CN110184204A - A method of adjusting the low pH stress of resistance of Torulopsis glabrata to hyper - Google Patents
A method of adjusting the low pH stress of resistance of Torulopsis glabrata to hyper Download PDFInfo
- Publication number
- CN110184204A CN110184204A CN201910497267.9A CN201910497267A CN110184204A CN 110184204 A CN110184204 A CN 110184204A CN 201910497267 A CN201910497267 A CN 201910497267A CN 110184204 A CN110184204 A CN 110184204A
- Authority
- CN
- China
- Prior art keywords
- gene
- cgrds2
- stress
- bacterial strain
- torulopsis glabrata
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/37—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from fungi
- C07K14/39—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from fungi from yeasts
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P7/00—Preparation of oxygen-containing organic compounds
- C12P7/40—Preparation of oxygen-containing organic compounds containing a carboxyl group including Peroxycarboxylic acids
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P7/00—Preparation of oxygen-containing organic compounds
- C12P7/40—Preparation of oxygen-containing organic compounds containing a carboxyl group including Peroxycarboxylic acids
- C12P7/44—Polycarboxylic acids
- C12P7/46—Dicarboxylic acids having four or less carbon atoms, e.g. fumaric acid, maleic acid
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P7/00—Preparation of oxygen-containing organic compounds
- C12P7/40—Preparation of oxygen-containing organic compounds containing a carboxyl group including Peroxycarboxylic acids
- C12P7/44—Polycarboxylic acids
- C12P7/50—Polycarboxylic acids having keto groups, e.g. 2-ketoglutaric acid
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- General Health & Medical Sciences (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Chemical & Material Sciences (AREA)
- Biotechnology (AREA)
- Mycology (AREA)
- Gastroenterology & Hepatology (AREA)
- Biophysics (AREA)
- Medicinal Chemistry (AREA)
- Molecular Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention discloses a kind of methods of the low pH stress of adjusting resistance of Torulopsis glabrata to hyper, belong to technical field of bioengineering.The present invention adjusts the ability of the low pH stress of resistance of Torulopsis glabrata to hyper by the encoding gene CgRDS2 of missing or overexpression origin transcription factor.The result shows that compared with starting strain, cell concentration can reduce by 32.6% under low pH stress conditions, and cell survival rate decline 56.9%, ATP content intracellular reduces by 33.5%, and permeability of cell membrane reduces by 23.6% after torulopsis glabrata missing CgRDS2 gene；After being overexpressed CgRDS2 gene, compared with starting strain, for bacterial strain under low pH stress conditions, cell concentration does not have significant changes, and cell survival rate improves 17.6%, and ATP content intracellular improves 41.5%, and permeability of cell membrane increases by 18.8%.
Description
Technical field
The present invention relates to a kind of methods of the low pH stress of adjusting resistance of Torulopsis glabrata to hyper, belong to biotechnology neck
Domain.
Background technique
Unique industrial microorganism of the torulopsis glabrata as production pyruvic acid, is also used for producing other organic acids, apple
Acid, fumaric acid, α-ketoglutaric acid etc..During fermentation production of organic acid, as the accumulation of extracellular organic acid will cause training
The decline of base pH is supported, it is serious to inhibit cell growth, while reducing the yield of organic acid.Therefore, effectively solving low pH stress is light
A urgent problem to be solved during sliding torulopsis fermentation production of organic acid.Solving the method that low pH is coerced at present is mainly
NaOH, CaCO are added into fermentation medium3Equal alkaline matters, but the addition of this substance can make the infiltration of fermentation system again
Pressure constantly increases thoroughly, forms infiltration pressure stress, also results in cell growth and production capacity decline.
Currently, some researches show that transcription factor CgCrz1 is closed by adjusting Cell membrane lipids in torulopsis glabrata
Acid stress environment is resisted at metabolisming way；In saccharomyces cerevisiae, transcription factor Smp1 by participate in HOG signal transduction path come
Response infiltration pressure stress；Transcription factor Mga2 makes lipid composition change by regulating lipid metabolism gene to resist the oxygen side of body
Compel environment；Transcription factor Cip1 makes cell cycle arrest by downward cell cycle protein dependent kinase Cdk1 to cope with height
Seep stress；Transcription factor Gcn4 synthesizes gene by lowering ribosomal protein, so that protein synthesis capacity is impaired, and then inhibits
Translation is to extend the yeast service life.There it can be seen that bacterial strain is when resisting different stress, related transcription factor, and
The metabolic pathway of transcription factor regulation or path are different.Therefore, it is not that bacterial strain, which resists the mechanism of different environment-stress,
With, under different environment-stress between the regulation of cell and there is no inevitable connections.
Inventor laboratory early period by literature survey, has excavated a large amount of possible transcription factors for participating in stress response, hair
Under present stress conditions, compared with starting strain, the growing state of the torulopsis glabrata of some transcription factors is lacked not
Significant changes occur.Simultaneously because the research at present about transcription factor in torulopsis glabrata is very limited, regulate and control micro-
The specific mechanism that biology resists external environment stress is not fully aware of, after lacking or being overexpressed transcription factor, it is possible to meeting
It influences the integrality of cell and its growth under normal operation is made to be affected.Therefore, a kind of adjustable smooth ball is found
False yeast resists the transcription factor of low pH stress, and its missing or overexpression do not influence the normal growth of cell, for
The performance for improving torulopsis glabrata fermentation production of organic acid has a very important significance.
Summary of the invention
To solve the above-mentioned problems, the present invention passes through the encoding gene CgRDS2 of the lack transcription factor, so that smooth ball is quasi-
Yeast resists low pH stress ability to reduce；By the encoding gene CgRDS2 of overexpression transcription factor, so that smooth ball intends ferment
Survival ability of the mother under low pH stress conditions improves；Meanwhile under normal condition, knocks out or be overexpressed CgRDS2 and have no effect on bacterium
The growth of strain provides potential strategy to improve the performance of torulopsis glabrata fermentation production of organic acid.
The first purpose of the invention is to provide a kind of method of the low pH stress of adjusting resistance of Torulopsis glabrata to hyper, the sides
Method is missing from CgRDS2 gene to reduce the low pH stress resistance of bacterial strain, or is overexpressed CgRDS2 gene to enhance the low pH of bacterial strain
Stress resistance.
In one embodiment, the method is enhanced by the encoding gene CgRDS2 of overexpression origin transcription factor
Torulopsis glabrata resists the ability of infiltration pressure stress.
In one embodiment, the present invention makes bacterial strain in osmotic pressure by missing torulopsis glabrata CgRDS2 gene
Biomass and cell activity decline under stress conditions, to reduce the growth ability of bacterial strain.
In one embodiment, the CgRDS2 gene contains the nucleotide sequence of gene ID:2891470.
In one embodiment, the bacterial strain is Candida glabrata HTU Δ, and genotype is his3 Δ trp1
Δura3Δ。
In one embodiment, the bacterial strain is Candida glabrata HTU Δ, and genotype is his3 Δ trp1
Δ ura3 Δ, in Yan DN, Lin XB, Qi YL, Liu H, Chen XL, Liu LM, Chen are J.2016.Crz1p
regulates pH homeostasis in Candida glabrata by altering membrane lipid
Composition.Appl Environ Microb 82:6920-6929. discusses (publication date: 2016-12-31) disclosed herein.
In one embodiment, the deletion mutation is specifically: (1) by the left and right arms of marker gene and gene C gRDS2
It connects, building knocks out frame；(2) the knockout frame of step (1) is imported in torulopsis glabrata competent cell, by homologous
Gene C gRDS2 is substituted for marker gene by arm recombination, and (3) screening obtains the bacterial strain of missing CgRDS2 gene.
In one embodiment, the deletion mutation is specifically: by a left side of the homogenic CgRDS2 of marker gene CgHIS3
Right arm connects, and building knocks out frame, and sequencing is correctly knocked out to frame and is imported in torulopsis glabrata competent cell, by same
Gene C gRDS2 is substituted for CgHIS3 by source arm recombination, is contained CgHIS3 gene using the bacterial strain after recombination and can be synthesized histidine
This Feature Selection lacks the mutant strain of CgRDS2 gene, is to lack through Genomic PCR and the correct bacterial strain of sequence verification
Lose the bacterial strain Cgrds2 Δ of CgRDS2 gene.
In one embodiment, the overexpression is specifically: starting transcription CgRDS2 gene with strong promoter.
In one embodiment, the strong promoter is PTEF。
In one embodiment, described be overexpressed is that CgRDS2 gene is connected on plasmid pY26, obtains recombination matter
Grain pY26-CgRDS2, then by recombinant plasmid transformed into yeast.
A second object of the present invention is to provide a kind of method for changing torulopsis glabrata ATP content intracellular, the sides
Method is to knock out or be overexpressed gene C gRDS2.
Third object of the present invention is to provide a kind of method for changing torulopsis glabrata permeability of cell membrane, the sides
Method is to knock out or be overexpressed gene C gRDS2.
The present invention also provides application of the method in terms of torulopsis glabrata produces organic acid.
In one embodiment, the organic acid includes but is not limited to pyruvic acid, malic acid, fumaric acid, α -one penta 2
Acid.
Beneficial effects of the present invention:
(1) after torulopsis glabrata missing CgRDS2 gene, compared with starting strain, cell is dense under low pH stress conditions
Degree can reduce by 32.6%, and cell survival rate decline 56.9%, ATP content intracellular reduces by 33.5%, and permeability of cell membrane reduces
23.6%；
(2) after torulopsis glabrata is overexpressed CgRDS2 gene, compared with starting strain, bacterial strain is in low pH stress conditions
Under, cell concentration does not have significant changes, and cell survival rate improves 17.6%, and ATP content intracellular improves 41.5%, cell membrane penetration
Property increase by 18.8%；
(3) under normal condition, knock out or be overexpressed the growth that CgRDS2 has no effect on bacterial strain.
Detailed description of the invention
Fig. 1: the building gel electrophoresis figure of gene deletion strains: A is the genetic fragment electrophoretogram that building knocks out frame, wherein M
It is gene C gRDS2 left arm and histidine gene for 2000bp marker, LM, LMR is gene C gRDS2 left arm, histidine gene
With gene C gRDS2 right arm；B is bacterium colony PCR verifying, wherein M is 5000bp marker ,+it is positive control；It is negative right
According to swimming lane 1 indicates the bacterium colony PCR fragment of positive transformant.
Fig. 2: the building gel electrophoresis figure of gene overexpression bacterial strain: A is the verifying of plasmid pY26-CgRds2 double digestion, wherein
M is 5000bp marker, and the double digestion that swimming lane 1-4 is plasmid pY26-CgRds2 in different positive transformants verifies band, on
Side is pY26 segment, and size 7430bp, lower section is CgRds2, size 1389bp；B is containing plasmid pY26-CgRds2
Bacterium colony PCR verifying, wherein M is 2000bp marker, and swimming lane 1-5 is the bacterium colony PCR fragment of positive transformant ,+it is positive right
According to.
Fig. 3: plated growth lab diagram of each bacterial strain under normal condition and different pH condition.
Fig. 4: growth curve of each bacterial strain under the conditions of normal condition and 2.0 pH: A is each bacterial strain under normal condition
Growth curve；B is the growth curve of each bacterial strain under the conditions of pH 2.0.
Fig. 5: the measurement result of each bacterial strain cell survival rate under the conditions of normal condition and 2.0 pH.
Fig. 6: the measurement result of intracellular ATP content of each bacterial strain under the conditions of normal condition and 2.0 pH.
Fig. 7: the measurement result of permeability of cell membrane of each bacterial strain under the conditions of normal condition and 2.0 pH.
Fig. 8: deletion mycopremna Cgrlm1 Δ, the plate of Cgusv1 Δ and Cgcst6 Δ under the conditions of normal condition and 2.0 pH
Growth experiment figure.
Fig. 9: deletion mycopremna Cgrds2 Δ is in normal condition and 5% ethyl alcohol, 10mM H2O2Under the conditions of plated growth experiment
Figure.
Specific embodiment
Embodiment 1: the building of deletion mycopremna
Using 2001 genome of wild type torulopsis glabrata Candida glabrata ATCC as template, respectively with P1/
P2, P3/P4, P5/P6 are primer, amplify the left arm (L), histidine gene (M) and right arm (R) of gene to be knocked out, fused
PCR building knocks out frame CgRDS2-LMR (Fig. 1).Sequencing is correctly knocked out into frame and imports starting strain with electric shock conversion method
(genotype is his3 Δ trp1 Δ ura3 Δ to Candida glabrata HTU Δ, in Yan DN, Lin XB, Qi YL, Liu
H,Chen XL,Liu LM,Chen J.2016.Crz1p regulates pH homeostasis in Candida
glabrata by altering membrane lipid composition.Appl Environ Microb 82:6920-
6929. discuss disclosed herein, publication date: 2016-12-31), positive transformant is screened using histidine mark gene, and extract
Genomic PCR sequence verification.The correct bacterial strain of verification result is deletion mycopremna Cgrds2 Δ.
P1:ATTCGAAGGCCCACTGTA
P2:ACCCTCTTAACAAACGCCATGTCAAAAATATGATGCTGTGCTTAG
P3:CACAGCATCATATTTTTGACATGGCGTTTGTTAAGAGGGT
P4:ACTTGTCTATGCATATGTGTCTATGCTAGGACACCCTTAGT
P5:CTAAGGGTGTCCTAGCATAGACACATATGCATAGACAAGTTATATACA
P6:CCACTATTAGTGGCCCTAAATAAGT
Embodiment 2: it is overexpressed the building of bacterial strain
Using 2001 genome of wild type torulopsis glabrata Candida glabrata ATCC as template, it is with P7/P8
Primer amplification target gene CgRDS2 (gene ID:2891470), by amplified production and plasmid pY26 with identical restricted interior
Gene C gRDS2 and plasmid pY26, are attached, plasmid pY26 is one by enzyme cutting NotI and BglII digestion by T4 ligase
Two-way expression plasmid, containing two promoters of TEF and GPD, after gene C gRDS2 is connected to the TEF promoter on plasmid pY26
Face, by PTEFStarting transcription, screens positive transformant using the URA3 gene on recombinant plasmid, finally extracts plasmid and verifies
To overexpression bacterial strain Cgrds2 Δ/CgRDS2 (Fig. 2).
P7:AAGGAAAAAAGCGGCCGCATGGAAGAACCAGCAGC
P8:GGAAGATCTTTAGTTGGAATGATCTCTTGTAGGA
Embodiment 3: the measurement of each strain growth performance
(1) plated growth is tested: the single colonie of strain to be tested is inoculated in the YNB (0.67%Yeast of 20mL
Nitrogen Base without Amino Acids, 2%Glucose) it is activated overnight in fluid nutrient medium, then it is transferred to YNB
Culture measures cell concentration and bacteria suspension is adjusted to OD to logarithmic phase in culture medium660=1.0, as initial concentration, into
5 10 times of gradient dilutions of row, successively by 4 μ L bacterium solution dibblings on corresponding solid YNB culture medium, 30 DEG C are cultivated 2-3 days, observation
The growing state of thallus simultaneously takes pictures (Fig. 3).
(2) single colonie of strain to be tested the growth curve property surveyed: is inoculated in the YNB (0.67%Yeast of 20mL
Nitrogen Base without Amino Acids, 2%Glucose) it is activated overnight in fluid nutrient medium, then be transferred to
In the YNB fluid nutrient medium of the YNB or pH 2.0 of 100mL, control starting OD660=0.1,30 DEG C, 200rpm shaking table culture,
Every 2 hours sampling and measuring OD values, draw growth curve (Fig. 4).
Plated growth experiment and growth curve analysis pH 2.0 are to bacterial strain wt (starting strain Candida glabrata HTU
Δ), Cgrds2 Δ, the growth of Cgrds2 Δ/CgRDS2 influence.Under normal condition, knocks out or be overexpressed CgRDS2 and have no effect on
The growth of bacterial strain；Under the conditions of 2.0 pH, compared with starting strain wt, the cell concentration of knock-out bacterial strain Cgrds2 Δ is reduced
32.6%, and be overexpressed bacterial strain Cgrds2 Δ/CgRDS2 cell concentration covering to starting strain level.Result above table
Bright, gene C gRDS2 can adjust the tolerance that cell coerces low pH.
Embodiment 4: the measurement of each strain cell survival rate
Bacterial strain wt, Cgrds2 Δ, Cgrds2 Δ/CgRDS2 single colonie are inoculated in YNB fluid nutrient medium and be incubated overnight, then
It is transferred in the YNB fluid nutrient medium of 100mL, control starting OD660=0.1,30 DEG C, 200rpm shaking table culture to logarithmic phase adds
Add various concentration hydrochloric acid adjust culture medium pH value, 30 DEG C, 200rpm cultivate 1h after thalline were collected by centrifugation, sterile water wash bacterium
It is resuspended after body 2 times and dilutes thallus.The bacterium solution under identical quantity different condition is taken to be coated on YNB plate, 30 DEG C of culture 2-4
It, observes the growth conditions of each bacterial strain and counting.Defining cell survival rate under normal condition is 100%, then thin under stress conditions
Clump count × 100% on clump count/normal plate on born of the same parents' survival rate=stress plate, finally draws cell survival rate broken line
Figure.As shown in figure 5, compared with starting strain wt, the cell survival rate of knock-out bacterial strain Cgrds2 Δ is reduced under the conditions of 2.0 pH
56.9%, and be overexpressed bacterial strain Cgrds2 Δ/CgRDS2 cell survival rate and improve 17.6%.The above results show gene
CgRDS2 is conducive to torulopsis glabrata and grows under the conditions of 2.0 pH.
Embodiment 5: the measurement of each bacterial strain ATP content intracellular
Bacterial strain wt, Cgrds2 Δ, Cgrds2 Δ/CgRDS2 single colonie are inoculated in YNB fluid nutrient medium and be incubated overnight, then
It is transferred in the YNB fluid nutrient medium of 100mL, control starting OD660=0.1,30 DEG C, 200rpm shaking table culture to logarithmic phase, with
1h is handled under without stress or 2.0 stress conditions of pH afterwards, the bacterium solution of 500 μ L same concentrations is respectively taken to be placed in the ceramics being pre-chilled
In mortar, liquid nitrogen is added immediately is ground after 500 μ LATP detection lysate is added into mortar, lapping liquid is collected and is existed
In 1.5mL centrifuge tube, 4 DEG C, supernatant is taken to detect for ATP after 12000rpm centrifugation.Specific detecting step is according to ATP detection reagent
Box (S0026, the green skies) specification carries out.
The result shows that: as shown in fig. 6, under the conditions of 6.0 pH, compared with starting strain wt, in knock-out bacterial strain Cgrds2 Δ
ATP content intracellular reduces 18.4%；And it covers ATP content intracellular in bacterial strain Cgrds2 Δ/CgRDS2 and improves 17.4%；?
Under the conditions of pH 2.0, compared with starting strain wt, ATP content intracellular reduces 33.5% in knock-out bacterial strain Cgrds2 Δ；And it returns
It mends ATP content intracellular in bacterial strain Cgrds2 Δ/CgRDS2 and improves 41.5%.Illustrate transcription factor in torulopsis glabrata
It is horizontal that CgRds2 can adjust ATP intracellular, and adjustment effect under the conditions of acid stress is more significant.
Embodiment 6: the measurement of each strain cell membrane permeability
Bacterial strain wt, Cgrds2 Δ, Cgrds2 Δ/CgRDS2 single colonie are inoculated in YNB fluid nutrient medium and be incubated overnight, then
It is transferred in the YNB fluid nutrient medium of 100mL, control starting OD660=0.1,30 DEG C, 200rpm shaking table culture to logarithmic phase, with
1h is handled under without stress or 2.0 stress conditions of pH afterwards, 4 DEG C, thalline were collected by centrifugation by 6000rpm, and bacterium mud is through PBS (NaCl
8.0g/L, KH2PO40.2g/L, Na2HPO4·H2O 2.9g/L, KCl 0.2g/L) it is resuspended after buffer solution for cleaning, it is appropriate to be diluted to
Concentration.Sample after taking 5mL to dilute is equally divided into two parts, and 5 μ L propidium iodides (PI) are added in portion, are protected from light immediately
5min uses 2.5mL PBS that cell is resuspended after receiving bacterium cleaning；Another is without any processing.Fluorescence spectrophotometer is proofreaded with PBS buffer solution
Photometer is then detected under the conditions of excitation wavelength 536nm and launch wavelength 617nm and is unstained and the fluorescence in stained cells
Value, and permeability of cell membrane: PI absorption factor=[F (PBS+ cell+PI)-F (PBS+ cell)]/[F is analyzed using following formula
(PBS+PI)-F (PBS)], F indicates fluorescent value in formula.
The result shows that: as shown in fig. 7, the permeability of cell membrane of three plants of bacterium does not have marked difference under the conditions of 6.0 pH；And
Under the conditions of 2.0 pH, compared with starting strain wt, permeability of cell membrane reduces 23.6% in knock-out bacterial strain Cgrds2 Δ, and
Permeability of cell membrane improves 18.8% in covering bacterial strain Cgrds2 Δ/CgRDS2.Illustrate that CgRds2 facilitates under acid stress
Maintain permeability of cell membranes.
Reference examples 1: growing state of other transcription factors under the conditions of acid stress
Using identical strategy in embodiment 1, difference is, is other factors CgRLM1 by CgRDS2 gene replacement
(gene ID:2888539), CgUSV1 (gene ID:2887354) and CgCST6 (gene ID:2889195), construct respectively
To deletion mycopremna Cgrlm1 Δ, Cgusv1 Δ and Cgcst6 Δ.To the growing state of corresponding deletion mycopremna in acid condition
It is detected.
The result shows that: as shown in Figure 8: under without stress and 2.0 stress conditions of pH, compared with starting strain wt, lacking bacterium
There is no significant changes for the growing state of strain Cgrlm1 Δ, Cgusv1 Δ and Cgcst6 Δ.
Reference examples 2: growing state of the deletion mycopremna Cgrds2 Δ under other stressful environmentals
Identical strategy is tested using plated growth in embodiment 3, difference is, by bacterium solution dibbling without coercing and contain
There are 5% ethyl alcohol and 10mM H2O2Solid YNB culture medium on, 30 DEG C cultivate 2-3 days, observe the growing state of thallus and take pictures.
The result shows that: as shown in figure 9, deletion mycopremna Cgrds2 Δ is with starting strain wt's on the YNB plate of no stress
Upgrowth situation is essentially identical, shows that knocking out gene C gRDS2 has no significant effect the growth of torulopsis glabrata；In addition 5%
Ethyl alcohol and 10mM H2O2YNB plate on, compared with starting strain wt, the upgrowth situation of deletion mycopremna Cgrds2 Δ is only slight
Inhibit, shows transcription factor CgRds2 to resist the effect in ethyl alcohol and Oxdative stress not significant.
Although the present invention has been described by way of example and in terms of the preferred embodiments, it is not intended to limit the invention, any to be familiar with this skill
The people of art can do various change and modification, therefore protection model of the invention without departing from the spirit and scope of the present invention
Enclosing subject to the definition of the claims.
SEQUENCE LISTING
<110>Southern Yangtze University
<120>a kind of method for adjusting the low pH stress of resistance of Torulopsis glabrata to hyper
<160> 8
<170> PatentIn version 3.3
<210> 1
<211> 18
<212> DNA
<213>artificial synthesized
<400> 1
attcgaaggc ccactgta 18
<210> 2
<211> 45
<212> DNA
<213>artificial synthesized
<400> 2
accctcttaa caaacgccat gtcaaaaata tgatgctgtg cttag 45
<210> 3
<211> 40
<212> DNA
<213>artificial synthesized
<400> 3
cacagcatca tatttttgac atggcgtttg ttaagagggt 40
<210> 4
<211> 41
<212> DNA
<213>artificial synthesized
<400> 4
acttgtctat gcatatgtgt ctatgctagg acacccttag t 41
<210> 5
<211> 48
<212> DNA
<213>artificial synthesized
<400> 5
ctaagggtgt cctagcatag acacatatgc atagacaagt tatataca 48
<210> 6
<211> 25
<212> DNA
<213>artificial synthesized
<400> 6
ccactattag tggccctaaa taagt 25
<210> 7
<211> 35
<212> DNA
<213>artificial synthesized
<400> 7
aaggaaaaaa gcggccgcat ggaagaacca gcagc 35
<210> 8
<211> 34
<212> DNA
<213>artificial synthesized
<400> 8
ggaagatctt tagttggaat gatctcttgt agga 34
Claims (10)
1. a kind of method for adjusting the low pH stress of resistance of Torulopsis glabrata to hyper, which is characterized in that the method is missing from CgRDS2
Gene is to reduce the low pH stress resistance of bacterial strain, or is overexpressed CgRDS2 gene to enhance the low pH stress resistance of bacterial strain.
2. the method according to claim 1, wherein the CgRDS2 gene contains gene ID:2891470's
Nucleotide sequence.
3. method according to claim 1 or 2, which is characterized in that the bacterial strain is Candida glabrata HTU Δ,
Genotype is his3 Δ trp1 Δ ura3 Δ.
4. the method according to claim 1, wherein the deletion mutation is specifically: (1) mark that will be used to screen
The left and right arms of note gene and gene C gRDS2 connect, and building knocks out frame；(2) the knockout frame of step (1) is imported into smooth ball
It in false yeast competent cell, is recombinated by homology arm and gene C gRDS2 is substituted for marker gene, (3) screening is lacked
The bacterial strain of CgRDS2 gene.
5. the method according to claim 1, wherein the overexpression is specifically: being started with strong promoter and transcribed
CgRDS2 gene.
6. according to the method described in claim 5, it is characterized in that, the strong promoter is PTEF。
7. according to the method described in claim 5, it is characterized in that, described be overexpressed is that CgRDS2 gene is connected to plasmid
On pY26, recombinant plasmid pY26-CgRDS2 is obtained, then by recombinant plasmid transformed into yeast.
8. a kind of method for changing torulopsis glabrata ATP content intracellular, which is characterized in that the method is to knock out or be overexpressed
Gene C gRDS2.
9. a kind of method for changing torulopsis glabrata permeability of cell membrane, which is characterized in that the method is to knock out or cross table
Up to gene C gRDS2.
10. application of any the method for claim 1-9 in terms of torulopsis glabrata produces organic acid.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910497267.9A CN110184204B (en) | 2019-06-10 | 2019-06-10 | Method for adjusting torulopsis glabrata to resist low pH stress |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910497267.9A CN110184204B (en) | 2019-06-10 | 2019-06-10 | Method for adjusting torulopsis glabrata to resist low pH stress |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110184204A true CN110184204A (en) | 2019-08-30 |
| CN110184204B CN110184204B (en) | 2020-09-04 |
Family
ID=67721027
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910497267.9A Active CN110184204B (en) | 2019-06-10 | 2019-06-10 | Method for adjusting torulopsis glabrata to resist low pH stress |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110184204B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110616161A (en) * | 2019-09-25 | 2019-12-27 | 江南大学 | Method for regulating oxygen stress of saccharomyces cerevisiae by using Y-family polymerase Rev1 |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104789600A (en) * | 2015-04-24 | 2015-07-22 | 江南大学 | Method for improving acid stress resistance of candida glabrata |
| CN105400770A (en) * | 2015-12-07 | 2016-03-16 | 江南大学 | Method for regulating acid stress resistance of torulopsis glabrata by utilizing transcription factor Crz1p |
| CN109266566A (en) * | 2018-10-12 | 2019-01-25 | 江南大学 | A method of it adjusting torulopsis glabrata and permeates pressure stress |
-
2019
- 2019-06-10 CN CN201910497267.9A patent/CN110184204B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104789600A (en) * | 2015-04-24 | 2015-07-22 | 江南大学 | Method for improving acid stress resistance of candida glabrata |
| CN105400770A (en) * | 2015-12-07 | 2016-03-16 | 江南大学 | Method for regulating acid stress resistance of torulopsis glabrata by utilizing transcription factor Crz1p |
| CN109266566A (en) * | 2018-10-12 | 2019-01-25 | 江南大学 | A method of it adjusting torulopsis glabrata and permeates pressure stress |
Non-Patent Citations (5)
| Title |
|---|
| CHENGJIN WU,ET AL.: ""CgHog1-mediated CgRds2 phosphorylation alters glycerophospholipid composition to coordinate osmotic stress in Candida glabrata"", 《APPLIED AND ENVIRONMENTAL MICROBIOLOGY》 * |
| INMACULADA MORENO, ET AL.: ""Saccharomyces cerevisiae Rds2 transcription factor involvement in cell wall composition and architecture"", 《INTERNATIONAL MICROBIOLOGY》 * |
| NITNIPA SOONTORNGUN,ET AL.: ""Regulation of gluconeogenesis in saccharomyces cerevidiae is mediated by activatior and repressor functions of RDS2"", 《MOLECULAR AND CELLULAR BIOLOGY》 * |
| 吴承晋: ""光滑球拟酵母转录因子CgRds2应答环境胁迫的生理机制"", 《中国优秀硕士学位论文全文数据库（基础科技辑）》 * |
| 闫冬妮: ""转录因子Crz1p调控光滑球拟酵母应答酸胁迫的生理机制"", 《中国优秀硕士学位论文全文数据库（基础科学辑）》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110616161A (en) * | 2019-09-25 | 2019-12-27 | 江南大学 | Method for regulating oxygen stress of saccharomyces cerevisiae by using Y-family polymerase Rev1 |
| CN110616161B (en) * | 2019-09-25 | 2021-07-27 | 江南大学 | Method for regulating oxygen stress of saccharomyces cerevisiae by using Y-family polymerase Rev1 |
Also Published As
| Publication number | Publication date |
|---|---|
| CN110184204B (en) | 2020-09-04 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105229154A (en) | Constitutive promoter | |
| Zhu et al. | The Pal pathway required for ambient pH adaptation regulates growth, conidiation, and osmotolerance of Beauveria bassiana in a pH-dependent manner | |
| Nakazawa et al. | Mutations in the Cc. rmt1 gene encoding a putative protein arginine methyltransferase alter developmental programs in the basidiomycete Coprinopsis cinerea | |
| Zhang et al. | 14-3-3 proteins are involved in growth, hyphal branching, ganoderic acid biosynthesis, and response to abiotic stress in Ganoderma lucidum | |
| Wu et al. | A WD40 protein encoding gene Fvcpc2 positively regulates mushroom development and yield in Flammulina velutipes | |
| CN109266566A (en) | A method of it adjusting torulopsis glabrata and permeates pressure stress | |
| Zhang et al. | Creation of an ethanol-tolerant Saccharomyces cerevisiae strain by 266 nm laser radiation and repetitive cultivation | |
| CN106916837A (en) | Hyperosmosis glycerine protein kinase gene RkHog1 and its recombinant expression carrier | |
| CN101473035B (en) | Method for reinforcing secretion efficiency of recombination exogenous protein in sprout fungi expression system | |
| CN110184204A (en) | A method of adjusting the low pH stress of resistance of Torulopsis glabrata to hyper | |
| Wang et al. | Role of AcndtA in cleistothecium formation, osmotic stress response, pigmentation and carbon metabolism of Aspergillus cristatus | |
| Nakazawa et al. | A mutation in the Cc. ubc2 gene affects clamp cell morphogenesis as well as nuclear migration for dikaryosis in Coprinopsis cinerea | |
| Chu et al. | Vital role for cyclophilin B (CypB) in asexual development, dimorphic transition and virulence of Beauveria bassiana | |
| CN107603987B (en) | Application of ganoderma lucidum transcription factor SKN7 gene in regulation and control of ganoderma lucidum triterpene biosynthesis | |
| CN107287197B (en) | Histidine attenuator mutants and histidine operons addressing feedback repression and their uses | |
| Hinterdobler et al. | Integration of chemosensing and carbon catabolite repression impacts fungal enzyme regulation and plant associations | |
| Ding et al. | Essential roles of ferric reductase-like proteins in growth, development, stress response, and virulence of the filamentous entomopathogenic fungus Beauveria bassiana | |
| JP6206408B2 (en) | Schizosaccharomyces pombe mutant transformant and cloning vector | |
| AU2016361701A1 (en) | Green algae mutant exhibiting resistance to intense light, and use thereof | |
| US20120096596A1 (en) | Regulators involved in mushroom formation | |
| US5821038A (en) | Yeast with modified permeability | |
| CN104711284A (en) | Method for improving sulfur-tolerant capability of saccharomyces uvarum by transforming SSU1 gene and identification method | |
| CN109321618A (en) | A method of yield of erythrocin is improved by the red mould SACE_5717 gene of the more spores of sugar | |
| JP2012518437A (en) | Materials and methods for identifying and using yeast strains that metabolize pentose sugars in the presence of D-glucose | |
| CN110616161B (en) | Method for regulating oxygen stress of saccharomyces cerevisiae by using Y-family polymerase Rev1 |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |