32.6%, the cell viability can be reduced by 56.9%, the intracellular ATP content can be reduced by 33.5%, and the cell membrane permeability can be reduced by 32.6% under low pH stress conditions. 23.6% lower;

(2) After overexpression of the CgRDS2 gene in T. glabrata, compared with the starting strain, the cell concentration of the strain did not change significantly under low pH stress conditions, the cell survival rate increased by 17.6%, the intracellular ATP content increased by 41.5%, and the cell membrane 18.8% increase in permeability;

(3) Under normal conditions, knockout or overexpression of CgRDS2 did not affect the growth of the strain.

Description of drawings

Figure 1: Gel electrophoresis image of gene deletion strain construction: A is the electrophoresis image of the gene fragment for the construction of the knockout box, where M is a 2000bp marker, LM is the left arm of gene CgRDS2 and histidine gene, and LMR is the left arm of gene CgRDS2 , histidine gene and the right arm of the gene CgRDS2; B is the colony PCR verification, where M is a 5000bp marker, + is the positive control; - is the negative control, and lane 1 represents the colony PCR fragment of the positive transformant.

Figure 2: Gel electrophoresis of the construction of gene overexpression strains: A is the double-enzyme digestion verification of plasmid pY26-CgRds2, where M is a 5000bp marker, and lanes 1-4 are the double-enzyme digestion of plasmid pY26-CgRds2 in different positive transformants The verification band, the upper part is the pY26 fragment with a size of 7430bp, and the lower part is CgRds2 with a size of 1389bp; B is the colony PCR verification containing the plasmid pY26-CgRds2, where M is a 2000bp marker, and lanes 1-5 are the colonies of the positive transformants PCR fragment, + is a positive control.

Figure 3: Plate growth experiments of each strain under normal conditions and different pH values.

Figure 4: Growth curves of each strain under normal conditions and pH 2.0: A is the growth curve of each strain under normal conditions; B is the growth curve of each strain under pH 2.0.

Figure 5: Results of determination of cell viability of each strain under normal and pH 2.0 conditions.

Figure 6: Determination of intracellular ATP content of each strain under normal conditions and pH 2.0.

Figure 7: Measurement results of cell membrane permeability of each strain under normal and pH 2.0 conditions.

Figure 8: Graph of plate growth experiments of deletion strains Cgrlm1Δ, Cgusv1Δ and Cgcst6Δ under normal and pH 2.0 conditions.

Figure 9: Graph of plate growth experiments of deletion strain _Cgrds2Δ under normal conditions and ₅ % ethanol, 10 mM H2O2.

Detailed ways

Example 1: Construction of deletion strains

Using the genome of wild-type Candida glabrata ATCC 2001 as a template, and using P1/P2, P3/P4, and P5/P6 as primers, the left arm (L) and histidine gene (L) of the gene to be knocked out were amplified. M) and right arm (R), the knockout box CgRDS2-LMR was constructed by fusion PCR (Figure 1). The correctly sequenced knockout frame was introduced into the starting strain Candida glabrata HTUΔ (genotype: his3Δtrp1Δura3Δ, which was described in Yan DN, Lin XB, Qi YL, LiuH, Chen XL, Liu LM, Chen J.2016. Crz1p regulates pH homeostasis in Candidaglabrata by altering membrane lipid composition. Appl Environ Microb 82:6920-6929. Published in the paper, publication date: 2016-12-31), use histidine marker gene to screen positive transformants, and extract the genome for PCR sequencing verification . The strain with correct results was the deletion strain Cgrds2Δ.

P1: ATTCGAAGGCCCACTGTA

P2: ACCCTCTTAACAAACGCCATGTCAAAAATATGATGCTGTGCTTAG

P3: CACAGCATCATATTTTTGACATGGCGTTTGTTAAGAGGGT

P4: ACTTGTCTATGCATATGTGTCTATGCTAGGACACCCTTAGT

P5: CTAAGGGTGTCCTAGCATAGACACATATGCATAGACAAGTTATATACA

P6: CCACTATTAGTGGCCCCTAAATAAGT

Example 2: Construction of overexpression strains

The target gene CgRDS2 (gene ID: 2891470) was amplified with the genome of the wild-type T. glabrata Candida glabrata ATCC 2001 as the template and P7/P8 as the primers. After digestion with BglII, the gene CgRDS2 was connected to the plasmid pY26 by T4 ligase. The plasmid pY26 is a bidirectional expression plasmid containing two promoters of TEF and GPD. The gene CgRDS2 was connected to the back of the _TEF promoter on the plasmid pY26. Transcription was started, and the URA3 gene on the recombinant plasmid was used to screen positive transformants. Finally, the plasmid was extracted to verify the overexpression strain Cgrds2Δ/CgRDS2 (Figure 2).

P7: AAGGAAAAAAGCGGCCGCATGGAAGAACCAGCAGC

P8: GGAAGATCTTTAGTTGGAATGATCTCTTGTAGGA

Example 3: Determination of growth performance of each strain

(1) Plate growth experiment: A single colony of the strain to be tested was inoculated into 20 mL of YNB (0.67% YeastNitrogen Base without Amino Acids, 2% Glucose) liquid medium for overnight activation, and then transferred to YNB medium and cultured until the For several stages, measure the bacterial concentration and adjust the bacterial suspension to OD ₆₆₀ = 1.0, take this as the initial concentration, carry out 5 times of 10-fold gradient dilution, and sequentially spot 4 μL bacterial liquid on the corresponding solid YNB medium, 30 Cultivate at ℃ for 2-3 days, observe the growth of the cells and take pictures (Fig. 3).

(2) Growth curve test: inoculate a single colony of the strain to be tested in 20 mL of YNB (0.67% YeastNitrogen Base without Amino Acids, 2% Glucose) liquid medium for overnight activation, and then transfer to 100 mL of YNB or pH 2.0 In the YNB liquid medium of 200 mg/kg, control the initial OD ₆₆₀ =0.1, 30 ° C, 200 rpm shaker culture, take samples every 2 hours to measure the OD value, and draw the growth curve (Figure 4).

Plate growth experiments and growth curve analysis of the effect of pH 2.0 on the growth of strains wt (starting strain Candida glabrata HTUΔ), Cgrds2Δ, Cgrds2Δ/CgRDS2. Under normal conditions, knockout or overexpression of CgRDS2 did not affect the growth of the strain; at pH 2.0, the cell concentration of the knockout strain Cgrds2Δ was reduced by 32.6% compared with the starting strain wt, while the cell concentration of the overexpressing strain Cgrds2Δ/CgRDS2 was reduced by 32.6%. The cell concentration was replenished to the level of the starting strain. The above results indicated that the gene CgRDS2 could regulate the tolerance of cells to low pH stress.

Example 4: Determination of cell viability of each strain

Single colonies of strains wt, Cgrds2Δ, Cgrds2Δ/CgRDS2 were inoculated into YNB liquid medium for overnight culture, and then transferred to 100 mL of YNB liquid medium, and the initial OD ₆₆₀ = 0.1, 30 ° C, 200 rpm shaker culture to logarithm During the period, different concentrations of hydrochloric acid were added to adjust the pH value of the medium, and the cells were collected by centrifugation at 30°C and 200 rpm for 1 h. The cells were washed twice with sterile water and then resuspended and diluted. The same amount of bacterial liquid under different conditions was spread on YNB plate, cultured at 30°C for 2-4 days, and the growth state of each strain was observed and counted. The cell survival rate under normal conditions is defined as 100%, then the cell survival rate under stress conditions = the number of colonies on the stress plate/the number of colonies on the normal plate × 100%, and finally a line graph of cell survival rate is drawn. As shown in Figure 5, at pH 2.0, compared with the starting strain wt, the cell viability of the knockout strain Cgrds2Δ was reduced by 56.9%, while that of the overexpressing strain Cgrds2Δ/CgRDS2 was increased by 17.6%. The above results indicated that the gene CgRDS2 was beneficial to the growth of T. glabrata at pH 2.0.

Example 5: Determination of intracellular ATP content of each strain

Single colonies of strains wt, Cgrds2Δ, Cgrds2Δ/CgRDS2 were inoculated into YNB liquid medium for overnight culture, and then transferred to 100 mL of YNB liquid medium, and the initial OD ₆₆₀ = 0.1, 30 ° C, 200 rpm shaker culture to logarithm Then, under no stress or pH 2.0 stress conditions for 1 h, each 500 μL of the same concentration of bacterial solution was placed in a pre-cooled ceramic mortar, and 500 μL of ATP detection lysate was added to the mortar and immediately added liquid nitrogen for grinding. , the grinding liquid was collected in a 1.5 mL centrifuge tube, centrifuged at 4°C at 12000 rpm, and the supernatant was taken for ATP detection. The specific detection steps were carried out according to the instructions of the ATP detection kit (S0026, Biyuntian).

The results showed that: as shown in Figure 6, under the condition of pH 6.0, compared with the starting strain wt, the intracellular ATP content of the knockout strain Cgrds2Δ decreased by 18.4%; while the intracellular ATP content of the complementing strain Cgrds2Δ/CgRDS2 increased 17.4%; under the condition of pH 2.0, compared with the starting strain wt, the intracellular ATP content of the knockout strain Cgrds2Δ was decreased by 33.5%; while the intracellular ATP content of the complementing strain Cgrds2Δ/CgRDS2 was increased by 41.5%. It indicated that the transcription factor CgRds2 in T. glabrata could regulate the level of intracellular ATP, and the regulation effect was more significant under acid stress conditions.

Example 6: Determination of cell membrane permeability of each strain

A single colony of strains wt, Cgrds2Δ, Cgrds2Δ/CgRDS2 was inoculated into YNB liquid medium for overnight culture, and then transferred to 100 mL of YNB liquid medium, and the initial OD ₆₆₀ = 0.1, 30 ° C, 200 rpm shaker culture to logarithm The bacteria were collected by centrifugation at ₄ °C and 6000 rpm for ₁ h under no stress or pH _2.0 stress conditions _{. 2} O 2.9g/L, KCl 0.2g/L) buffer wash, resuspend and dilute to appropriate concentration. Take 5 mL of the diluted sample, and divide it into two equal parts. One part is added with 5 μL propidium iodide (PI), and the reaction is immediately protected from light for 5 minutes. After the bacteria are collected and washed, the cells are resuspended in 2.5 mL of PBS; the other part is not treated. . The fluorescence spectrophotometer was calibrated with PBS buffer, and then the fluorescence values in unstained and stained cells were detected under the conditions of excitation wavelength 536 nm and emission wavelength 617 nm, and the cell membrane permeability was analyzed using the following formula: PI absorption factor = [F( PBS+cell+PI)-F(PBS+cell)]/[F(PBS+PI)-F(PBS)], where F represents the fluorescence value.

The results showed that: as shown in Figure 7, under the condition of pH 6.0, the cell membrane permeability of the three strains had no significant difference; while under the condition of pH 2.0, compared with the starting strain wt, the cell membrane permeability of the knockout strain Cgrds2Δ was not significantly different. decreased by 23.6%, while cell membrane permeability was increased by 18.8% in the apoplectic strain Cgrds2Δ/CgRDS2. It shows that CgRds2 helps to maintain the permeability of cell membrane under acid stress.

Control Example 1: Growth of other transcription factors under acid stress conditions

The same strategy as in Example 1 was adopted, except that the CgRDS2 gene was replaced with other factors CgRLM1 (gene ID: 2888539), CgUSV1 (gene ID: 2887354) and CgCST6 (gene ID: 2889195), respectively, and the deletion strains Cgrlm1Δ, Cgusv1Δ and Cgcst6Δ. The corresponding deletion strains were tested for growth under acidic conditions.

The results showed that: as shown in Figure 8: under the conditions of no stress and pH 2.0 stress, compared with the starting strain wt, the growth of the deletion strains Cgrlm1Δ, Cgusv1Δ and Cgcst6Δ did not change significantly.

Control example 2: Growth of deletion strain Cgrds2Δ under other stress conditions

The same strategy was adopted for the plate growth experiment in Example 3, except that the bacterial solution was spotted on solid YNB medium without stress and containing 5% ethanol and 10 mM H ₂ O ₂ , and cultured at 30°C for 2-3 days. The growth of the bacteria was recorded and photographed.

The results showed that: as shown in Figure 9, on the unstressed YNB plate, the growth status of the deletion strain Cgrds2Δ was basically the same as that of the starting strain wt, indicating that the knockout gene CgRDS2 had no significant effect on the growth of T. glabrata; after adding 5% On YNB plates with ethanol and 10 mM H ₂ O ₂ , the growth status of the deletion strain Cgrds2Δ was only slightly inhibited compared with the starting strain wt, indicating that the transcription factor CgRds2 does not play a significant role in resisting ethanol and oxygen stress.

Although the present invention has been disclosed above with preferred embodiments, it is not intended to limit the present invention. Anyone who is familiar with this technology can make various changes and modifications without departing from the spirit and scope of the present invention. Therefore, The protection scope of the present invention should be defined by the claims.

SEQUENCE LISTING

<110> Jiangnan University

<120> A method for regulating T. glabrata to resist low pH stress

<160> 8

<170> PatentIn version 3.3

<210> 1

<211> 18

<212> DNA

<213> Synthetic

<400> 1

attcgaaggc ccactgta 18

<210> 2

<211> 45

<212> DNA

<213> Synthetic

<400> 2

accctcttaa caaacgccat gtcaaaaata tgatgctgtg cttag 45

<210> 3

<211> 40

<212> DNA

<213> Synthetic

<400> 3

cacagcatca tatttttgac atggcgtttg ttaagagggt 40

<210> 4

<211> 41

<212> DNA

<213> Synthetic

<400> 4

acttgtctat gcatatgtgt ctatgctagg acacccttag t 41

<210> 5

<211> 48

<212> DNA

<213> Synthetic

<400> 5

ctaagggtgt cctagcatag acacatatgc atagacaagt tatataca 48

<210> 6

<211> 25

<212> DNA

<213> Synthetic

<400> 6

ccactattag tggccctaaa taagt 25

<210> 7

<211> 35

<212> DNA

<213> Synthetic

<400> 7

aaggaaaaaa gcggccgcat ggaagaacca gcagc 35

<210> 8

<211> 34

<212> DNA

<213> Synthetic

<400> 8

ggaagatctt tagttggaat gatctcttgt agga 34

Claims (9)

1. A method of modulating the resistance of torulopsis glabrata against low pH stress by deleting the CgRDS2 gene to reduce the low pH stress resistance of the strain or overexpressing the CgRDS2 gene to enhance the low pH stress resistance of the strain.

2. The method of claim 1 wherein the CgRDS2 gene comprises the nucleotide sequence of gene ID 2891470.

3. The method according to claim 1 or 2, wherein the strain is Candida glabrata HTU Δ, and the genotype is his3 Δ trp1 Δ ura3 Δ.

4. The method according to claim 1, characterized in that said deletion mutation is in particular: (1) connecting a marker gene for screening with the left arm and the right arm of the gene CgRDS2 to construct a knockout frame; (2) introducing the knockout frame in the step (1) into a torulopsis glabrata competent cell, replacing the gene CgRDS2 with a marker gene through homologous arm recombination, and (3) screening to obtain a strain lacking the CgRDS2 gene.

5. The method according to claim 1, wherein the overexpression is in particular: transcription of the CgRDS2 gene is initiated with a strong promoter.

6. The method of claim 5, wherein the strong promoter is P_TEF。

7. The method of claim 5, wherein the over-expression is carried out by ligating the CgRDS2 gene to plasmid pY26 to obtain recombinant plasmid pY26-CgRDS2, and then transforming the recombinant plasmid into yeast.

8. A method for changing the intracellular ATP content of Torulopsis glabrata, which is characterized in that the gene CgRDS2 is knocked out or over-expressed.

9. Use of the method according to any one of claims 1 to 8 for the production of organic acids by Torulopsis glabrata.

Images