CN117126854A - Biofilm formation regulation gene and application thereof - Google Patents

Abstract

The invention discloses a biofilm formation regulating gene and application thereof, wherein the nucleotide sequence of the gene FenSr3 is SEQ ID NO.1, the gene FenSr3 is used as a target gene for regulating and controlling the formation of bacillus amyloliquefaciens biofilm, and particularly the formation of the bacillus amyloliquefaciens biofilm is promoted after the gene FenSr3 is used as the target gene for knocking out or deleting. The gene is cloned to a biofilm formation regulating gene FenSr3, is a non-coding RNA gene (FenSr 3) related to biofilm formation, is a brand-new related gene for biofilm formation regulation, is deleted by utilizing a homologous recombination technology, and is constructed into a gene knockout mutant strain, so that the biofilm formation capacity is improved by 66%, and the bacillus biofilm has a protective function, can resist the adverse influence of external environment, has an antibacterial effect and an adhesion capacity, and has great application potential.

Description

Biofilm formation regulation gene and application thereof

Technical Field

The invention belongs to the technical field of biology, and particularly relates to a biofilm formation regulating gene and application thereof.

Background

Bacterial biofilm refers to a structure formed by adhesion and aggregation of bacteria on a contact surface, and substances such as polysaccharide matrix, fibrin, lipid and the like are secreted on the surface of the bacterial biofilm, so that a complex three-dimensional network structure is formed, the structure has a strict protection effect, and the biofilm formation is an important adaptation and survival strategy commonly adopted by the bacteria to protect the bacteria to cope with adverse factors in the environment.

Biofilm formation is a complex process, which is not only affected by a number of external environmental factors, such as: temperature, pH, self-nutrient conditions, extracellular secretions and the like, in Bacillus, biofilm formation is also affected by multiple regulatory pathways such as the Spo0A-KinA-E, sinI/SinR, degS-U two-component systems and the like.

In recent years, with the intensive research on sRNA, researchers find that sRNA has important regulatory effects in the processes of prokaryotic metabolism, environmental stress response, quorum sensing and other vital activities. In the process of cell adversity stress response, sRNA regulates and controls the physiological functions of cells through complementary pairing action with mRNA molecules, and simultaneously sRNA can regulate and control the transcription level to influence mRNA translation in the cells, and the sRNA can cope with environmental changes to influence the growth and propagation of bacteria.

Bacillus amyloliquefaciens is an important biological control strain, and the lack of the transformation of the molecular level of the existing wild strain leads to insufficient colonization capacity, so that the large-scale application of the biological control strain is limited. The formation of the bacillus biomembrane improves the colonization capability and is more beneficial to the exertion of the disease resistance, growth promotion and other probiotics. With the research of sRNA in bacillus involved in the regulation mechanism of forming biological film, genetic engineering means are used to change the genetic characteristics of strain, elucidate the regulation mechanism of sRNA on forming biological film signal molecule, and it is possible to improve the biological film forming ability from molecular level.

Disclosure of Invention

The invention aims to: aiming at the problems existing in the prior art, the invention provides a metabolic regulation gene FenSr3 for forming a biological film, which is a non-coding RNA gene (FenSr 3) related to the formation of the biological film, and a gene knockout mutant strain is constructed by utilizing the deletion of the gene, so that the biological film forming capability of bacillus is improved by 66%, the bacillus biological film has a protection function, can resist the adverse effect of external environment, has an antibacterial effect and an adhesion capability, and has great application potential in the aspect of the colonization of biological control strains.

The invention also provides application of the biomembrane formation metabolism regulating gene FenSr 3.

The technical scheme is as follows: in order to achieve the above purpose, the biofilm formation regulating gene FenSr3 is characterized in that the nucleotide sequence of the gene is SEQ ID NO.1.

Wherein, the gene FenSr3 is used as a target gene to regulate and control the formation of the bacillus amyloliquefaciens biological film.

The recombinant expression vector FenSr3 gene knockout vector containing the biofilm formation regulatory gene FenSr 3.

Wherein, the recombinant expression vector FenSr3 gene knockout vector constructs a recombinant fragment through DNA overlapping extension, and is connected with a linearization vector to construct FenSr3 deletion mutation, thus obtaining the FenSr3 gene knockout vector.

The invention relates to application of a biofilm formation regulatory gene FenSr3 in promoting the formation of a biofilm.

Wherein, the application of the biofilm formation regulating gene FenSr3 in promoting the formation of the bacillus amyloliquefaciens biofilm.

Wherein, the gene FenSr3 is used as target gene to knock out or delete and applied in promoting the formation of bacillus amyloliquefaciens biological film.

The invention relates to application of a primer or a reagent for knocking out or deleting a biofilm formation regulatory gene FenSr3 in promoting the formation of a biofilm.

Wherein, the primer or the reagent for knocking out or deleting the gene FenSr3 for regulating the formation of the biological film is applied to promoting the formation of the biological film of the bacillus amyloliquefaciens.

Wherein the sequence of the primer is shown as SEQ ID NO. 2-5.

Further, the biofilm formation regulatory gene FenSr3 can be applied in the process of colonising biological control strains.

The genetically engineered bacterium with high biofilm formation capability is obtained by taking bacillus amyloliquefaciens as an initial strain and knocking out or inactivating a gene FenSr3 in a strain genome.

Wherein the bacillus amyloliquefaciens is Bacillus amyloliquefaciens LPB-18.

Firstly, constructing a recombinant fragment through DNA overlapping extension, connecting the recombinant fragment with a linearization vector, and constructing FenSr3 deletion mutation to obtain FenSr3 gene knockout plasmid; the plasmid is transformed into original bacillus amyloliquefaciens competence through an electrotransformation system to obtain the strain with high biofilm formation capacity. Specifically, the gene of the gene FenSr3 involved in the regulated biofilm formation is tasA, sipW, tapA, blsA. The method comprises the following steps: fenSr3 regulates the expression of the gene tasA, sipW, tapA, blsA related to the formation of the biological film, and after the FenSr3 gene in the genome of bacillus amyloliquefaciens is knocked out, the expression of the gene related to the formation of the biological film is influenced.

The key regulatory gene provided by the invention effectively solves the technical problems of low biological film forming capability and weak colonization capability of wild strains.

The beneficial effects are that: compared with the prior art, the invention has the following advantages:

the invention provides a biological film regulating gene FenSr3 for the first time, which is a non-coding RNA gene (FenSr 3) related to biological film formation, and simultaneously provides the application of the biological film forming regulating gene FenSr3 in the processes of regulating and controlling bacterial strain colonization.

Furthermore, the invention provides application of a primer or a reagent for knocking out or deleting a biofilm formation regulatory gene FenSr3 in promoting formation of a bacillus amyloliquefaciens biofilm. The invention utilizes a recombinant expression vector FenSr3 gene knockout vector constructed by a biomembrane regulatory gene FenSr3, and utilizes the deletion of genes to construct a gene knockout mutant strain LPB-18N in the bacillus amyloliquefaciens LPB-18 competence through an electrotransformation system, the strain has high growth speed and strong biological forming capability which is 1.66 times of the yield of original wild strains, and the strain obtained by the method has high biomembrane forming capability, thereby being further beneficial to improving the colonization capability of the strain and the capability of meeting external adverse environmental conditions and being more beneficial to the exertion of biological control effects.

Drawings

FIG. 1 gel imaging of knocked-out plasmid PCR products (Lane 1: DNAMake, lane2: single colony PCR amplification products);

FIG. 2 is a gel image (knockout) of an electrotransformation single colony PCR product (M: DNAMake, lane1-4: single colony PCR amplification product);

FIG. 3 gel imaging of over-expressed plasmid PCR products (Lane 1: DNAMake, lane2: single colony PCR amplification products);

FIG. 4 is a gel image (over-expression) of an electrotransformed single colony PCR product (M: DNAMake, lane1-4: single colony PCR amplification product);

FIG. 5 shows the surface morphology of Bacillus amyloliquefaciens LPB-18 and genetically engineered strain cell scanning electron microscope (A: sRNAFenSr3 gene knockout strain LPB-18N; B: wild strain LPB-18; C: sRNA FenSr3 gene overexpressing strain LPB-18P);

FIG. 6 is a view of colony observation of FenSr3 knockout strain LPB-18N;

FIG. 7 shows the biofilm formation ability of Bacillus amyloliquefaciens strain LPB-18, LPB-18N and LPB-18P at different growth stages (A: three strains at different time periods biofilm formation amount measurement, B three strains 48h biofilm static culture top view, 1-3 being strain LPB-18P, strain LPB-18N and strain LPB-18 respectively);

FIG. 8 is a graph showing biofilm formation capacity of Bacillus amyloliquefaciens LPB-18, LPB-18N and LPB-18P in different media;

FIG. 9 is a graph showing the expression level of genes related to the biofilm formation ability of a knockout strain, wherein the graph shows the transcription difference of genes related to the biofilm of the knockout strain by taking an original strain as a control, namely, the gene transcription of the original strain is 1 unit, and the y axis is the fold of the gene transcription of the knockout strain compared with a control group.

Detailed Description

Further description is provided below with reference to the drawings and examples.

The sources of microorganisms and reagents used in the examples are as follows:

KpnI, bglII and BamHI are available from Fermentas; bacterial RNA extraction kits and fluorescent quantitative PCR kits were purchased from Norwegian Biotechnology Co., ltd, agarose, naCl, tryptone, agar, tryptone liquid Medium (TSB), MSgg Medium, NYBD Medium, 50 XTAE buffer were purchased from the national drug group.

The E.coli-bacillus subtilis shuttle plasmid pCBS and the vector pHT43 used in the invention are all known vectors and plasmids and are provided by the national institute of life sciences and food engineering.

Coli e.coli DH5 a competent cells and Trans110 competent cells were purchased from all gold biotechnology company.

The gene FenSr3 in the invention is a key gene for regulating and controlling the formation of a biological film, and is cloned in bacillus amyloliquefaciens Bacillus amyloliquefaciens LPB-18, and the preservation number of the strain LPB-18 is CGMCC No.18719 and has been disclosed in the prior patent CN111019948A of the applicant.

Example 1

Target gene analysis is carried out on Bacillus amyloliquefaciens LPB-18 transcriptome data through bioinformatics analysis, and a non-coding RNA (sRNA) fragment with the length of 355bp is obtained, the fragment is named as FenSr3, and the nucleotide sequence of the gene FenSr3 is shown as SEQ ID NO.1.

SEQ ID NO.1

GGAGCTGTGTACGCGGTTTGAAGCGCGAGCTCCGGTTCGGGCAGATTTTTCCGATCCAATTTACCGTTCGGCGTAAGCGGCAGCTTCTCAAGTTCCATCATATAGGCCGGGACCATGTAATTCGGCAGTTGCTTAGAAAGTGATGAACGCACTTTTTCTGTATCCATGTCCGTCTGCAGACTCATATATGCGATCAGTTCTTTATTGCCGGACTGCCCGGTTCTGACTGACACGGCAGCTTCTTTCACGCCGTCCAGGCTCCTTAGTGCGGCTTCAATCTCTCCCAGCTCGACCCGATAACCGCGGATTTTCACTTGATCATCCATCCGTCCGGCATATTCGATCGTTCCGTCCG

Example 2

1. Construction of sRNA Gene knockout vector

The 520bp sequences on the upstream and downstream of the FenSr3 gene are respectively designed into a primer for knocking out the vector construction:

L-FenSr3-F：(SEQ ID NO.2)

atcgatgcatgccatggtaccCCAAGTATCTGTCTCAGAC(KpnⅠ)

L-FenSr3-R：(SEQ ID NO.3)

GTTCTTCAAGCTCATTGCGGGCAGCCAGCGGGCTA

R-FenSr3-F：(SEQ ID NO.4)

GATTTAGCCCGCTGGCTGCCCGCAATGAGCTTGAA

R-FenSr3-R：(SEQ ID NO.5)

gcgtcgggcgatatcagatctTTATATGTAAGTGACCAGG(BglⅡ)

(1) Amplification of sequences upstream and downstream of sRNA genes

LPB-18 genome DNA is used as a template, and primers L-FenSr3-F/R and R-FenSr3-F/R are used for respectively amplifying homologous arm sequences between upstream genes and downstream genes of sRNA.

PCR reaction System (50. Mu.L): 2X Phanta Master Mix. Mu.L, 2. Mu.L of upstream primer, 2. Mu.L of downstream primer, 1. Mu.L of template DNA, ddH ₂ O20. Mu.L; PCR amplification conditions: pre-denaturation at 95℃for 5min, denaturation at 95℃for 30s, annealing at 55℃for 30s, extension at 72℃for 1min, 30 cycles, extension at 72℃for 10min. And respectively purifying and recovering the PCR products to obtain target products. The target product is amplified by adopting overlapping extension primers L-FenSr3-F and R-FenSr3-R, and the electrophoresis detection result is shown in figure 1, so that the recombinant target fragment is obtained.

(2) Recombinant fragment and linearization vector ligation

The E.coli-Bacillus subtilis shuttle plasmid pCBS was digested with restriction enzymes KpnI and BamHI for 3 hours, and the BamHI cleavage sites were eliminated by using the characteristics of BglII and BamHI as homotail enzymes, and the linearized vector was recovered.

Recombination reaction system: 5 XCE II Buffer 4. Mu.L, linearization vector 150ng, fragment of interest 160ng, exnase II 2. Mu.L, ddH ₂ Up to 20. Mu.L. The reaction is carried out for 30min in a water bath at 37 ℃ and is cooled for 5min in an ice-water bath. The reaction products are transformed into E.coli DH5 alpha competent cells, LB resistant plate blue white spot screening (IPTG, X-gaL, amp) is carried out, and positive single colony PCR is selected to detect the target fragment. Plasmids were extracted and verified by double restriction enzymes KpnI and BglII. The correct knockout plasmid is transformed into a Trans110 competent cell, an LB resistance plate (Amp), the plasmid is extracted, and the demethylated knockout plasmid pCBS-delta sRNA is obtained through PCR and double enzyme digestion verification.

2. Construction of Bacillus amyloliquefaciens LPB-18 knockout sRNA Strain

(1) Preparation of competent Bacillus amyloliquefaciens LPB-18

LBS medium cultured overnight at 1:25 (v/v) dilution (250 mL shaking flask, liquid loading amount 100 mL), shaking culture in shaking table (37deg.C, 180 r/min) for 2h, detection with ultraviolet spectrophotometer, and OD ₆₀₀ When the concentration is about 0.5, glycine solution is added into a shake flask to ensure that the final system concentration is 10mg/mL, and the shake culture is continued, when the OD is ₆₀₀ When about 1.0, placing the shake flask on ice for standing for 30min, centrifuging at 8000rpm for 5min at 4 ℃ in a precooled low-temperature centrifuge, discarding the supernatant, collecting the bacterial cells, repeatedly cleaning the bacterial cells for 3 times by using precooled electrotransformation liquid, re-suspending competent cells by using precooled heavy suspension according to the ratio of 1:100 (v/v) to obtain LPB-18 competent cells, placing the LPB-18 competent cells in a precooled centrifuge tube, and preserving at-80 ℃ for standby. And (3) injection: and (3) whole-process sterile and low-temperature precooling operation. Composition of the electrotransformation solution: 0.5M trehalose, 0.5M sorbitol, 0.5M mannitol, and 10% glycerol, and sterilizing at 115deg.C for 30min. The heavy suspension is composed of: the electrotransformation solution was added with 14% PEG6000 polyethylene glycol.

(2) Electric conversion

About 500ng of plasmid pCBS-delta sRNA to be transformed is taken in 100 mu L of LPB-18 competent cells, the walls of the flick tube are uniformly mixed, the competent cells and the plasmid are transferred into an electric rotating cup (2 mm) precooled on ice, and the mixture is placed on ice for 5min. After setting the electrotransformation parameters, performing electric shock at 2800v and 4.5ms voltage, immediately adding 1mL of LBS culture medium into an electrorotating cup, gently mixing, slowly sucking into a 2mL centrifuge tube, performing mild shaking culture for 3h by a shaking table (30 ℃ C., 120 r/min), centrifuging at 2500 Xg at room temperature for 3min, discarding 900 mu L of supernatant, re-suspending the bacteria in the centrifuge tube by using the rest culture medium, uniformly coating on an LB resistance plate (Amp, erythromycin), and culturing at 30 ℃ for 72h. And (3) verifying single bacterial colonies by adopting PCR amplification and electrophoresis detection, wherein the amplification primers L-FenSr3-F and R-FenSr3-R are the same as the PCR reaction system, the electrophoresis detection result is shown in figure 2, and the electrophoresis detection result is consistent with the electrophoresis detection result shown in figure 1, namely the correct bacterial strain is knocked out.

Example 3

1. Construction of sRNA Gene overexpression vector

The primer constructed by the overexpression vector is designed by the 355bp sequence of the sRNA gene:

Pgrac-F：(SEQ ID NO.6)

caccggaattagcttggtaccCAGCTATTGTAACATAATCGGTACGG(KpnⅠ)

Pgrac-R：(SEQ ID NO.7)

TGTAGTAAAGCCATtgatccttcctcctttaattg

sRNA-F：(SEQ ID NO.8)

aggaggaaggatcaGGAGCTGTGTACGCGGTTTGAA

sRNA-R：(SEQ ID NO.9)

gacgtcgactctagaagatctCGGACGGAACGATCGAATATGCCGGACG(BglⅡ)

(1) sRNA gene sequence cloning

The full-length sequence between sRNA genes is amplified by using LPB-18 genome DNA as a template and adopting a primer sRNA-F/R.

The promoter was amplified using the plasmid pHT43 as a template and the primer Pgrad-F/R.

PCR reaction System (50. Mu.L): 2X Phanta Master Mix. Mu.L, 2. Mu.L of upstream primer, 2. Mu.L of downstream primer, 1. Mu.L of template DNA and 20. Mu.L of ddH 2O; PCR amplification conditions: pre-denaturation at 95 ℃ for 5min, denaturation at 95 ℃ for 30s, annealing at 60-68 ℃ for 30s, extension at 72 ℃ for 1min, circulation for 30 times and extension at 72 ℃ for 10min. And respectively purifying and recovering the PCR products to obtain target products. And amplifying the target product by adopting overlapping extension primers Pgrad-F and sRNA-R to obtain the recombinant fusion fragment.

(2) Recombinant fragment and linearization vector ligation

The E.coli-Bacillus subtilis shuttle plasmid pHT43 was digested simultaneously with restriction enzymes KpnI and BamHI for 3 hours, and the linearized vector was recovered.

Recombination reaction system: 5 XCE II Buffer 4. Mu.L, linearization vector 50-200ng, fragment of interest 20-200ng, exnase II 2. Mu.L, ddH2O Up to 20. Mu.L. The reaction is carried out for 30min in a water bath at 37 ℃ and is cooled for 5min in an ice-water bath. The reaction products were transformed into E.coli DH 5. Alpha. Competent cells, LB-resistant plate blue and white spot screening (IPTG, X-gaL, amp), and positive single colonies were picked for PCR detection of the clones. Plasmids were extracted and verified by double restriction enzymes KpnI and BglII. The correct overexpression plasmid is transformed into a Trans110 competent cell, an LB resistance plate (Amp, chloramphenicol), the plasmid is extracted, and the plasmid is verified by PCR and double enzyme digestion, so as to obtain the demethylated overexpression plasmid pHT43-sRNA.

2. Construction of Bacillus amyloliquefaciens LPB-18 overexpressing sRNA Strain

(1) Preparation of competent Bacillus amyloliquefaciens LPB-18

LBS medium cultured overnight at 1:25 (v/v) dilution transfer (250 mL shaking flask, liquid loading amount 100 mL), shaking culture in shaking table (37deg.C, 180 r/min) for 2h, detection with ultraviolet spectrophotometer, and OD ₆₀₀ When the concentration is about 0.5, glycine solution is added into a shake flask to ensure that the final system concentration is 10mg/mL, and the shake culture is continued, when the OD is ₆₀₀ When about 1.0, placing the shake flask on ice for standing for 30min, centrifuging at 8000rpm for 5min at 4 ℃ in a precooled low-temperature centrifuge, discarding the supernatant, collecting the bacterial cells, repeatedly cleaning the bacterial cells for 3 times by using precooled electrotransformation liquid, re-suspending competent cells by using precooled heavy suspension according to the ratio of 1:100 (v/v) to obtain LPB-18 competent cells, placing the LPB-18 competent cells in a precooled centrifuge tube, and preserving at-80 ℃ for standby. Composition of the electrotransformation solution: 0.5M trehalose, 0.5M sorbitol, 0.5M mannitol, and 10% glycerol, and sterilizing at 115deg.C for 30min. The heavy suspension is composed of: the electrotransformation solution was added with 14% PEG6000 polyethylene glycol.

(2) Electric conversion

About 500ng of plasmid pHT43-sRNA to be transformed was taken in 100. Mu.L of LPB-18 competent cells, the walls of the flick tube were mixed well, the competent cells and plasmid were transferred to an electrorotating cup (2 mm) pre-cooled on ice, and placed on ice for 5min. Setting electric conversion parameters, performing electric shock at 2800v for 4.5ms, immediately adding 1mL of LBS culture medium into an electric rotating cup, gently mixing, slowly sucking into a 2mL centrifuge tube, performing mild shaking culture for 3h by a shaking table (30 ℃ C., 120 r/min), centrifuging at 2500 Xg for 3min at room temperature, discarding 900 mu L of supernatant, re-suspending the bacteria in the centrifuge tube by using the rest culture medium, uniformly coating on LB resistance plates (Amp and chloramphenicol), and culturing at 30 ℃ for 72h. And (3) verifying single colonies by adopting PCR amplification and electrophoresis detection, wherein the PCR reaction system is the same as that of the amplification primers Pgrad-F and Pgrad-R, and the electrophoresis detection result is the same as that of the electrophoresis detection result of FIG. 3, namely the strain with correct over-expression.

Example 4

Biofilm formation ability assay

Obtaining correct knocked-out strains in example 2, and obtaining FenSr3 gene knocked-out strains LPB-18N by streaking on LB plates, wherein the colony pictures of the knocked-out strains are shown in figure 6, and in order to observe the microstructures of the cell surfaces of different strains, the cell surface morphology of three strains is shown in figure 5 by using a scanning electron microscope, and the result shows that the strains LPB-18N form convex wrinkles with different ductility on the surfaces, and the space structure is complete; the cell surface of the wild strain LPB-18 is smoother, and wrinkles are not obvious; example 3 the structure of the sRNA FenSr3 over-expressed strain LPB-18P obtained by construction clearly shows the original structure of the cells in an electron microscope scanning picture, and the cells are rod-shaped, blunt at both ends and smooth in surface.

In a sterile 96-well deep well plate, 2mL of LB liquid medium was added to each well, and 1mL of OD was added with a pipette, respectively ₆₀₀ Bacterial suspensions of original bacterial strains LPB-18, fenSr3 gene knockout bacterial strain LPB-18N and FenSr3 overexpression bacterial strain LPB-18P are enriched and cultured for 3 hours on a shaking table at 33 ℃ and 100r/min, then the bacterial suspensions are placed in a constant temperature incubator at 33 ℃ for standing for 48 hours, the biofilm formation capacity of different bacterial strains is measured by a crystal violet staining method every 6 hours in the culture process, a deep pore plate is gently taken out, a lower layer culture solution in the deep pore plate is carefully sucked by a syringe, the integrity of an upper layer biological film is kept as much as possible, the bacterial suspensions are rinsed for 3 times by sterile PBS buffer solution, and the bacterial suspensions are dried at room temperature. Washing the biomembrane with 1mL formaldehyde (submerged biomembrane), standing for 5min, repeating for 1-2 times, and suckingFormaldehyde was dried in an oven at 40 ℃ and finally stained with 1ml of 0.5% crystal for 10min, washed with absolute ethanol, the wash of absolute ethanol was collected and absorbance was determined at 590nm using absolute ethanol as a blank. The biofilm formation ability of the bacillus amyloliquefaciens strains LPB-18, LPB-18N and LPB-18P was measured by repeating each sample 3 times according to the absorbance, and as shown in fig. 7 and 8, the strains LPB-18N showed stronger biofilm formation ability, especially when the bacteria enter the stationary phase, the biofilm synthesis appeared to be a "secondary growth point", while the biofilm formation amounts of the wild strains LPB-18 and sRNA FenSr3 overexpressing strains LPB-18P gradually decreased, and the total biofilm formation amounts of the original strains LPB-18 and FenSr3 gene knockout strains LPB-18N in the four media were: TSB > LB > Msgg > NYBD, and the biofilm formation capacity is strongest when TSB is used as the only medium.

Example 5

Biofilm formation ability-associated gene expression level detection

(1) The original strain LPB-18 and the FenSr3 gene knockout strain LPB-18N are cultured to the logarithmic growth phase, and bacterial RNA is extracted according to the instruction of extracting total RNA of the bacterial RNA extraction kit.

(2) Target gene primers were designed, and primers were designed by using Primier Premier 5.0, and were synthesized by Shanghai bioengineering Co.Ltd, to detect the expression levels of genes related to biofilm synthesis (tasA, sipW, tapA, blsA), quorum sensing systems (comA, comP, degU, spo A, etc.), extracellular polysaccharides (epsC, epsK).

(3) The extracted RNA is treated by DNase I, and cDNA is generated by reverse transcription by taking the RNA as a template. The reverse transcription reaction system was as follows, 5X PrimeScript RT Master Mix. Mu.L, total RNA 2. Mu.L RNase Free ddH ₂ O6. Mu.L. The fluorescent quantitative PCR system was as follows, 2X SYBR qPCR Master Mix (Universal) 10. Mu.L, primer F (10. Mu.M) 1. Mu.L, primer R (10. Mu.M) 1. Mu. L, cDNA 4. Mu.4. Mu. L, ddH ₂ O4. Mu.L, the expression level of the gene related to the biofilm formation ability is obtained, and as shown in FIG. 9, compared with the original strain LPB-18, the transcript of the gene related to the biofilm synthesis of the FenSr3 gene knockout strain LPB-18N is in an up-regulated expression trend, which further proves that the gene is promotedUse in the formation of a biofilm.

Claims (10)

1. A biofilm formation regulating gene FenSr3 is characterized in that the nucleotide sequence of the gene is SEQ ID NO.1.

2. The biofilm formation regulating gene FenSr3 according to claim 1, wherein said gene FenSr3 regulates bacillus amyloliquefaciens biofilm formation as a target gene.

3. An application of a biofilm formation regulatory gene FenSr3 in promoting the formation of a biofilm.

4. The use according to claim 3, characterized by the use of the biofilm formation regulating gene FenSr3 for promoting the formation of a bacillus amyloliquefaciens biofilm.

5. The use according to claim 3, wherein the biofilm formation regulating gene FenSr3 is used as target gene for promoting the formation of a bacillus amyloliquefaciens biofilm after knockout or deletion.

6. Use of a primer or reagent for knockout or deletion of the biofilm formation regulatory gene FenSr3 in promoting biofilm formation.

7. The use according to claim 6, wherein the primer or reagent for knockout or deletion of the biofilm formation regulating gene FenSr3 is used for promoting the formation of a bacillus amyloliquefaciens biofilm.

8. The use according to claim 6, wherein the sequence of the primer is preferably as shown in SEQ ID NO. 2-5.

9. The genetically engineered bacterium with high biofilm formation capability is characterized in that the genetically engineered bacterium is obtained by taking bacillus amyloliquefaciens as an initial strain and knocking out or inactivating a gene FenSr3 in a strain genome.

10. The genetically engineered bacterium having high biofilm formation ability of claim 9, wherein the bacillus amyloliquefaciens is Bacillus amyloliquefaciens LPB-18.