CN114672510A

CN114672510A - Method for preparing L-tryptophan-L-alanine cyclic dipeptide by utilizing aspergillus oryzae

Info

Publication number: CN114672510A
Application number: CN202210503663.XA
Authority: CN
Inventors: 刘成伟; 祁建钊; 刘长莉
Original assignee: Northeast Forestry University
Current assignee: Northeast Forestry University
Priority date: 2022-05-10
Filing date: 2022-05-10
Publication date: 2022-06-28
Anticipated expiration: 2042-05-10
Also published as: CN114672510B

Abstract

A method for preparing L-tryptophan-L-alanine cyclic dipeptide by utilizing aspergillus oryzae relates to the technical field of biological medicines. The invention aims to solve the problems of unstable fermentation, low yield and difficult extraction and purification of the traditional synthetic method of L-tryptophan-L-alanine cyclic dipeptide. According to the invention, Aspergillus oryzae is used as a host, and the host cell has strong amino acid synthesis capacity and can provide rich L-tryptophan and L-alanine; the expression plasmid pMA-criC used in the invention carries pAmyB amylase promoter, and can efficiently drive the efficient expression of the loop dipeptide synthase coding gene criC when rice is taken as a culture medium; the high-yield strain of the invention takes rice culture as a culture medium, and has the advantages of low cost, simple operation, short culture period, simple and easy separation and purification. The invention can obtain a method for preparing L-tryptophan-L-alanine cyclic dipeptide by utilizing aspergillus oryzae.

Description

Method for preparing L-tryptophan-L-alanine cyclic dipeptide by utilizing aspergillus oryzae

Technical Field

The invention relates to the technical field of biological medicines, in particular to a method for preparing L-tryptophan-L-alanine cyclic dipeptide in a large scale by utilizing aspergillus oryzae.

Background

L-tryptophan-L-alanine cyclic dipeptide (L-Trp-L-Ala)) is a small molecular compound containing indole ring and 2, 5-diketopiperazine ring, and is an important structural unit of alkaloid natural products. The compound taking L-tryptophan-L-alanine cyclic dipeptide as a structural skeleton often has important biological activity and has potential application value in the aspect of clinical drug development.

Although L-tryptophan-L-alanine cyclodipeptides are currently commercially available, the CAS registry number: 17079-37-7, but is extremely expensive. The main reason of high price is the limited source, on one hand, the chemical synthesis of L-tryptophan-L-alanine cyclic dipeptide is difficult due to the structural specificity; on the other hand, although it can be obtained from metabolites of fungi of the genus Aspergillus and the genus Eurotium, a series of problems such as unstable fermentation, low yield and extraction and purification severely limit the sources of microbial production.

Disclosure of Invention

The present invention has been made to solve the above problems, and an object of the present invention is to provide a method for producing L-tryptophan-L-alanine cyclodipeptide from Aspergillus oryzae.

A method for preparing L-tryptophan-L-alanine cyclic dipeptide by utilizing aspergillus oryzae comprises the following steps:

step S1: constructing an expression plasmid pMA-criC;

amplifying to obtain a first fragment of a cyclic dipeptide synthase coding gene criC by taking genome DNA of Jingwei Fuzhuan tea symbiotic bacteria (Eurotium cristatum) as a template, P1F as a forward primer and P1R as a reverse primer, and then amplifying to obtain a second fragment of the cyclic dipeptide synthase coding gene criC by taking P2F as the forward primer and P2R as the reverse primer; then, taking the genome DNA of Jingwei Fuzhuan tea symbiotic bacteria (Eurotium cristatum) as a template, taking a fragment of pMA plasmid subjected to KpnI restriction enzyme linearization treatment as a vector, and inserting the fragment I and the fragment II of the cyclic dipeptide synthase encoding gene criC into the restriction site KpnI of the pMA plasmid to obtain an expression plasmid pMA-criC;

the sequence of primer P1F is aattcgagctcggtaccATGTGAAGCTGATATTCATTC, the sequence of primer P1R is gaccaaggtagcgTAGGTAATTGAATGTGACCCTTTTTG, the sequence of primer P2F is ttacctaCGCTACCTTGGTCCAATATGCA, and the sequence of primer P2R is tactacagatccccgggtaccCTATACCACCGTTAGATACTGTCGCG;

step S2: obtaining a high-yield strain carrying L-tryptophan-L-alanine cyclic dipeptide;

inoculating a spore preservation solution of Aspergillus oryzae (Aspergillus oryzae) into a DPY culture medium, and performing shake culture for 2-3 days to obtain thalli of the Aspergillus oryzae (Aspergillus oryzae); then adding a cell wall dissolving solution, and carrying out mild oscillation for 2-3 hours to obtain a protoplast; adding a buffer solution II and a buffer solution III into a protoplast, adding an expression plasmid pMA-criC, uniformly mixing, carrying out ice bath for 18-20 min, adding the buffer solution III into a mixed system, incubating for 18-20 min at room temperature, then adding the buffer solution II, uniformly mixing, centrifuging for 8-10 min, removing a supernatant, adding the buffer solution II, uniformly mixing, transferring to an improved Chaech culture medium plate, adding a covering culture medium, and carrying out inverted culture for 3-7 days; after hyphae grow out from the culture medium, verifying the hyphae by using PCR, and carrying out subculture on the positive transformant for 2 times to obtain a high-yield strain carrying L-tryptophan-L-alanine cyclic dipeptide;

the buffer solution II consists of 1.2M sorbitol, 50mM calcium chloride solution, 50mM sodium chloride solution and 10mM tromethamine, and the pH is adjusted to 7.5; the buffer solution III consists of 40 percent of polyethylene glycol-4000, 50mM of calcium chloride solution and 50mM of tromethamine; the improved Chachi culture medium is prepared by the following steps: each 200mL of the modified Chao's medium contained 7.0g of Chao's medium, 9.3g of NaCl, 1.8g (NH4)₂SO₄20mg of adenine, 300mg of methionine and 3g of agar powder;

step S3: preparing L-tryptophan-L-alanine cyclic dipeptide;

inoculating hypha of a high-yield strain carrying L-tryptophan-L-alanine cyclic dipeptide into a sterilized culture medium filled with rice, extracting and concentrating the culture medium to obtain a fermentation liquid extract; and preparing the fermentation liquid extract by using a high performance liquid chromatograph to obtain the L-tryptophan-L-alanine cyclic dipeptide.

The invention has the beneficial effects that:

firstly, the invention takes Aspergillus oryzae (Aspergillus oryzae) as a host, and the host cell has strong amino acid synthesis capacity and can provide rich L-tryptophan and L-alanine; secondly, the expression plasmid pMA-criC used by the invention carries a pAmyB amylase promoter, and can efficiently express the encoding gene criC of the cyclic dipeptide synthase when rice is taken as a culture medium; thirdly, the high-yield strain Aspergillus oryzae/pMA-criC takes rice culture as a culture medium, and has the advantages of low cost, simple operation, short culture period and simple and easy separation and purification.

The invention is very suitable for large-scale fermentation production, breaks through the resource limitation of the traditional separation, and by adopting the culture medium and the culture conditions for fermentation, the separation, extraction and various spectrum identification of fermentation products are carried out, the aspergillus oryzae heterologous expression strain can produce L-tryptophan-L-alanine cyclic dipeptide in large quantity, the yield exceeds 100mg/1Kg rice, the problem of the source of the L-tryptophan-L-alanine cyclic dipeptide can be effectively solved, and sufficient raw materials can be provided for the synthesis of natural products containing indole skeleton and diketopiperazine structure and related medical intermediates.

The invention provides a method for preparing L-tryptophan-L-alanine cyclic dipeptide in a large scale by taking Aspergillus oryzae (Aspergillus oryzae) as a host, wherein more than one hundred milligrams of L-tryptophan-L-alanine cyclic dipeptide can be obtained by fermenting every 1 kilogram of rice.

The invention can obtain a method for preparing L-tryptophan-L-alanine cyclic dipeptide by utilizing aspergillus oryzae.

Drawings

FIG. 1 is a HPLC analysis chart of L-tryptophan-L-alanine cyclic dipeptide, wherein i represents a wild-type Aspergillus oryzae and ii represents an Aspergillus oryzae containing criC gene.

FIG. 2 is a LC-MS detection map of L-tryptophan-L-alanine cyclic dipeptide.

FIG. 3 shows L-Tryptophan-L-alanine cyclic dipeptide¹H nuclear magnetic resonance spectroscopy.

FIG. 4 shows L-Tryptophan-L-alanine cyclic dipeptide¹³C nuclear magnetic resonance spectrum.

FIG. 5 shows HSQC NMR spectra of L-tryptophan-L-alanine cyclic dipeptide.

FIG. 6 shows HMBC NMR spectra of L-tryptophan-L-alanine cyclic dipeptide.

FIG. 7 shows L-Tryptophan-L-alanine cyclic dipeptide¹H-¹H COSY nuclear magnetic resonance spectrum.

FIG. 8 shows L-Tryptophan-L-alanine cyclic dipeptide¹H-¹H NOESY NMR spectrum.

Detailed Description

The first embodiment is as follows: the method for preparing the L-tryptophan-L-alanine cyclic dipeptide by utilizing the aspergillus oryzae comprises the following steps:

step S1: constructing an expression plasmid pMA-criC;

the buffer solution II consists of 1.2M sorbitol, 50mM calcium chloride solution, 50mM sodium chloride solution and 10mM tromethamine, and the pH is adjusted to 7.5; the buffer solution III consists of 40 percent of polyethylene glycol-4000, a 50mM calcium chloride solution and 50mM tromethamine; the improved Chachi culture medium is prepared by the following steps: each 200mL of the modified Chao's medium contained 7.0g of Chao's medium, 9.3g of NaCl, 1.8g (NH4)₂SO₄20mg of adenine, 300mg of methionine and 3g of agar powder;

step S3: preparing L-tryptophan-L-alanine cyclic dipeptide;

inoculating mycelium of high-yield strain carrying L-tryptophan-L-alanine cyclic dipeptide into sterilized culture medium filled with rice, extracting the culture medium, and concentrating to obtain fermentation broth extract; and preparing the fermentation liquid extract by using a high performance liquid chromatograph to obtain the L-tryptophan-L-alanine cyclic dipeptide.

The second embodiment is as follows: the present embodiment differs from the present embodiment in that: in the step S1, mixing the fragment I and the fragment II of the cyclic dipeptide synthase coding gene criC and the pMA plasmid fragment subjected to KpnI enzyme digestion linearization treatment according to a molar ratio of 1:1:2, connecting by using a multi-fragment connection kit, transforming a connection system into Escherichia coli DH5 alpha after connection is finished, obtaining a positive clone after overnight culture, and finally obtaining the expression plasmid pMA-criC after PCR verification and enzyme digestion verification.

Other steps are the same as those in the first embodiment.

The third concrete implementation mode: the first or second differences from the present embodiment are as follows: the cultivation of the high-producing strain of L-tryptophan-L-alanine cyclodipeptide based on the expression plasmid pMA-criC in step S2 was carried out as follows: inoculating a spore preservation solution of Aspergillus oryzae (Aspergillus oryzae) into a DPY culture medium containing 100mL, and carrying out shake culture at the temperature of 28-30 ℃ and the rotating speed of 180-200 rpm for 2-3 days to obtain thalli of the Aspergillus oryzae (Aspergillus oryzae); filtering and collecting thallus of Aspergillus oryzae (Aspergillus oryzae), washing with sterile water for 3-5 times, adding 20mL of cell wall dissolving liquid, and carrying out mild oscillation for 2-3 hours at the temperature of 25-28 ℃ to obtain a protoplast; washing the protoplasm for 2 times by using a sterilized 0.8M NaCl solution, adding a buffer solution II and a buffer solution III, adding 10 mu g of expression plasmid pMA-criC, uniformly mixing, carrying out ice bath for 18-20 min, adding 1mL of the buffer solution III into a mixed system, incubating at room temperature for 20min, then adding 10mL of the buffer solution II, uniformly mixing, centrifuging at the temperature of 2-4 ℃ for 8-10 min at the rotating speed of 600-800 rpm, removing a supernatant, adding 1mL of the buffer solution II, uniformly mixing, transferring 200 mu L of the uniformly mixed solution to an improved Chaudou culture medium plate, then adding 5mL of a covering culture medium at the temperature of 45-50 ℃, sealing the plate after the covering culture medium is solidified, and carrying out inverted culture for 3-7 days; after mycelia grow out from transformants containing pMA-criC, verifying the mycelia by using PCR, and carrying out subculture on positive transformants for 2 times to obtain the high-yield strain of L-tryptophan-L-alanine cyclic dipeptide.

The other steps are the same as those in the first or second embodiment.

The fourth concrete implementation mode: the difference between this embodiment and one of the first to third embodiments is as follows: the DPY culture medium is prepared by the following steps: 2g of dextrin, 1g of polypeptone, 0.5g of yeast powder, 10mg of adenine, 925mg of ammonium sulfate, 150mg of methionine and 60mg of arginine, and adding water to quantify to 100 mL; the overlay medium consisted of 1.2M sorbitol and 0.5% agar powder.

The other steps are the same as those in the first to third embodiments.

The fifth concrete implementation mode: the difference between this embodiment and one of the first to fourth embodiments is: the cell wall dissolving solution is prepared by dissolving 1.0 percent of carbohydrase in the solution I; the solution I consists of a 0.8M sodium chloride solution and a 10mM sodium dihydrogen phosphate solution.

The other steps are the same as those in the first to fourth embodiments.

The sixth specific implementation mode: the difference between this embodiment and one of the first to fifth embodiments is as follows: step S3, inoculating hypha of a high-yield strain carrying L-tryptophan-L-alanine cyclic dipeptide into a sterilized culture medium filled with rice, and standing and culturing at 25-28 ℃ for two weeks; extracting the culture medium for 3-5 times by using ethyl acetate, and concentrating to obtain a fermentation liquid extract; performing coarse separation on the fermentation liquid extract by using a normal phase chromatogram, performing fine separation by using a reverse phase chromatogram, and preparing by using a high performance liquid chromatograph to obtain the L-tryptophan-L-alanine cyclic dipeptide.

The other steps are the same as those in the first to fifth embodiments.

The seventh embodiment: the difference between this embodiment and one of the first to sixth embodiments is: in the step S1, taking a fragment of pMA plasmid subjected to KpnI restriction enzyme linearization treatment as a vector, and inserting a fragment I and a fragment II of the cyclic dipeptide synthase encoding gene criC into a restriction site KpnI of the pMA plasmid by utilizing a ligase-independent multi-fragment one-step cloning kit to obtain an expression plasmid pMA-criC; the ratio of mass of the pMA plasmid to volume of KpnI was 1. mu.g: 1 μ L.

The other steps are the same as those in the first to sixth embodiments.

The specific implementation mode is eight: in the embodiment, the expression plasmid pMA-criC obtained by the method for preparing the L-tryptophan-L-alanine cyclic dipeptide by using the aspergillus oryzae has a nucleotide sequence shown in a sequence table SEQ ID NO. 1.

The following examples were used to demonstrate the beneficial effects of the present invention:

example 1: a method for preparing L-tryptophan-L-alanine cyclic dipeptide by utilizing aspergillus oryzae comprises the following steps:

step S1: constructing an expression plasmid pMA-criC;

the Jingwei Fu tea symbiotic fungus (Eurotium cristatum) is a filamentous fungus which can produce a compound with an L-tryptophan-L-alanine cyclic dipeptide skeleton, and the ITS NCBI accession number is OM 276864. Using the DNA of the strain as a template, using P1F (aattcgagctcggtaccATGTGAAGCTGATATTCATTC) as a forward primer and P1R (gaccaaggtagcgTAGGTAATTGAATGTGACCCTTTTTG) as a reverse primer, amplifying to obtain a first fragment of the cyclic dipeptide synthase coding gene criC, and then using P2F (ttacctaCGCTACCTTGGTCCAATATGCA) as the forward primer and P2R (tactacagatccccgggtaccCTATACCACCGTTAGATACTGTCGCG) as the reverse primer, amplifying to obtain a second fragment of the cyclic dipeptide synthase coding gene criC; and then, taking a fragment of a pMA plasmid subjected to KpnI restriction linearization treatment as a vector, mixing a fragment I and a fragment II of the cyclic dipeptide synthase encoding gene criC and the vector pMA plasmid according to a molar ratio of 1:1:2, connecting by using a multi-fragment connection Kit (Clon express Multi One Step Cloning Kit) to insert the criC into a restriction site KpnI of the pMA plasmid, transforming a connecting system into escherichia coli DH5 alpha after connection, obtaining a positive clone after overnight culture, and finally obtaining an expression plasmid pMA-criC after PCR verification and enzyme digestion verification, wherein the schematic diagram is shown in figure 1.

Nucleotide sequence of expression plasmid pMA-criC:

ATGGGCTCCATCGAATCCGACTCTGTCCTCTCTTTCTTCAGTCAACAGTGTTTTCAACACCCAGACAACACTGCTATTGACGATGGGCCAAACGGCAACCTCTCCTACAGCCAGCTCGACCAACAGTCTTCCACACTCGCCCATTGCCTACGGCAAAATGGCATCAAGGCAGGTCAGGTGGTTCCGCTCCTGACAACCTCCCGTCTGGAAATGGTCATTGCGGTTTTGGGGATTCTTAAAGCCGGCGGCGTCTATGTGCCCGTTGATATTGATCAATGGCCTGCGGACCGCATTAACTATGTGTTGGGCCGTACATGTTCGGGCCTTGTGGTCTATACAGGTGACCATATCCCCTCCGGTATAAATCTCGAGGAAAAGTGTCGCGTTGTCCAGGTTCAGATTCGGCTTGAAAACGAACTCAAAGCACAATACGAGCCCAATCCAAGGCCCCGGTTGATGTGTATCATCTTCACCTCTGGCACTACCGACAAACCAAAAGGCGTCATGGTTCCACATACCTCTGTTGCTCGGTTTGTCACATCACCGGGCTTCAACTATGATATAGTGCCGGGAGACCGGGTCTTGTTGGTACTTTCGGTAGCATTCGATGGTATGTTCGAATAGCCCGTTCTCATTGAAATGGCGAAACTAATACGGAATCGTTAGCATGCATGGGTACCTTGTTCAACACGATTTGTAACGGAGGAACAGTGATCCTGGCCAACAGATTAAACTTTCAGGAACGGTCTCGGCAATGCACGGTCCTTGTCATGACGCCGTCGATTCTGGATGTGTTGAGCCCTCCTCAATCTCCATCAGACTACCCCCAACTTGAGCGTATTTTCCTTGGTGGAGAGACTCCGTCACAGCAATTGCTGGAGGCATGGTCAGCTTTCAACGACGTGGCTCTGTGGATTGCCTATGGTCCGACCGAAGCTACCTGTGCAGTGTTGTGTGGTCGTCTACAAGCATCCAGTGAGACTGGCCAATTCCATCCCACGAGGCTAGGGCACAGCATCCCCGGCTCGAGTGTGCTATTGCTCACCGAGAGAATGGAAACAATCCAAGACAGCAACATGGAAGGGGAAATATGCATCGAAGGCCCATGTTTGACGGATGGGTATTGGCAGGATGAGGAACGCACGAAGGACCGATTCATAGAATATCACGGACGACGTGTCTACCGCACTGGCGACCTCGGTCGATTTGTGACCACGGAAGATAACGAGACCGCCATAGAATTTTGTGGACGGCGTGATAGGGTTACCAAAATCCGAGGGTTTTTGGTTAATCTAGAGTTGGACGTCGACGCTGGTCTTCGACGTCTTGATCCGAATATTACCGCCGTTTTCTCCATTCTGCTCGATAGAAAGCTATGCACAGCAGTCGTGCCATCGTCAGTTGATTGTCGCAATCTACAGGCAGCTTGGCGGCTGGTGGCCCCGCCCTACCTCGTGCCTGATAAGATGGTTGCCCTCGATGGCCTCCCGCTGACGGCAAATGGAAAATTCGATCCTCGGCAAGTTATCAGCATTTTGCGGGATGCATTGCAAAAAGACGCGACCATGCAGAATGGTACATCGCACAATAATGGTGCCGCCAATGATCGAAAGCAGTACAACTGGCGTTCAGGCCCTTTAACGATTGACCAGACGATCATCAAAGGTCTTCAACAGGTCTTAGGAATCTCTCAGTCCGAAATCAATATGAAGGACTCTGCCGTGTTCCAGGGCGTACATTCATTGGCTGCAGCTAGATTGTCGACATTTTGCCGGCACCATGGATACAATGTCTCTGTCGAGAGCATCCTCACGGAGCCATCCCTTCACGCCTTAGTTGAGAAAAATCGCCACGAGACAGAGAATCGACCAGATAGCTCGGCATTTGCCACAAGAACGCCGGAAGAAAGCTCTATGCCCACCCAAGGACCAGTGACGCCCTTGCAGAAGCGGATGGTCCTCGACAGTATAGTGGAGGATCCTAGGGCCAATTGCCTCCAGCATATCTCTTGGTATAAGACGGAAGACATTGGAAGGCTCCGAGAGGCCTGGAAAACGGTGGTAACCCATGAGCCCATTTTCCAGACTACTTTTGAGCTGGACGAGACACAAGAGCCATCTCAGAGACTCATCGGTGCTGGACTCTTCATATGGGAAGAGACAACTGTTACCACACACGCAGCCATTAAAGAAAGCCTCAAATCTCTCCCTGCCGCCACCGGTCTAGGGTCACGATTCCGCGTGCTGCATTGCGTCGGATCGGAGTTCCCCCACAACGAAAGTATGTTTGTATGGGCGGTGCATCATGCGCTCATTGACGGTTACTCCGCTTCACTGGTGTTCGAAAAGGTCGACAAAGCGCTGCAAAATGAGCCCTTTGAATCCTCCCATCCTTTCATGCTTGCAGCTCAGGATATTGCTCAAATGCGGGATAAACTAGCACCCGAGGTCGACCATTTCTGGAAAGACCAAGAGGCACAGTATCCTGGGGCAGCGGGTGAACCTCTCATCCCGGAGGCGTTGACGAACCAAAGCGGGGTGGACTTCGCTGAGCATGTCGTGAACGTTAGTATAGACAACCAACGCCTGCGCTTTGCGGCACAGCAGGCCCAGGCTACTCCGGCTGCCATCTTCTATGCAGCATGGGCGTTGTTGCTATCTAGCTACACGAATTCAGACACGGTGATCTTTGGGGCTGTCTTCTCCGGAAGGAATCTTCCATTCTCATGGGCCCCGTGCATGGTCGGGCCGCTGCTCAATATTCTGCCCTTGCGGTGCCGTATCAAACGCGACATCGAATCGGCCAGTTTTGTTCGCGAGATTCACCAAACAATCCAGAATATCTCTCGATTTCAGGTTGCTGATCGCCCAAAAGATACACCACCGTTTGCAAGCACTTTGACCGTACAAGATTCTGGTCTTCGGTCTGGGACTACTGCTATCCCTTCACTTCACTCTCCAGAAGTCAGAGAGTCAAATTTGCTTCCACTCACGGTTGTAGTCGAAACTGACAGCCAAATCACCTTTCTGTATCGCACAGATCGGTTTTCTGAAAGCCACGTAAAGGACATGGCAGCCATTTACATGAGCTTACTCGATGCCTTTCTCGACCCGGGACGAAGTCTACAGCACTGTATGGATCGCCGGTTTCCAATTGAAATGAACCAGGCCATACTGCAAACAGGAAACATCGATTCTGAAGTCGCGCGAGTTCCTTCTGTAGACGGGGGACACACTCTTTCCAGTCTCTTCGGTACGGTCGCTAGTCTGCACCCCACGCATATCGCAGTTCAAAAAGGGTCACATTCAATTACCTACGCTACCTTGGTCCAATATGCAGCTCGGGTAGCTGCAGTAATTGAGAAAAAGACACAGCCGGGAGAAGTGGTAGCCATCCTGGCCGATAGATCAATCAATTGGATTGTCGGCATTATGGGGGCCACCGCTGCCAATACAGTGTATTGTCCGTTGGATTCATCATACCCGGCTGAGTATCGAGAAGACCTGCTTCGGCGCAGCCATGCCAAGTTATTCCTGGTTCCCAGCAAGTCACAACTCCCGACAGCCGATAGCGGAGTGGCAACCGTTTCCATCGAAGACATCCTAGCTAGTGATATCAAACCACTTTATCCATGGCGAAAGCAAACACCTAGCGATGGAGCATACATTTGCTTCACGTCAGGTTCAACAGGTGTTCCGAAAGGCAAGTATCTCAGCAACCTCTGTTTACAATGTTACTAATGTATATCGTGATAGGCGTTCTTTGCCTGCATCAAGGAGTGGTTTCGTTGCAATCATCCTCCGAGGAAGGACGGCTGCATAGTGAGCCTGGACGGCGTATCGCTCAGTTCATGTCAACTGGTTTCGATGTCTGCGTTCATGAGGTTTTCGCCAGTCTTTGCTACGGAGCCACACTAGTCTTGCGCAAGGACGATGATGACCCCTTTTCTCATCTAGCTGATGTGGATGTGGTGTCCATGAATGCTACTGTTGCTGGTTCGCTAGATCCTTCAGAGTATCCTGATTTGCACTATGTATGCCCTCCTTGTTCGCGTGTATTTCATCAGGGGCTTACCAGATTTAAACCAGGTTTACCTCGCTGGGGAGCCAATCCCTCAAAGAACAGCAGACAAGTGGGCAGTAGGTCGGAAGCTGTACAATGCATACGGGCCTACAGAGGTGCGTACTATTCTTCTATCATTCAAGCTGTCTGTGACGGTATGTGCTGTGATACGTAACTGACTATTTCAGGCCACCATTATCGTCACGAGGACGCTACTCCAAGCAGGCATTCTAGTTGCTATCGGTAAACCGTTTCCTTCTGTAAGAGCATACATCCTCAACGACCGCAGGGAGCTTCAGCCGCCAAACACACTGGGCAATCTCTTTGTCGCGGGGGTACAAGTGAGCCACGGCTATCTCGACCTACCAGAGGCCACCGCCAATTCATACTTCCCTGATCCTTTTCTTCCTGGATCTTCCAACGAGCGCATGTACGACACCGGTGACATTGGATTCTGGGACACAGACGGGAAAATCCAGTGCTGTGGCCGTAAGGACCGTCAGGTCAAAGTACGCGGGTTCCGTATTAACCTCGACGGTATCTCCAACATGGCCACCCTCCGCATGCCTACAATTCGCCACGCTGCTGCTTTTGTCAAGGATGGTGCAGTTGTATTGTGCGTGGAACCGGAAGACGTGAACACGGACGAGCTGCGGGCCCGATTAAAGGATGCTCTGCCTCCGCATGCGATCCCGCGGACCATATATTCCATTGCACATATTCCGTTATCATTGAACGGGAAAATCGATGTCAAGCATTTGGCTGCTATGGAAGTTCGCAACGACACGGCGCTAACCAATGGAATTACCAAGGCAAATAAGCTGGATTCAGCCCAACAAACGAGCAGCAATGGTCTGAGTAATGGTGCTTCCCATGCCTCGAGCGAAGCGCACCTTGAGAAGCTTATTATTAAAGAGTGGCAACAGCTTCTCGGCCTCGATCCATCGCAACCACTTTCTAGGTCGGACGACTTCGTCCTTCTCGGGGGGGATTCCATTCGACAACTCAACTTGGCGGCACGCCTTCGGTCCGTACTTGGGCTTCCAATCAAGGTTAAGGACATCATCCGGTCATCCACGTTGGGTGACTTGATTACCCTAGTTGCGCAGCAGCAAGAGCAGCATGGAAAGAAGAATGTACCTAACGGTACACCTGCTCACAATTCCGTGCATCGACCACTAGGATATAAGAAGCTCTCACCCCCAGAAATGGAATGGGCATGTAAATATCGCCATTCGCAATCGCAGTCAACCTTCAATGTGCCTTATGTTGCACGGCTCTCATCAGCAGTTGACTGGCAACGTCTCGCGAGCGCCTTAGAAACGGTCCTCAATCGCCATCGCGTGTTGAGATCGCGATTCACTACGAAGGATGGAACTGGCGAACGCGTTTTGTCTGAACATCCGATCAGTGTAAATCGGACGGTGGATGATATCGACATTCAAGAGGTGATCAACCGGCCCTTTGAGTTCGACAGCAGTGAAGCCCTTATCCGCACGGTTATATCGCCATCTACACTGGTTCTGTGTATTTCGCATATCCTATGTGATCTAACTGCCATCAACACGCTGTTATATGAAGTTGCAGCTACCTATCGTGGATTGGCCTTACCTCCGGTGGTGCGTGAGTATTTTGATGTCACATGGCACCACACAGTCGACCCGGAAAAGCAACGATTCTGGGCAGAGTACTTACAAGGTCTCAGTTTCAAGCAGCCAGATGAAGTCAAACAAGTCAATGGAGTCAATGGCTGTGATCACTCGAACGGTACGAAGATTCGCAAACCACGCTCGTACCGGGGAACCTCACGGACAACGAGTCTGTCCGACAGTCTGTATCGTCACCTTATCATATCCTCGACCAAGAATGGTTTCACATTCCACCAGTTTGGCATGGCCGTTGCCGGGCTCGTGCTGCATTTTCTGACTGGTCGAGACGACATTGTGCTTGGCTCCCCATTTGTCAATCGCCCTTCGTTCGAGGACCGACAGGTAATCGGCTTATTCCTGGAGCCATTGCCTGTTCGTATTTCCGTGAAGCACCAGAACGAGAATGATGGCGGACCTGGCGCTCGCGAGTTCGTGCAGAGCGTCCGACAATCCTCACAATCGGCGCTGGCACACAGCGTACCCTGGGCAGAATTGATGTCCCATTTGGGGCTCCCTTTCCCCTCCGCACAGCCTCAGGTCTTTTCCTGCTGCGTCACTTTCCATGACGACCGGGGAACAGATCCACCTCTGGCGATAAATGGCGTGGAGGGACAGTACATTTCAGCGGAGGGAGCGAAATTCCCCTTGTTGTTCGAGTGGCAGGCAACCAGGGCTACCGGTCAACATGAGCAACTCACTGTGCGCCTTGAGTATGATACCGATTGGTTTTCCGCGGAGTTTACAGAGATTCTCGAGGCACTGTTGCTGGAGTGCTTCCGGATGTTGTTGGAGGAAGAGGGCAGCCGTCATGGCGAAGTGAAGGGACGGCTGGGAGAGGTGCTTCAGAGCGAAGCCACTCGTATCGGAGTTGCGGTGGATGAGATATACGAGACGGCGCGACAGTATCTAACGGTGGTATAG

uniformly smearing Aspergillus oryzae (Aspergillus oryzae) spores on PDA (potato dextrose agar) culture medium, and culturing at 30 deg.C for one week to obtain large amount of Aspergillus oryzae (Aspergillus oryzae) spores; inoculating a proper amount of spore preservation solution of Aspergillus oryzae (Aspergillus oryzae) into a DPY culture medium containing 100mL, and performing shake culture at 30 ℃ and 200rpm for 2-3 days to obtain thallus of Aspergillus oryzae (Aspergillus oryzae) in a good growth state; in an aseptic environment, filtering and collecting thalli by using a funnel with a sterilized filtering hole diameter of 5mm, filtering and collecting thalli of Aspergillus oryzae (Aspergillus oryzae), washing the thalli with sterile water for 3-5 times to remove a residual culture medium on the surfaces of the thalli to obtain clean thalli, and repeatedly squeezing the thalli in the funnel to remove water. Then transferring the thalli into a 50mL sterilized centrifuge tube, adding 20mL of cell wall dissolving solution (prepared by dissolving 1.0% carbohydrase (Takara Shuzo) in the solution I), and carrying out mild oscillation for 2-3 hours at the temperature of 28 ℃ to obtain protoplasts, wherein the protoplast degree can be observed by using a microscope in the enzymolysis process.

The enzymatic solution was filtered through a sterilized Miracloth (Merck Germany) into a 50mL sterilized centrifuge tube, centrifuged at 800rpm for 10 minutes at 4 ℃ and the supernatant was decanted in a clean bench, the bottom precipitated as protoplasts of Aspergillus oryzae (Aspergillus oryzae), the protoplasts were washed 2 times with sterilized 0.8M NaCl solution, an appropriate amount of a mixture of buffer II and buffer III was prepared in a 4:1 ratio, and the protoplast concentration was adjusted to 2X 10 with the aid of the mixed solution by means of a microscope⁸cell/mL, putting 200mL of protoplast solution with adjusted concentration into a new 50mL centrifuge tube, adding 10 μ g of expression plasmid pMA-criC, gently blowing and beating by using a pipette to fully mix the mixed system, carrying out ice bath for 20 minutes, adding 1mL of buffer solution III into the mixed system, incubating for 20 minutes at room temperature, then adding 10mL of buffer solution II, mixing uniformly, centrifuging for 10 minutes at the rotating speed of 800rpm at 4 ℃, removing the supernatant, adding 1mL of buffer solution II, gently blowing and beating by using the pipette to mix uniformly, transferring 200 μ L of mixed solution after mixing uniformly to an improved Chaudou culture medium plate, then adding 5mL of covering culture medium in a liquid state at 50 ℃, adding the covering culture medium, shaking uniformly to mix the covering culture medium and 200 μ L of mixed solution, uniformly covering the surface of the improved Chaudou culture medium plate, sealing the plate after the covering culture medium is solidified, and (5) performing inverted culture for 3-7 days.

After mycelia grow on the surface of the improved Czochralski medium plate of the Aspergillus oryzae transformant containing the pMA-criC, the mycelia continuously grow to form colonies. And (3) picking a proper amount of hyphae into 50 mu LTE buffer solution (1M Tris,0.5M EDTA, PH8.0), shaking and uniformly mixing, taking 1 mu L as a template, carrying out PCR verification by taking P1F and P1R as the templates, and carrying out 2 times of subculture on positive transformants on the same improved Czochralski culture medium plate to obtain a genetically stable high-yield strain (A.oryzae/pMA-criC) of L-tryptophan-L-alanine cyclic dipeptide.

The DPY culture medium is prepared by the following steps: 2g Dextrin (Dextrin), 1g Polypeptone (Polypeptone), 0.5g Yeast powder (Yeast Extract), 10mg Adenine (Adenine), 925mg ammonium sulfate, 150mg Methionine (Methionine) and 60mg Arginine (Arginine), and water was added to the mixture to a volume of 100 mL.

The improved Chachi culture medium is prepared by the following steps: each 200mL of the modified Chao's medium contained 7.0g of Chao's medium (Czapek-Dox), 9.3g of NaCl, 1.8g of (NH4)₂SO₄20mg of Adenine (Adenine), 300mg of Methionine (Methionine) and 3g of Agar powder (Agar).

The overlay medium consisted of 1.2M Sorbitol (Sorbitol) and 0.5% Agar powder (Agar).

The solution I consists of a 0.8M sodium chloride solution and a 10mM sodium dihydrogen phosphate solution.

The solution II consisted of 1.2M Sorbitol (Sorbitol), 50mM calcium chloride solution, 50mM sodium chloride solution and 10mM tromethamine (Tris) and was adjusted to pH 7.5.

The solution III consists of 40% polyethylene glycol-4000 (PEG-4000), 50mM calcium chloride solution and 50mM tromethamine (Tris).

Step S3: preparing L-tryptophan-L-alanine cyclic dipeptide;

inoculating hypha of a high-producing strain (Aspergillus oryzae/pMA-criC) carrying L-tryptophan-L-alanine cyclic dipeptide into a sterilized culture medium filled with rice (50 g of rice and 30mL of water per 500mL of triangular flask, and soaking the rice for three hours and then sterilizing), and performing standing culture at 28 ℃ for two weeks; when hyphae cover the surface of the culture medium and produce a large number of spores, L-tryptophan-L-alanine cyclic dipeptide synthesized by the thalli is secreted in the culture medium. HPLC analysis of an ethyl acetate crude extract of the metabolite of the host bacterium (Aspergillus oryzae/pMA-criC) and the highly productive strain of L-tryptophan-L-alanine cyclodipeptide (Aspergillus oryzae/pMA-criC) is shown in FIG. 2, and the mass spectral characteristics and spectral characteristics of L-tryptophan-L-alanine cyclodipeptide are shown in FIG. 3.

Extracting the culture medium containing mycelia with equal amount of ethyl acetate for 3 times, mixing extractive solutions, and concentrating under low pressure to obtain fermented liquid extract. Performing coarse segmentation on the fermentation liquid extract by using normal phase chromatography of silica gel filler, preliminarily judging the distribution segment of the L-tryptophan-L-alanine cyclic dipeptide by using TLC, combining the segments containing the L-tryptophan-L-alanine cyclic dipeptide, then subdividing by using reverse phase chromatography of C18 filler, judging the position of the L-tryptophan-L-alanine cyclic dipeptide by using TLC, and finally preparing by using Agilent HPLC1260 Infinity II liquid chromatograph under the detection of 275nm wavelength to obtain a pure product (purity is more than 98%). The structure was confirmed by means of a 400M nuclear magnetic instrument, and the structural data (solvent is deuterated methanol) is as follows;

the normal phase chromatographic packing used in the separation preparation process is 200-mesh 300-mesh silica gel, the reverse phase chromatographic packing is C18 chromatographic packing, the high performance liquid chromatograph used for the preparation is Agilent 1260Infinity II, the chromatographic column is Agilent ZORBAX RX-C18, 9.4 x 250mm, and the detection wavelength is 275 nm.

Sequence listing

<110> northeast university of forestry

<120> a method for preparing L-tryptophan-L-alanine cyclic dipeptide by using Aspergillus oryzae

<160> 5

<210> 1

<211> 6632

<212> DNA

<213> expression plasmid pMA-criC.

atgggctcca tcgaatccga ctctgtcctc tctttcttca gtcaacagtg ttttcaacac 60

ccagacaaca ctgctattga cgatgggcca aacggcaacc tctcctacag ccagctcgac 120

caacagtctt ccacactcgc ccattgccta cggcaaaatg gcatcaaggc aggtcaggtg 180

gttccgctcc tgacaacctc ccgtctggaa atggtcattg cggttttggg gattcttaaa 240

gccggcggcg tctatgtgcc cgttgatatt gatcaatggc ctgcggaccg cattaactat 300

gtgttgggcc gtacatgttc gggccttgtg gtctatacag gtgaccatat cccctccggt 360

ataaatctcg aggaaaagtg tcgcgttgtc caggttcaga ttcggcttga aaacgaactc 420

aaagcacaat acgagcccaa tccaaggccc cggttgatgt gtatcatctt cacctctggc 480

actaccgaca aaccaaaagg cgtcatggtt ccacatacct ctgttgctcg gtttgtcaca 540

tcaccgggct tcaactatga tatagtgccg ggagaccggg tcttgttggt actttcggta 600

gcattcgatg gtatgttcga atagcccgtt ctcattgaaa tggcgaaact aatacggaat 660

cgttagcatg catgggtacc ttgttcaaca cgatttgtaa cggaggaaca gtgatcctgg 720

ccaacagatt aaactttcag gaacggtctc ggcaatgcac ggtccttgtc atgacgccgt 780

cgattctgga tgtgttgagc cctcctcaat ctccatcaga ctacccccaa cttgagcgta 840

ttttccttgg tggagagact ccgtcacagc aattgctgga ggcatggtca gctttcaacg 900

acgtggctct gtggattgcc tatggtccga ccgaagctac ctgtgcagtg ttgtgtggtc 960

gtctacaagc atccagtgag actggccaat tccatcccac gaggctaggg cacagcatcc 1020

ccggctcgag tgtgctattg ctcaccgaga gaatggaaac aatccaagac agcaacatgg 1080

aaggggaaat atgcatcgaa ggcccatgtt tgacggatgg gtattggcag gatgaggaac 1140

gcacgaagga ccgattcata gaatatcacg gacgacgtgt ctaccgcact ggcgacctcg 1200

gtcgatttgt gaccacggaa gataacgaga ccgccataga attttgtgga cggcgtgata 1260

gggttaccaa aatccgaggg tttttggtta atctagagtt ggacgtcgac gctggtcttc 1320

gacgtcttga tccgaatatt accgccgttt tctccattct gctcgataga aagctatgca 1380

cagcagtcgt gccatcgtca gttgattgtc gcaatctaca ggcagcttgg cggctggtgg 1440

ccccgcccta cctcgtgcct gataagatgg ttgccctcga tggcctcccg ctgacggcaa 1500

atggaaaatt cgatcctcgg caagttatca gcattttgcg ggatgcattg caaaaagacg 1560

cgaccatgca gaatggtaca tcgcacaata atggtgccgc caatgatcga aagcagtaca 1620

actggcgttc aggcccttta acgattgacc agacgatcat caaaggtctt caacaggtct 1680

taggaatctc tcagtccgaa atcaatatga aggactctgc cgtgttccag ggcgtacatt 1740

cattggctgc agctagattg tcgacatttt gccggcacca tggatacaat gtctctgtcg 1800

agagcatcct cacggagcca tcccttcacg ccttagttga gaaaaatcgc cacgagacag 1860

agaatcgacc agatagctcg gcatttgcca caagaacgcc ggaagaaagc tctatgccca 1920

cccaaggacc agtgacgccc ttgcagaagc ggatggtcct cgacagtata gtggaggatc 1980

ctagggccaa ttgcctccag catatctctt ggtataagac ggaagacatt ggaaggctcc 2040

gagaggcctg gaaaacggtg gtaacccatg agcccatttt ccagactact tttgagctgg 2100

acgagacaca agagccatct cagagactca tcggtgctgg actcttcata tgggaagaga 2160

caactgttac cacacacgca gccattaaag aaagcctcaa atctctccct gccgccaccg 2220

gtctagggtc acgattccgc gtgctgcatt gcgtcggatc ggagttcccc cacaacgaaa 2280

gtatgtttgt atgggcggtg catcatgcgc tcattgacgg ttactccgct tcactggtgt 2340

tcgaaaaggt cgacaaagcg ctgcaaaatg agccctttga atcctcccat cctttcatgc 2400

ttgcagctca ggatattgct caaatgcggg ataaactagc acccgaggtc gaccatttct 2460

ggaaagacca agaggcacag tatcctgggg cagcgggtga acctctcatc ccggaggcgt 2520

tgacgaacca aagcggggtg gacttcgctg agcatgtcgt gaacgttagt atagacaacc 2580

aacgcctgcg ctttgcggca cagcaggccc aggctactcc ggctgccatc ttctatgcag 2640

catgggcgtt gttgctatct agctacacga attcagacac ggtgatcttt ggggctgtct 2700

tctccggaag gaatcttcca ttctcatggg ccccgtgcat ggtcgggccg ctgctcaata 2760

ttctgccctt gcggtgccgt atcaaacgcg acatcgaatc ggccagtttt gttcgcgaga 2820

ttcaccaaac aatccagaat atctctcgat ttcaggttgc tgatcgccca aaagatacac 2880

caccgtttgc aagcactttg accgtacaag attctggtct tcggtctggg actactgcta 2940

tcccttcact tcactctcca gaagtcagag agtcaaattt gcttccactc acggttgtag 3000

tcgaaactga cagccaaatc acctttctgt atcgcacaga tcggttttct gaaagccacg 3060

taaaggacat ggcagccatt tacatgagct tactcgatgc ctttctcgac ccgggacgaa 3120

gtctacagca ctgtatggat cgccggtttc caattgaaat gaaccaggcc atactgcaaa 3180

caggaaacat cgattctgaa gtcgcgcgag ttccttctgt agacggggga cacactcttt 3240

ccagtctctt cggtacggtc gctagtctgc accccacgca tatcgcagtt caaaaagggt 3300

cacattcaat tacctacgct accttggtcc aatatgcagc tcgggtagct gcagtaattg 3360

agaaaaagac acagccggga gaagtggtag ccatcctggc cgatagatca atcaattgga 3420

ttgtcggcat tatgggggcc accgctgcca atacagtgta ttgtccgttg gattcatcat 3480

acccggctga gtatcgagaa gacctgcttc ggcgcagcca tgccaagtta ttcctggttc 3540

ccagcaagtc acaactcccg acagccgata gcggagtggc aaccgtttcc atcgaagaca 3600

tcctagctag tgatatcaaa ccactttatc catggcgaaa gcaaacacct agcgatggag 3660

catacatttg cttcacgtca ggttcaacag gtgttccgaa aggcaagtat ctcagcaacc 3720

tctgtttaca atgttactaa tgtatatcgt gataggcgtt ctttgcctgc atcaaggagt 3780

ggtttcgttg caatcatcct ccgaggaagg acggctgcat agtgagcctg gacggcgtat 3840

cgctcagttc atgtcaactg gtttcgatgt ctgcgttcat gaggttttcg ccagtctttg 3900

ctacggagcc acactagtct tgcgcaagga cgatgatgac cccttttctc atctagctga 3960

tgtggatgtg gtgtccatga atgctactgt tgctggttcg ctagatcctt cagagtatcc 4020

tgatttgcac tatgtatgcc ctccttgttc gcgtgtattt catcaggggc ttaccagatt 4080

taaaccaggt ttacctcgct ggggagccaa tccctcaaag aacagcagac aagtgggcag 4140

taggtcggaa gctgtacaat gcatacgggc ctacagaggt gcgtactatt cttctatcat 4200

tcaagctgtc tgtgacggta tgtgctgtga tacgtaactg actatttcag gccaccatta 4260

tcgtcacgag gacgctactc caagcaggca ttctagttgc tatcggtaaa ccgtttcctt 4320

ctgtaagagc atacatcctc aacgaccgca gggagcttca gccgccaaac acactgggca 4380

atctctttgt cgcgggggta caagtgagcc acggctatct cgacctacca gaggccaccg 4440

ccaattcata cttccctgat ccttttcttc ctggatcttc caacgagcgc atgtacgaca 4500

ccggtgacat tggattctgg gacacagacg ggaaaatcca gtgctgtggc cgtaaggacc 4560

gtcaggtcaa agtacgcggg ttccgtatta acctcgacgg tatctccaac atggccaccc 4620

tccgcatgcc tacaattcgc cacgctgctg cttttgtcaa ggatggtgca gttgtattgt 4680

gcgtggaacc ggaagacgtg aacacggacg agctgcgggc ccgattaaag gatgctctgc 4740

ctccgcatgc gatcccgcgg accatatatt ccattgcaca tattccgtta tcattgaacg 4800

ggaaaatcga tgtcaagcat ttggctgcta tggaagttcg caacgacacg gcgctaacca 4860

atggaattac caaggcaaat aagctggatt cagcccaaca aacgagcagc aatggtctga 4920

gtaatggtgc ttcccatgcc tcgagcgaag cgcaccttga gaagcttatt attaaagagt 4980

ggcaacagct tctcggcctc gatccatcgc aaccactttc taggtcggac gacttcgtcc 5040

ttctcggggg ggattccatt cgacaactca acttggcggc acgccttcgg tccgtacttg 5100

ggcttccaat caaggttaag gacatcatcc ggtcatccac gttgggtgac ttgattaccc 5160

tagttgcgca gcagcaagag cagcatggaa agaagaatgt acctaacggt acacctgctc 5220

acaattccgt gcatcgacca ctaggatata agaagctctc acccccagaa atggaatggg 5280

catgtaaata tcgccattcg caatcgcagt caaccttcaa tgtgccttat gttgcacggc 5340

tctcatcagc agttgactgg caacgtctcg cgagcgcctt agaaacggtc ctcaatcgcc 5400

atcgcgtgtt gagatcgcga ttcactacga aggatggaac tggcgaacgc gttttgtctg 5460

aacatccgat cagtgtaaat cggacggtgg atgatatcga cattcaagag gtgatcaacc 5520

ggccctttga gttcgacagc agtgaagccc ttatccgcac ggttatatcg ccatctacac 5580

tggttctgtg tatttcgcat atcctatgtg atctaactgc catcaacacg ctgttatatg 5640

aagttgcagc tacctatcgt ggattggcct tacctccggt ggtgcgtgag tattttgatg 5700

tcacatggca ccacacagtc gacccggaaa agcaacgatt ctgggcagag tacttacaag 5760

gtctcagttt caagcagcca gatgaagtca aacaagtcaa tggagtcaat ggctgtgatc 5820

actcgaacgg tacgaagatt cgcaaaccac gctcgtaccg gggaacctca cggacaacga 5880

gtctgtccga cagtctgtat cgtcacctta tcatatcctc gaccaagaat ggtttcacat 5940

tccaccagtt tggcatggcc gttgccgggc tcgtgctgca ttttctgact ggtcgagacg 6000

acattgtgct tggctcccca tttgtcaatc gcccttcgtt cgaggaccga caggtaatcg 6060

gcttattcct ggagccattg cctgttcgta tttccgtgaa gcaccagaac gagaatgatg 6120

gcggacctgg cgctcgcgag ttcgtgcaga gcgtccgaca atcctcacaa tcggcgctgg 6180

cacacagcgt accctgggca gaattgatgt cccatttggg gctccctttc ccctccgcac 6240

agcctcaggt cttttcctgc tgcgtcactt tccatgacga ccggggaaca gatccacctc 6300

tggcgataaa tggcgtggag ggacagtaca tttcagcgga gggagcgaaa ttccccttgt 6360

tgttcgagtg gcaggcaacc agggctaccg gtcaacatga gcaactcact gtgcgccttg 6420

agtatgatac cgattggttt tccgcggagt ttacagagat tctcgaggca ctgttgctgg 6480

agtgcttccg gatgttgttg gaggaagagg gcagccgtca tggcgaagtg aagggacggc 6540

tgggagaggt gcttcagagc gaagccactc gtatcggagt tgcggtggat gagatatacg 6600

agacggcgcg acagtatcta acggtggtat ag 6632

<210> 2

<211> 38

<212> DNA

<213> Artificial sequence

<220>

<223> nucleotide sequence of PCR primer P1F.

<400>2

aattcgagctcggtaccATGTGAAGCTGATATTCATTC 38

<210>3

<211> 39

<212> DNA

<213> Artificial sequence

<220>

<223> nucleotide sequence of PCR primer P1R.

<400> 3

gaccaaggtagcgTAGGTAATTGAATGTGACCCTTTTTG 39

<210>4

<211> 29

<212> DNA

<213> Artificial sequence

<220>

<223> nucleotide sequence of PCR primer P2F.

<400> 4

ttacctaCGCTACCTTGGTCCAATATGCA 29

<210>5

<211> 47

<212> DNA

<213> Artificial sequence

<220>

<223> nucleotide sequence of PCR primer P2R.

<400>5

tactacagatccccgggtaccCTATACCACCGTTAGATACTGTCGCG 47

Claims

1. A method for preparing L-tryptophan-L-alanine cyclic dipeptide by utilizing aspergillus oryzae is characterized by comprising the following steps:

step S1: constructing an expression plasmid pMA-criC;

inoculating a spore preservation solution of Aspergillus oryzae (Aspergillus oryzae) into a DPY culture medium, and performing shake culture for 2-3 days to obtain thalli of the Aspergillus oryzae (Aspergillus oryzae); then adding a cell wall dissolving solution, and carrying out mild oscillation for 2-3 hours to obtain a protoplast; adding a buffer solution II and a buffer solution III into the protoplast, adding an expression plasmid pMA-criC, mixing uniformly, performing ice bath for 18-20 min, adding the buffer solution III into the mixed system, incubating at room temperature for 18-20 min, then adding the buffer solution II, mixing uniformly, centrifuging for 8-10 min, removing supernatant, adding the buffer solution II, mixing uniformly, transferring to an improved Chaudou culture medium plate, adding a covering culture medium, and performing inverted culture for 3-7 days; after hyphae grow out of the culture medium, verifying the hyphae by utilizing PCR, and carrying out subculture on the positive transformant for 2 times to obtain a high-yield strain carrying L-tryptophan-L-alanine cyclic dipeptide;

the buffer solution II consists of 1.2M sorbitol, 50mM calcium chloride solution, 50mM sodium chloride solution and 10mM tromethamine, and the pH is adjusted to 7.5; the buffer solution III consists of 40 percent of polyethylene glycol-4000, 50mM of calcium chloride solution and 50mM of tromethamine; the improved Chao's medium is prepared by the following steps: each 200mL of the modified Chao's medium contained 7.0g of Chao's medium, 9.3g of NaCl, 1.8g (NH4)₂SO₄20mg of adenine, 300mg of methionine and 3g of agar powder;

step S3: preparing L-tryptophan-L-alanine cyclic dipeptide;

2. The method of claim 1, wherein the first fragment and the second fragment of the cyclic dipeptide synthase encoding gene criC and the pMA plasmid fragment linearized by KpnI digestion are mixed at a molar ratio of 1:1:2 in step S1, ligated by using a multi-fragment ligation kit, the ligation system is transformed into Escherichia coli DH5 alpha after the ligation is completed, a positive clone is obtained after overnight culture, and finally the expression plasmid pMA-criC is obtained after PCR and digestion verification.

3. The method for preparing L-tryptophan-L-alanine cyclodipeptide according to claim 1, wherein the culturing of the high-producing strain of L-tryptophan-L-alanine cyclodipeptide based on the expression plasmid pMA-criC in step S2 comprises the following steps: inoculating a spore preservation solution of Aspergillus oryzae (Aspergillus oryzae) into a DPY culture medium containing 100mL, and carrying out shake culture at the temperature of 28-30 ℃ and the rotating speed of 180-200 rpm for 2-3 days to obtain thalli of the Aspergillus oryzae (Aspergillus oryzae); filtering and collecting thallus of Aspergillus oryzae (Aspergillus oryzae), washing with sterile water for 3-5 times, adding 20mL of cell wall dissolving liquid, and carrying out mild oscillation for 2-3 hours at the temperature of 25-28 ℃ to obtain a protoplast; washing the protoplasm for 2 times by using a sterilized 0.8M NaCl solution, adding a buffer solution II and a buffer solution III, adding 10 mu g of expression plasmid pMA-criC, uniformly mixing, carrying out ice bath for 18-20 min, adding 1mL of the buffer solution III into a mixed system, incubating at room temperature for 20min, then adding 10mL of the buffer solution II, uniformly mixing, centrifuging at the temperature of 2-4 ℃ for 8-10 min at the rotating speed of 600-800 rpm, removing a supernatant, adding 1mL of the buffer solution II, uniformly mixing, transferring 200 mu L of the uniformly mixed solution to an improved Chaudou culture medium plate, then adding 5mL of a covering culture medium at the temperature of 45-50 ℃, sealing the plate after the covering culture medium is solidified, and carrying out inverted culture for 3-7 days; after mycelia grow out from transformants containing pMA-criC, verifying the mycelia by using PCR, and carrying out subculture on positive transformants for 2 times to obtain the high-yield strain of L-tryptophan-L-alanine cyclic dipeptide.

4. The method for preparing L-tryptophan-L-alanine cyclodipeptide from Aspergillus oryzae according to claim 1 or 3, wherein the DPY medium is prepared by the following steps: 2g of dextrin, 1g of polypeptone, 0.5g of yeast powder, 10mg of adenine, 925mg of ammonium sulfate, 150mg of methionine and 60mg of arginine, and adding water to quantify 100 mL; the overlay medium consisted of 1.2M sorbitol and 0.5% agar powder.

5. The method for preparing L-tryptophan-L-alanine cyclodipeptide from Aspergillus oryzae according to claim 1 or 3, wherein the cell wall lysis solution is prepared by dissolving 1.0% carbohydrase in solution I; the solution I consists of a 0.8M sodium chloride solution and a 10mM sodium dihydrogen phosphate solution.

6. The method for producing L-tryptophan-L-alanine cyclodipeptide according to claim 1, wherein the mycelium of a high-yielding strain carrying L-tryptophan-L-alanine cyclodipeptide is inoculated into a sterilized culture medium filled with rice in step S3, and the culture medium is left to stand at 25 to 28 ℃ for two weeks; extracting the culture medium for 3-5 times by using ethyl acetate, and concentrating to obtain a fermentation liquid extract; performing coarse separation on the fermentation liquid extract by using a normal phase chromatogram, performing fine separation by using a reverse phase chromatogram, and preparing by using a high performance liquid chromatograph to obtain the L-tryptophan-L-alanine cyclic dipeptide.

7. The method for preparing L-tryptophan-L-alanine cyclic dipeptide from Aspergillus oryzae according to claim 1, wherein the expression plasmid pMA-criC is obtained by inserting the first fragment and the second fragment of the cyclic dipeptide synthase encoding gene criC into the restriction site KpnI of the pMA plasmid using a ligase-independent multi-fragment one-step cloning kit, taking the fragment of the pMA plasmid after being linearized by KpnI cleavage as a vector in step S1; the ratio of mass of the pMA plasmid to volume of KpnI was 1. mu.g: 1 μ L.

8. The expression plasmid pMA-criC obtained by the method for preparing L-tryptophan-L-alanine cyclodipeptide from Aspergillus oryzae according to claim 1, wherein the nucleotide sequence is represented by SEQ ID No.1 of the sequence Listing.