CN112522285B - Temperature control expression system and application - Google Patents
Temperature control expression system and application Download PDFInfo
- Publication number
- CN112522285B CN112522285B CN202011521964.2A CN202011521964A CN112522285B CN 112522285 B CN112522285 B CN 112522285B CN 202011521964 A CN202011521964 A CN 202011521964A CN 112522285 B CN112522285 B CN 112522285B
- Authority
- CN
- China
- Prior art keywords
- temperature
- expression
- gene
- promoter
- protein
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/65—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression using markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/70—Vectors or expression systems specially adapted for E. coli
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2795/00—Bacteriophages
- C12N2795/00011—Details
- C12N2795/00022—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
Abstract
The mutant CI857 used by the invention can improve the induction effect by 13.8 times in shake flask fermentation at 37 ℃ within 9h compared with the original strain CI857, and basically keeps the same repression effect with the original strain at 30 ℃, and can obviously improve the expression quantity of target protein, so the invention can be used as a temperature control system for efficiently expressing heterologous protein.
Description
Technical Field
The invention relates to a temperature control expression system and application, in particular to a method for efficiently expressing heterologous protein in escherichia coli by temperature control and application thereof, belonging to the technical field of biology.
Background
As recombinant protein produced in Escherichia coli has the characteristics of simple operation, low production cost and the like, people have conducted extensive research on a large intestine bacillus expression system, and a large number of inducible expression systems are developed to meet the requirement of realizing different gene expression levels under different conditions (such as temperature or pH), so that the recombinant protein can be used for producing proteins toxic to host cells and ensuring the stability of expression plasmids. However, chemical inducers such as IPTG are expensive, toxic and may require separation and purification from the product, complicating downstream operations and increasing production costs. When the exogenous gene expression is controlled by using temperature regulation, the addition of a chemical inducer can be avoided, the operation is simple, and the cost is reduced.
A commonly used temperature-controlled expression system is λ P R /P L -CI857, wherein CI587 is a temperature sensitive mutant of the CI repressor protein from bacteriophage lambda, mutated at amino acid 67 of the CI amino terminal region: ala to Thr. The mutant retains wild-type characteristics at low temperatures (e.g., 28-30 ℃) and is unstable at elevated temperatures (e.g., 37-42 ℃) and thus changes from P R /P L The operation region of the promoter is dissociated, and thus, the promoter.lambda.P can be controlled by adjusting the culture temperature R /P L The switching off and on of the downstream gene transcription expression realizes the regulation of the expression of heterologous proteins by physical means. Lambdap R /P L the-CI 857 temperature control system has been widely used for the production of heterologous proteins in gram-negative bacteria such as E.coli, Bacillus subtilis, etc., and in particular for the production of recombinant proteins for pharmaceutical use, such as recombinant human growth hormone (rHGH), insulin, interferon, etc. Lambdap R /P L the-CI 857 temperature control system has important biotechnological significance.
However,. lambda.P R /P L The CI857 temperature-controlled expression system also has some disadvantages, for example, it requires induction at 42 ℃ to achieve optimal expression level, and at too high temperature, the protein is more prone to misfolding and activation of heat shock proteins during protein synthesis, thereby forming inclusion bodies, resulting in reduction of protein activity and expression level. In addition, the existing temperature-sensitive CI857 temperature control system has the phenomenon of low-temperature condition leakage, the temperature control performance is still insufficient, and the requirement of high-efficiency controllable induction expression cannot be met. Therefore, it is urgently needed to screen an expression element with better temperature control performance, reduce the temperature of protein induced expression and improve the expression strength of target protein in a temperature control system.
Disclosure of Invention
[ problem ] to
The protein expression quantity of the repressor protein in the existing temperature-induced expression system is low when the temperature is raised, an inclusion body is easily formed, the high-efficiency expression of heterologous protein is not favorably induced, and the phenomenon of low-temperature condition leakage exists at low temperature. In addition, the existing method for qualitatively evolving repressor protein has the problems of large mutant library and large screening workload.
[ solution ]
According to the invention, the repressor protein mutant which is more sensitive to temperature and has better induction effect is obtained through a high-throughput screening method, and an efficient temperature control expression system is established for efficiently and controllably expressing heterologous proteins.
The invention provides a gene for coding the lambda phage CI temperature-sensitive repressor mutant, and the nucleotide sequence of the gene is shown in SEQ ID NO. 1.
The present invention provides a temperature control system for efficient expression of a heterologous protein, the system comprising: a host, an expression vector for expressing a gene of interest and a repressor protein;
the host can be Escherichia coli and other gram-negative bacteria such as Erwinia, Serratia and Pseudomonas, and can also be gram-positive bacteria Bacillus subtilis;
the vector for expressing the target gene carries a promoter capable of being combined with the lambda phage CI temperature-sensitive repressor mutant, and the target gene to be expressed is positioned at the downstream of the promoter;
the expression vector for expressing the repressor carries a constitutive promoter, and has a nucleotide sequence which is shown in SEQ ID No.1 and encodes a lambda phage CI temperature-sensitive repressor mutant at the downstream of the constitutive promoter, wherein the expression vector can be a low copy plasmid (such as pACYCDuet-1), a medium copy plasmid (such as pCDFDuet-1) and a high copy plasmid (such as pRSFDuet-1), and can meet different heterologous expression requirements in host cells.
For example, E.coli BL21(DE3) as host, pACYCDuet-1 as vector for expressing target gene, and Lambda phagePromoter lambda P R A promoter as a gene of interest; pRSFDuet-1 was used as an expression vector for repression of proteins and P was constitutively expressed asnS The promoter promotes the expression of the lambda phage temperature-sensitive repressor mutant. When the temperature is lower than 30 ℃, the lambda phage temperature-sensitive repressor mutant can react with lambda P R Binding the control region of the promoter, thereby inhibiting the transcriptional expression of the target gene; when the temperature is higher than 37 ℃, the temperature-sensitive repressor mutant of the lambda phage is separated from lambda P R The promoter manipulation region is dissociated, and the RNA polymerase is capable of transcription, thereby expressing the target gene.
The invention also provides a method for preparing the lambda phage CI temperature-sensitive repressor mutant, which comprises the following steps: amplifying to obtain a temperature-sensitive CI857 gene; then, carrying out random mutation on the CI857 gene by using an error-prone PCR method to obtain a random mutation gene library CI 857; then transferring the recombinant expression vector containing the random mutant gene library and the vector carrying the reporter gene into the enterobacter, and screening by utilizing the reporter protein to obtain a CI repressor protein mutant with obviously enhanced induction effect under the condition of temperature rise and good repressor effect under the condition of low temperature; the gene sequence of the CI repressor mutant was changed 3 times compared to that of CI857, i.e., Δ T57, a400T, and T418A.
In one embodiment of the invention, the expression vector used to express the gene encoding the repressor protein is pRSFDuet-1. The gene encoding the repressor protein is located behind a constitutive promoter.
In one embodiment of the invention, the reporter protein may be selected from the fluorescent protein EGFP. The coding gene of the fluorescent reporter protein is connected to pACYCDuet-1 and then transferred into Escherichia coli.
In one embodiment of the invention, the screening may be high throughput screening using flow cytometry. Specifically, cells transformed with a recombinant vector in which random mutation of repressor protein occurs and a vector carrying a reporter gene are sorted by flow cytometry.
In one embodiment of the present invention, the following steps may be employed:
(1) will be provided withConstruction of a Gene encoding repressor protein CI derived from bacteriophage lambda to contain constitutive promoter P asnS On the plasmid pRSFDuet-1 of the promoter, a pRSFDuet-CI plasmid is obtained;
(2) site-directed mutagenesis is carried out on pRSFDuet-CI plasmid to obtain a gene coding temperature-sensitive repressor CI857 with A67T mutation and the corresponding plasmid pRSFDuet-CI 857;
(3) then, the green fluorescent protein reporter gene EGFP is constructed to contain a promoter lambda P from the lambda phage R On plasmid pACYCDuet-1 to obtain pACYCDuet-lambda P R- An EGFP plasmid;
(4) randomly introducing mutation into a gene encoding a temperature-sensitive CI857 repressor protein by using an error-prone PCR kit through low-fidelity DNA polymerase to obtain a CI857 gene fragment, and constructing a mutation library in vitro to obtain pRSFduet-CI857 plasmid;
(5) transforming the pACYCDuet-EGFP plasmid and the pRSFduet-CI857 plasmid into E.coli BL21 to obtain a mutant library expressing the genes of the suppressor protein;
(6) the temperature-sensitive CI857 repressor protein can react with lambda P at the temperature lower than 30 DEG C R The operation region of the promoter is combined, so that the transcription expression of the green fluorescent protein gene is inhibited; at temperatures above 37 ℃ the repressor protein is derived from lambda P R The control region of the promoter is dissociated, and RNA polymerase can perform transcription, so that green fluorescent protein is expressed; cells with higher fluorescence intensity under the culture condition of 37 ℃ are preliminarily sorted by adopting a flow cytometer, so that a CI857 mutant with obviously enhanced induction effect at 37 ℃ can be conveniently obtained; then screening cells with lower fluorescence intensity under the culture condition of 30 ℃ to obtain a CI857 mutant with good 30 ℃ repression effect;
(7) culturing the sorted cells under different temperature conditions for re-screening to obtain a CI857 mutant with obviously enhanced induction effect at 37 ℃ and good repression effect at 30 ℃;
(8) shake flask fermentations verified the effect of CI857 × mutant on inducing expression of other proteins.
The present invention also provides a method of using the temperature control system for the efficient expression of heterologous proteins, by placing a gene encoding a target protein to be expressed downstream of a temperature-inducible promoter, and transforming a recombinant expression vector into a host; the gene of the CI temperature-sensitive repressor mutant of the lambda phage is positioned at the downstream of a constitutive promoter, then is connected to an expression vector and is transferred to a host, the host cell is cultured, and the expression of the target protein is realized by regulating and controlling the temperature. By changing the temperature, the lambda phage CI temperature-sensitive repressor mutant can be combined with or separated from a temperature-induced promoter, so that the target protein is repressed and expressed.
[ advantageous effects ]
The invention provides a repressor protein mutant which can efficiently express heterologous protein in an escherichia coli body under the temperature control, does not need to add an inducer, and can induce the expression quantity of target protein to be improved by about 13.8 times compared with the original CI857 strain under the high-temperature condition (37 ℃). Can be used as a temperature control system for high-efficiency expression of heterologous proteins, and can remarkably improve the expression quantity of downstream genes.
The invention randomly introduces mutation to the temperature-sensitive repressor protein gene by low fidelity DNA polymerase, constructs a mutation library, and then carries out high-throughput screening by a flow cytometer, selects the repressor protein with good repression effect at 30 ℃ and remarkably improved induction effect at 37 ℃, and improves the screening efficiency.
Drawings
FIG. 1 map of expression vector of temperature sensitive repressor CI 857.
FIG. 2 Green fluorescent protein reporter gene EGFP vector map.
FIG. 3 construction of λ P R Schematic representation of the-CI 857 expression system.
Figure 4CI857 schematic in vitro directed evolution.
FIG. 5 flow cytometer detection and sorting results.
FIG. 696 results of the well-plate double screen experiment.
FIG. 7A flask verifies the intensity of fluorescence expression per cell when the temperature control system is turned off at 30 ℃ and turned on at 37 ℃.
Detailed Description
The invention constructs a mutation library in vitro by using error-prone PCR, and then carries out high-throughput screening by using a flow cytometer to rapidly evolve a target gene and obtain a CI857 mutant with obviously enhanced induction effect at 37 ℃.
Example 1 construction of a library of mutants
1. Construction of a temperature-sensitive repressor CI857 expression vector:
designing a primer:
P asnS -F：CACGGCCGCATAATCGAAATtctttcgctgcatttgcgaat
P asnS -R：ggtatatctccttaatattctctctgttaatagtcggaa
CI-F：gagaatattaaggagatataccATGAGCACAAAAAAG
CI-R：GGCAGCAGCCTAGGTTAATCAGCCAAACGTCTCTTCAGGC
pRSFduet-F：TTAACCTAGGCTGCTGCCACCG
pRSFduet-R：TTCGATTATGCGGCCGTGTACAAT
CI(A67T)-F：GCATTGCTTACAAAAATTCTCAAAGTTAGCGTTGAAGAATt
CI(A67T)-R：CATTGGGTACAGTGGGTTTAGTGGTTGTAAAAACAC
the pRSFduet-1 vector, a promoter gene fragment derived from Escherichia coli and a repressor CI gene fragment were amplified by conventional PCR: amplification of pRSFduet-1 vector with primer pRSFduet-F/pRSFduet-R and primer P asnS -F/P asnS -R amplifying the promoter gene fragment and using CI-F/CI-R to amplify the repressor CI gene.
And carrying out homologous recombination on the pRSFduet-1 vector obtained by the last step of amplification, a promoter gene fragment and a repressor CI gene fragment by Gibson assembly to obtain a pRSFduet-CI plasmid.
The pRSFDuet-CI plasmid was subjected to circular PCR using the primers CI (A67T) -F/CI (A67T) -R to obtain pRSFDuet-CI857 plasmid (FIG. 1).
2. Construction of pACYCDuet-lambda PR-EGFP reporter vector:
designing a primer:
λP R -F：
gtgcgtgTTGACTATTTTACCTCTGGCGGTGATAATGGTTGCACCATCTTAGTATATTAGTTAA GTATAAGAAGGAGATATACATatg
λP R- R:
GTAAAATAGTCAAcacgcacggtgttagatatttatcccttgcggtgatagatttaacgtatgATTTCGATTATGCGGCC GTGTAC
EGFP-F：atgggtaagggagaagaacttttcac
EGFP-R：TGGCAGCAGCCTAGGTTAAttatttgtatagttcatccatgccatgtgt
pACYC-F：TTAACCTAGGCTGCTGCCACC
pACYC-R：ttcttctcccttacccatATGTATATCTCCTTCTTATACTTAACTAATATACTAAGATG
with primer lambda P R -F/λP R -R circular PCR of plasmid pACYCDuet-1 to obtain plasmid pACYCDuet-lambda P R 。
Amplification of pACYCDuet-Lambda P Using conventional PCR R Plasmid backbone and EGFP gene fragment: amplification of pACYCDuet-lambda P with primers pACYC-F/pACYC-R R And (3) a carrier, wherein the EGFP gene segment is amplified by using a primer EGFP-F/EGFP-R.
pACYCDuet-Lambda P obtained in the previous step by Gibson assembly R Assembling the carrier segment and EGFP gene segment to obtain plasmid pACYCDuet-lambda P R EGFP (FIG. 2).
3. Construction of a gene mutation library:
designing a primer:
CI*-F：gagaatattaaggagatataccATGAGCACAAAAAAG
CI*-R：GGCAGCAGCCTAGGTTAATCAGCCAAAC
PRSF-F：ATTAACCTAGGCTGCTGCCAC
PRSF-R：ggtatatctccttaatattctctctgttaatagtcggaa
using error-prone PCR kit and using CI-F/CI-R as primer and CI857 gene as template to amplify CI857 gene library of random mutation of coding repressor protein, and using PRSF-F/PRSF-R primer to amplify pRSFDuet-CI857 carrier fragment by conventional PCR.
The pRSFDuet-1 vector fragment was assembled with the repressor CI857 gene fragment by Gibson assembly to obtain a pRSFduet-CI857 plasmid mutant library.
pRSFduet-CI857 plasmids obtained in the above step were transformed to contain pACYCDuet-Lambda P R E. coli BL21 of EGFP plasmid (DE3), obtaining a library of mutants, constructing P R -CI857 expression system for subsequent high throughput screening (fig. 3). Transformants were randomly picked and plasmids extracted for CI857 gene sequencing, and the sequencing results were compared to calculate the average mutation rate, about 5.6mutations/1 kb.
Example 2 screening of mutant pools and Shake flask validation
1. Screening cells with enhanced fluorescence intensity using flow cytometry:
the temperature sensitive type CI857 can react with lambda P at the temperature lower than 30 DEG C R The operation region of the promoter is combined, so that the transcription expression of the green fluorescent protein gene is inhibited; at temperatures above 37 ℃ the repressor protein is derived from lambda P R The promoter manipulation region is dissociated, and RNA polymerase can perform transcription, thereby expressing green fluorescent protein. Initially sorting out cells with higher fluorescence intensity under the culture condition of 37 ℃ by adopting a flow cytometer, so as to obtain a CI857 mutant with obviously enhanced induction effect at 37 ℃; and then screening cells with lower fluorescence intensity under the culture condition of 30 ℃ to obtain the CI857 mutant with good repression effect at 30 ℃.
As shown in FIG. 4, the vector carrying pRSFduet-CI857 plasmid, pACYCDuet-lambda P, was used before flow cytometry sorting R E.coli BL21(DE3) bacterial liquid of EGFP plasmid was transferred to liquid LB and cultured overnight (about 10 h) in a constant temperature shaker at 37 ℃; taking a proper amount of culture solution, centrifuging, collecting thalli, diluting with phosphate buffer solution, and resuspending to OD 600 Around 0.3, 10000 cells with higher fluorescence were sorted out using a flow sorter (region in box in fig. 5A).
The sorted cells were incubated overnight (around 14 h) in a 30 ℃ constant temperature shaker, and 5000 cells with lower fluorescence were sorted out again by flow cytometry (region in box in FIG. 5B).
The cells sorted in the previous step were plated on a plate and cultured at 37 ℃ (about 10 h). About 768 single colonies were randomly picked to contain pRSFDuet-CI857 plasmid, pACYCDuet-lambda P R EGFP plasmid as a control strain was inoculated into 96 shallow well plates (200. mu.L of liquid LB) and cultured in a shaker at 30 ℃After about 9 hours, the cells were transferred to a 96 deep well plate (800. mu.L liquid TB) at an inoculum size of 5% and incubated at 37 ℃ for about 9 hours at 30 ℃. Centrifuging at 4000r/min to collect thalli, and discarding supernatant; suspending the cells by phosphate buffer solution, centrifuging at 4000r/min to collect thalli, and discarding the supernatant. After suspending the cells in the same volume of phosphate buffer, the cells were diluted to an appropriate concentration, and the fluorescence intensity expressed per OD of the cells at 30 ℃ and 37 ℃ was measured (FIG. 6).
2. Shake flask fermentation validation
From the above step, a strain (No. M1) having a low fluorescence intensity expressed by 30 ℃ unit cell OD and a highest fluorescence intensity expressed by 37 ℃ unit cell OD was selected and sequenced, and its DNA sequence was changed at 3 sites, that is, Δ T57, A400T and T418A, from the template (CI857) DNA sequence before error-prone PCR.
Coli BL21(DE3) strain containing only pRSFDuet-CI857 plasmid was used as a blank to contain pRSFDuet-CI857 plasmid, pACYCDuet-lambda P R E.coli BL21(DE3) strain of EGFP plasmid as Control (Control), M1 strain was shake-flask fermented. Picking single colony to 50mL triangular flask (20mL liquid LB) respectively, and culturing overnight at 30 ℃; inoculating to 50mL triangular flask (25mL liquid TB) with 1% inoculum size, and shake-culturing OD at 30 ℃ 600 To 0.4-0.6, and culturing at 30 deg.C and 37 deg.C respectively, and sampling at 3h (FIG. 7A), 6h (FIG. 7B), and 9h (FIG. 7C) to determine the fluorescence intensity expressed by unit cell OD.
As shown in FIG. 7, the screened mutant M1 strain has basically the same repression effect as the original strain after shaking flask fermentation at 30 ℃ for 3h, 6h and 9h, and the induction effect at 37 ℃ is greatly improved, the expression quantity of the fluorescent protein at 37 ℃ is 134.8 times of that at 30 ℃ at 9h, and the induction effect is improved by about 13.8 times compared with the original CI857 strain. The mutant M1 is shown to be capable of obviously improving the protein expression at the same induction temperature, and can be used as a temperature control system for efficiently expressing heterologous proteins.
Example 3A lambda phage CI temperature sensitive repressor mutant
A lambda phage CI temperature-sensitive repressor mutant has a nucleotide sequence shown in SEQ ID NO. 1. The preparation method can adopt the following steps:
(1) construction of a Gene encoding repressor protein CI derived from bacteriophage lambda to contain constitutive promoter P asnS On the plasmid pRSFDuet-1 of the promoter, a pRSFDuet-CI plasmid is obtained;
(2) site-directed mutagenesis is carried out on pRSFDuet-CI plasmid to obtain a gene coding temperature-sensitive repressor CI857 with A67T mutation and the corresponding plasmid pRSFDuet-CI 857;
(3) pRSFDuet-CI857 was then mutated as follows: carrying out deletion mutation on a 57 th nucleotide T in a gene coding a temperature-sensitive repressor CI857, mutating a400 th nucleotide A into T and mutating a 418 th nucleotide T into A;
(4) and (4) transferring the mutated vector obtained in the step (3) into a host for expression to obtain the lambda phage CI temperature-sensitive repressor mutant.
Example 4 temperature control System for high expression of heterologous proteins
A temperature control system for the efficient expression of a heterologous protein, the system comprising: a host, an expression vector for expressing a gene of interest and a repressor protein;
the host can be Escherichia coli and other gram-negative bacteria such as Erwinia, Serratia and Pseudomonas, and can also be gram-positive bacteria Bacillus subtilis;
the vector for expressing the target gene carries a promoter capable of being combined with the lambda phage CI temperature-sensitive repressor mutant, and the target gene to be expressed is positioned at the downstream of the promoter;
the expression vector for expressing the repressor carries a constitutive promoter, and has a nucleotide sequence for coding a lambda phage temperature-sensitive repressor mutant at the downstream of the constitutive promoter as shown in SEQ ID NO.1, and can be a low-copy plasmid (such as pACYCDuet-1), a medium-copy plasmid (such as pCDFDuet-1) and a high-copy plasmid (such as pRSFDuet-1) so as to meet different heterologous expression requirements in host cells.
For example, E.coli BL21(DE3) as a host, pACYCDuet-1 as a vector for expressing a target gene, and lambda phage promoterSub lambda P R A promoter as a target gene; pRSFDuet-1 is used as an expression vector for expressing repressor protein, and P is a constitutive component asnS The promoter promotes the expression of the lambda phage temperature-sensitive repressor mutant. When the temperature is lower than 30 ℃, the lambda phage temperature-sensitive repressor mutant can be combined with lambda P R Binding the control region of the promoter, thereby inhibiting the transcriptional expression of the target gene; when the temperature is higher than 37 ℃, the temperature-sensitive repressor mutant of the lambda phage is separated from lambda P R The promoter manipulation region is dissociated, and RNA polymerase can perform transcription, thereby expressing the target gene.
Nucleotide sequence of coding gene of lambda phage temperature-sensitive repressor mutant SEQ ID NO. 1:
ATGAGCACAAAAAAGAAACCATTAACACAAGAGCAGCTTGAGGACGCACGTC GCCTAAAGCAATTTATGAAAAAAAGAAAAATGAACTTGGCTTATCCCAGGAATCTG TCGCAGACAAGATGGGGATGGGGCAGTCAGGCGTTGGTGCTTTATTTAATGGCATC AATGCATTAAATGCTTATAACGCCGCATTGCTTACAAAAATTCTCAAAGTTAGCGTT GAAGAATTTAGCCCTTCAATCGCCAGAGAAATCTACGAGATGTATGAAGCGGTTAGT ATGCAGCCGTCACTTAGAAGTGAGTATGAGTACCCTGTTTTTTCTCATGTTCAGGCA GGGATGTTCTCACCTAAGCTTAGAACCTTTACCAAAGGTGATGCGGAGAGATGGGT AAGCACATCCAAAAAAGCCAGTGATACTGCATTCTGGCTTGAGGTTGAAGGTAATT CCATGACCGCACCAACAGGCTCCAAGCCAAGCTTTCCTGACGGAATGTTAATTCTC GTTGACCCTGAGCAGGCTGTTGAGCCAGGTGATTTCTGCATAGCCAGACTTGGGGG TGATGAGTTTACCTTCAAGAAACTGATCAGGGATAGCGGTCAGGTGTTTTTACAACC ACTAAACCCACAGTACCCAATGATCCCATGCAATGAGAGTTGTTCCGTTGTGGGGA AAGTTATCGCTAGTCAGTGGCCTGAAGAGACGTTTGGCTGA
although the present invention has been described with reference to the preferred embodiments, it should be understood that various changes and modifications can be made therein by those skilled in the art without departing from the spirit and scope of the invention as defined in the appended claims.
SEQUENCE LISTING
<110> university of south of the Yangtze river
<120> temperature control expression system and application
<130> BAA201299A
<160> 19
<170> PatentIn version 3.3
<210> 1
<211> 713
<212> DNA
<213> Artificial sequence
<400> 1
atgagcacaa aaaagaaacc attaacacaa gagcagcttg aggacgcacg tcgcctaaag 60
caatttatga aaaaaagaaa aatgaacttg gcttatccca ggaatctgtc gcagacaaga 120
tggggatggg gcagtcaggc gttggtgctt tatttaatgg catcaatgca ttaaatgctt 180
ataacgccgc attgcttaca aaaattctca aagttagcgt tgaagaattt agcccttcaa 240
tcgccagaga aatctacgag atgtatgaag cggttagtat gcagccgtca cttagaagtg 300
agtatgagta ccctgttttt tctcatgttc aggcagggat gttctcacct aagcttagaa 360
cctttaccaa aggtgatgcg gagagatggg taagcacatc caaaaaagcc agtgatactg 420
cattctggct tgaggttgaa ggtaattcca tgaccgcacc aacaggctcc aagccaagct 480
ttcctgacgg aatgttaatt ctcgttgacc ctgagcaggc tgttgagcca ggtgatttct 540
gcatagccag acttgggggt gatgagttta ccttcaagaa actgatcagg gatagcggtc 600
aggtgttttt acaaccacta aacccacagt acccaatgat cccatgcaat gagagttgtt 660
ccgttgtggg gaaagttatc gctagtcagt ggcctgaaga gacgtttggc tga 713
<210> 2
<211> 41
<212> DNA
<213> Artificial sequence
<400> 2
cacggccgca taatcgaaat tctttcgctg catttgcgaa t 41
<210> 3
<211> 39
<212> DNA
<213> Artificial sequence
<400> 3
ggtatatctc cttaatattc tctctgttaa tagtcggaa 39
<210> 4
<211> 37
<212> DNA
<213> Artificial sequence
<400> 4
gagaatatta aggagatata ccatgagcac aaaaaag 37
<210> 5
<211> 40
<212> DNA
<213> Artificial sequence
<400> 5
ggcagcagcc taggttaatc agccaaacgt ctcttcaggc 40
<210> 6
<211> 22
<212> DNA
<213> Artificial sequence
<400> 6
ttaacctagg ctgctgccac cg 22
<210> 7
<211> 24
<212> DNA
<213> Artificial sequence
<400> 7
ttcgattatg cggccgtgta caat 24
<210> 8
<211> 41
<212> DNA
<213> Artificial sequence
<400> 8
gcattgctta caaaaattct caaagttagc gttgaagaat t 41
<210> 9
<211> 36
<212> DNA
<213> Artificial sequence
<400> 9
cattgggtac agtgggttta gtggttgtaa aaacac 36
<210> 10
<211> 88
<212> DNA
<213> Artificial sequence
<400> 10
gtgcgtgttg actattttac ctctggcggt gataatggtt gcaccatctt agtatattag 60
ttaagtataa gaaggagata tacatatg 88
<210> 11
<211> 86
<212> DNA
<213> Artificial sequence
<400> 11
gtaaaatagt caacacgcac ggtgttagat atttatccct tgcggtgata gatttaacgt 60
atgatttcga ttatgcggcc gtgtac 86
<210> 12
<211> 26
<212> DNA
<213> Artificial sequence
<400> 12
atgggtaagg gagaagaact tttcac 26
<210> 13
<211> 49
<212> DNA
<213> Artificial sequence
<400> 13
tggcagcagc ctaggttaat tatttgtata gttcatccat gccatgtgt 49
<210> 14
<211> 21
<212> DNA
<213> Artificial sequence
<400> 14
ttaacctagg ctgctgccac c 21
<210> 15
<211> 59
<212> DNA
<213> Artificial sequence
<400> 15
ttcttctccc ttacccatat gtatatctcc ttcttatact taactaatat actaagatg 59
<210> 16
<211> 37
<212> DNA
<213> Artificial sequence
<400> 16
gagaatatta aggagatata ccatgagcac aaaaaag 37
<210> 17
<211> 28
<212> DNA
<213> Artificial sequence
<400> 17
ggcagcagcc taggttaatc agccaaac 28
<210> 18
<211> 21
<212> DNA
<213> Artificial sequence
<400> 18
attaacctag gctgctgcca c 21
<210> 19
<211> 39
<212> DNA
<213> Artificial sequence
<400> 19
ggtatatctc cttaatattc tctctgttaa tagtcggaa 39
Claims (6)
1. The gene for coding the lambda phage CI temperature-sensitive repressor mutant is characterized in that the nucleotide sequence is shown as SEQ ID NO. 1.
2. A temperature control system for efficient expression of a heterologous protein, the system comprising: a host, an expression vector for expressing a gene of interest and a repressor protein; the coding gene of the repressor protein is shown as SEQ ID NO. 1;
the vector for expressing the target gene carries a promoter lambda P capable of being combined with a lambda phage CI temperature-sensitive repressor mutant R The target gene to be expressed is positioned at the downstream of the promoter;
the expression vector for expressing repressor carries a constitutive promoter, and has a nucleotide sequence encoding a lambda phage CI temperature-sensitive repressor mutant at the downstream of the constitutive promoter.
3. The temperature control system for efficient expression of heterologous proteins according to claim 2, wherein the host is E.coli.
4. The temperature control system for efficient expression of heterologous proteins according to claim 2, wherein the expression vector is selected from the group consisting of low copy plasmid, medium copy plasmid, high copy plasmid.
5. The temperature control system for efficient expression of heterologous proteins according to claim 4, wherein the temperature control system is used forE. coli BL21(DE3) as host, pACYCDuet-1 as vector for expressing target gene, and lambda phage promoter lambda P R A promoter as a gene of interest; pRSFDuet-1 is used as an expression vector for expressing repressor protein, and P is constitutive asnS The promoter promotes the expression of the lambda phage temperature-sensitive repressor mutant.
6. The method of using the temperature control system for high-efficiency expression of a heterologous protein according to claim 2, wherein the gene encoding the desired protein to be expressed is placed in the temperature-inducible promoter λ P R And transforming the recombinant expression vector into a host; the gene of the CI temperature-sensitive repressor mutant of the lambda phage is placed at the downstream of a constitutive promoter, then is connected to an expression vector and is transferred to a host, the host cell is cultured, and the expression of the target protein is realized by regulating and controlling the temperature.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202011521964.2A CN112522285B (en) | 2020-12-22 | 2020-12-22 | Temperature control expression system and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202011521964.2A CN112522285B (en) | 2020-12-22 | 2020-12-22 | Temperature control expression system and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN112522285A CN112522285A (en) | 2021-03-19 |
| CN112522285B true CN112522285B (en) | 2022-09-06 |
Family
ID=75002268
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202011521964.2A Active CN112522285B (en) | 2020-12-22 | 2020-12-22 | Temperature control expression system and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN112522285B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114672502A (en) * | 2022-01-06 | 2022-06-28 | 清华大学 | Construction method of temperature-controlled cell-free reaction system, plasmid used by method and application |
| CN116947980B (en) * | 2023-07-26 | 2024-04-12 | 广州普言生物科技有限公司 | Temperature control expression system and construction method thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107344962A (en) * | 2016-05-04 | 2017-11-14 | 中国科学院微生物研究所 | Aporepressor, controlling element group and Gene expression regulation system and its construction method |
| CN108611357A (en) * | 2016-12-13 | 2018-10-02 | 上海凯赛生物技术研发中心有限公司 | A kind of recombinant expression plasmid, transformant and its application |
-
2020
- 2020-12-22 CN CN202011521964.2A patent/CN112522285B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107344962A (en) * | 2016-05-04 | 2017-11-14 | 中国科学院微生物研究所 | Aporepressor, controlling element group and Gene expression regulation system and its construction method |
| CN108611357A (en) * | 2016-12-13 | 2018-10-02 | 上海凯赛生物技术研发中心有限公司 | A kind of recombinant expression plasmid, transformant and its application |
Non-Patent Citations (5)
| Title |
|---|
| A Fine Structure Map of Spontaneous and Induced Mutations in the Lambda Repressor Gene, Including Insertions of IS Elements;M. Lieb;《Mol Gen Genet》;19811231;第184卷;第364-371页 * |
| In vivo recombineering of bacteriophage E by PCR fragments and single-strand oligonucleotides;Amos B. Oppenheim,et al;《Virology》;20041231;第319卷;第185-189页 * |
| Isolation and Characterization of Deletions in Bacteriophage Residing as Prophage in E. coli K12;M. Castellazzi，et al;《Molcc.gen. Genet.》;19721231;第117卷;第211-218页 * |
| The Construction in vitro of Transducing Derivatives of Phage Lambda;Kathleen Borck，et al;《Molec. gen. Gene.》;19761231;第146卷;第199-207页 * |
| The X repressor contains two domains;CARL 0. PABO，et al;《Proc. Natl. Acad. Sci. USA》;19790430;第76卷(第4期);第1608-1612页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN112522285A (en) | 2021-03-19 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20210348205A1 (en) | Expression System | |
| CN112522285B (en) | Temperature control expression system and application | |
| CN109486847B (en) | Bacillus subtilis efficient induction expression system based on artificial tandem promoter | |
| EP2147106B1 (en) | Expression system | |
| US9163247B2 (en) | Vector comprising mannose promoter and mannose promoter | |
| CN111041029B (en) | Strong promoter and application thereof in production of vitamin B12Application of strain | |
| CN106676125B (en) | Vector containing maltose promoter and maltose promoter mutant | |
| CN111363714B (en) | Construction method of food-grade streptococcus thermophilus expression vector | |
| CN110607300B (en) | Strong promoter, plasmid vector and application thereof | |
| CN109988802B (en) | Expression cassette for efficiently secreting and expressing human FGF21 protein and application thereof | |
| US20120196323A1 (en) | Fermentation Process | |
| CN112375774A (en) | Construction method of engineering strain for recombinant protein expression | |
| CN115029365B (en) | Construction and application of antibiotic-free efficient stable expression system of escherichia coli probiotics EcN | |
| CN117586356B (en) | Polypeptides and uses thereof | |
| CN117568349B (en) | Fungal promoter element P22 and application thereof | |
| CN117965587A (en) | Bacterial strain containing hok/sok genes and preparation and application thereof | |
| CN116254286A (en) | Cyanamide-induced saccharomyces cerevisiae engineering bacteria and construction method thereof | |
| CN116640709A (en) | Recombinant microorganism for expressing target polypeptide as well as preparation method and application thereof | |
| CN115807268A (en) | Bacillus thuringiensis promoter library and application thereof | |
| KR101745588B1 (en) | Mutant Strains which can Overproduce Target Proteins in the Periplasm | |
| WO2023193837A1 (en) | Expression vector for production of recombinant proteins in prokaryotic host cells | |
| CN116790588A (en) | Pediococcus acidilactici gradient strength promoter and application thereof | |
| CN117264859A (en) | Prokaryotic expression system and preparation method and application thereof | |
| CN117126854A (en) | Biofilm formation regulation gene and application thereof | |
| WO2018172739A1 (en) | Expression system |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |