CN115976093B - Method for preparing orcein by using aspergillus oryzae - Google Patents
Method for preparing orcein by using aspergillus oryzae Download PDFInfo
- Publication number
- CN115976093B CN115976093B CN202211110735.0A CN202211110735A CN115976093B CN 115976093 B CN115976093 B CN 115976093B CN 202211110735 A CN202211110735 A CN 202211110735A CN 115976093 B CN115976093 B CN 115976093B
- Authority
- CN
- China
- Prior art keywords
- hera
- pra
- orcein
- aspergillus oryzae
- fragment
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
A method for preparing orcein by using aspergillus oryzae relates to the technical field of microbial chemistry. The invention aims to solve the problems of high selling price of commercial sedge color acid, low purity, low yield and complex synthesis process of the traditional sedge color acid preparation method. The method comprises the following steps: taking a fragment of pRA plasmid subjected to KpnI enzyme tangential treatment as a vector, and inserting a fragment I and a fragment II of the orce synthase encoding gene herA into the pRA plasmid to obtain an expression plasmid pRA-herA; obtaining a high-yield orcein strain; inoculating mycelium of the high-yield orcein strain into a sterilized rice culture medium, and extracting and concentrating the cultured thalli to obtain a fermentation broth extract; separating the fermented liquid extract with silica gel, and preparing with high performance liquid chromatograph to obtain the orcein. The invention can obtain a method for preparing the orcein by using aspergillus oryzae.
Description
Technical Field
The invention relates to the technical field of microbial chemistry, in particular to a method for preparing orchromatic acid by using aspergillus oryzae.
Background
The sequoyic acid (2, 4-dihydroxyl-6-methylbenzoic acid) is a dihydroxyl benzoic acid derivative, and a compound taking the sequoyic acid derivative as a structural framework has the biological activities of anti-inflammation, anti-bacteria, anti-tumor, anti-oxidation, anti-diabetes and the like, and has potential application value in the aspect of clinical medicine development.
At present, isolated identification of orcein from herbs, moss, bacteria and fungi has been achieved. However, the currently commercialized orc is only produced by chemical synthesis, the selling price is about 1000 yuan/100 mg, and the preparation method has the problems of low yield, instability, complex synthesis process and the like, so that the application of the orc in the field of medicine is severely restricted. Therefore, a new preparation method is needed to overcome the defects of the prior preparation technology of the orcinol.
Disclosure of Invention
The invention aims to solve the problems of high selling price of commercial orotic acid, low purity, low yield and complex synthesis process of the traditional orotic acid preparation method, and provides a method for preparing orotic acid by using aspergillus oryzae, which successfully obtains the aspergillus oryzae strain (the yield of the orotic acid is about 0.34g/1 kg) capable of efficiently producing the orotic acid.
A method for preparing orcein by using aspergillus oryzae comprises the following steps:
step S1: constructing an expression plasmid pRA-herA;
amplifying by taking genomic DNA of hericium erinaceus as a template, taking P1F as a forward primer and P1R as a reverse primer to obtain a fragment I of a gene herA encoding the orotic acid synthase, and then taking P2F as a forward primer and P2R as a reverse primer, taking the fragment I of the gene herA encoding the orotic acid synthase as a template, and amplifying to obtain a fragment II of the gene herA encoding the orotic acid synthase; taking a fragment of pRA plasmid subjected to KpnI enzyme tangential treatment as a vector, and inserting a fragment I and a fragment II of the orce synthase encoding gene herA into the pRA plasmid to obtain an expression plasmid pRA-herA;
the primer P1F has a sequence of ccgGAATTCGAGCTCGGTACCATGTCCTCCATCGCGGATACG and the primer P1R has a sequence of TTTATCGCGATCATGCCGGTCGTCTCCACGGCG; the primer P2F has a sequence of ACCGGCATGATCGCGATAAACCAGGGCTC and the primer P2R has a sequence of tactacaGATCCCCGGGTACCTCAAGCAGCAAGGCTCTCGAGG;
step S2: obtaining a high-yield orcein strain;
inoculating the spore preservation solution of the aspergillus oryzae into a DPY culture medium, and carrying out shake culture for 2-3 days to obtain aspergillus oryzae mycelia; then adding cell wall dissolving solution, and gently oscillating for 2-3 hours to obtain protoplast; adding buffer solution II and buffer solution III into protoplast, adding expression plasmid pRA-herA, mixing uniformly, ice-bathing for 10-20 min, adding buffer solution III into the mixed system, incubating for 10-20 min at room temperature, adding buffer solution II, mixing uniformly, centrifuging for 10-20 min, removing supernatant, adding buffer solution II, mixing uniformly, transferring to an improved Chlamydia cell culture medium plate, adding a cover culture medium, and culturing upside down for 3-7 days; after mycelium grows out from the pRA-herA transformant, verifying the mycelium by using a PCR method, and carrying out 2 times of subculture on the obtained positive transformant to obtain a high-yield strain carrying the orce acid synthase gene;
buffer II consisted of 1.2M sorbitol, 50mM calcium chloride solution, 50mM sodium chloride solution and 10mM tromethamine per 200mL and pH was adjusted to 7.5; every 200mL of buffer solution III consists of 40% polyethylene glycol-4000, 50mM calcium chloride solution and 50mM tromethamine; the improved Chlamydia medium is prepared by the following steps: each 200mL of modified Bosch-type culture medium contained 7.0g of Bosch-type culture medium, 9.3g of NaCl, 1.8g (NH) 4 ) 2 SO 4 20mg adenine, 300mg methionine and 3g agar powder;
step S3: preparing the orcein;
inoculating mycelium of the high-yield orcein strain into a sterilized rice culture medium, and extracting and concentrating the cultured thalli to obtain a fermentation broth extract; separating the fermented liquid extract with silica gel, and preparing with high performance liquid chromatograph to obtain the orcein.
An expression plasmid pRA-herA obtained by a method for preparing the orcein by using aspergillus oryzae has a nucleotide sequence shown in a sequence table SEQ ID NO. 1.
The invention has the beneficial effects that:
firstly, the invention takes aspergillus oryzae as a host, can provide rich raw materials of acetyl coenzyme A and malonyl coenzyme A to synthesize the orcinol acid; secondly, the expression plasmid pRA-herA used in the invention carries an pAmyB amylase promoter, and can efficiently drive the efficient expression of the orce synthase encoding gene herA when rice is used as a culture medium; thirdly, the high-yield strain A.oryzae/pRA-hereA takes rice culture as a culture medium, and has the advantages of low cost, simple operation, short culture period and simple and easy separation and purification.
The invention is very suitable for large-scale fermentation production, breaks through the limitation of traditional separated resources, separates and extracts fermentation products and identifies various wave spectrums by adopting the culture medium and the culture conditions, can produce a large amount of the orcein by the Aspergillus oryzae heterologous expression strain, has the yield of more than 340mg/1Kg of rice, can effectively solve the problem of source of the orcein, and can provide sufficient raw materials for the synthesis of natural products containing the orcein skeleton structure and related medical intermediates.
The invention provides a method for preparing the orotic acid on a large scale by taking aspergillus oryzae as a host, wherein more than 340mg of the orotic acid can be obtained by fermenting 1kg of rice.
The invention can obtain a method for preparing the orcein by using aspergillus oryzae.
Drawings
FIG. 1 is a chart of HPLC analysis of orchromatic acid, a represents AO-herA, and b represents AO-WT;
FIG. 2 is a UV spectrum of a tongue acid, a is 207nm, b is 262nm, and c is 300nm;
FIG. 3 is a chart of LC-MS detection of orcein;
FIG. 4 shows the acid of the tongue coating color 1 H nuclear magnetic resonance spectrum;
FIG. 5 shows the acid of the tongue coating color 13 C nuclear magnetic resonance spectrum.
Detailed Description
The first embodiment is as follows: the method for preparing the orcein by using the aspergillus oryzae comprises the following steps:
step S1: constructing an expression plasmid pRA-herA;
amplifying by taking genomic DNA of hericium erinaceus as a template, taking P1F as a forward primer and P1R as a reverse primer to obtain a fragment I of a gene herA encoding the orotic acid synthase, and then taking P2F as a forward primer and P2R as a reverse primer, taking the fragment I of the gene herA encoding the orotic acid synthase as a template, and amplifying to obtain a fragment II of the gene herA encoding the orotic acid synthase; taking a fragment of pRA plasmid subjected to KpnI enzyme tangential treatment as a vector, and inserting a fragment I and a fragment II of the orce synthase encoding gene herA into the pRA plasmid to obtain an expression plasmid pRA-herA;
the primer P1F has a sequence of ccgGAATTCGAGCTCGGTACCATGTCCTCCATCGCGGATACG and the primer P1R has a sequence of TTTATCGCGATCATGCCGGTCGTCTCCACGGCG; the primer P2F has a sequence of ACCGGCATGATCGCGATAAACCAGGGCTC and the primer P2R has a sequence of tactacaGATCCCCGGGTACCTCAAGCAGCAAGGCTCTCGAGG;
step S2: obtaining a high-yield orcein strain;
inoculating the spore preservation solution of the aspergillus oryzae into a DPY culture medium, and carrying out shake culture for 2-3 days to obtain aspergillus oryzae mycelia; then adding cell wall dissolving solution, and gently oscillating for 2-3 hours to obtain protoplast; adding buffer solution II and buffer solution III into protoplast, adding expression plasmid pRA-herA, mixing uniformly, ice-bathing for 10-20 min, adding buffer solution III into the mixed system, incubating for 10-20 min at room temperature, adding buffer solution II, mixing uniformly, centrifuging for 10-20 min, removing supernatant, adding buffer solution II, mixing uniformly, transferring to an improved Chlamydia cell culture medium plate, adding a cover culture medium, and culturing upside down for 3-7 days; after mycelium grows out from the pRA-herA transformant, verifying the mycelium by using a PCR method, and carrying out 2 times of subculture on the obtained positive transformant to obtain a high-yield strain carrying the orce acid synthase gene;
buffer II consisted of 1.2M sorbitol, 50mM calcium chloride solution, 50mM sodium chloride solution and 10mM tromethamine per 200mL and pH was adjusted to 7.5; each 200mL of buffer III consists of 40% polyethylene glycol-4000, 50mM calcium chloride solution and 50mM tromethamine; the improved Chlamydia medium is prepared by the following steps: each 200mL of modified Bosch-type culture medium contained 7.0g of Bosch-type culture medium, 9.3g of NaCl, 1.8g (NH) 4 ) 2 SO 4 20mg adenine, 300mg methionine and 3g agar powder;
step S3: preparing the orcein;
inoculating mycelium of the high-yield orcein strain into a sterilized rice culture medium, and extracting and concentrating the cultured thalli to obtain a fermentation broth extract; separating the fermented liquid extract with silica gel, and preparing with high performance liquid chromatograph to obtain the orcein.
The second embodiment is as follows: the present embodiment differs from the specific embodiment in that: in the step S1, the gene herA fragment I and fragment II coded by the orcinol synthase and the pRA plasmid fragment subjected to KpnI enzyme digestion linearization are processed according to the following steps (1-2): (1-2): 2, connecting by using a multi-fragment connection kit, transferring a connection system to escherichia coli DH5 alpha after connection, culturing overnight to obtain a positive clone, and finally obtaining the expression plasmid pRA-herA after PCR verification and enzyme digestion verification.
The other steps are the same as in the first embodiment.
And a third specific embodiment: the present embodiment differs from the first or second embodiment in that: in the step S1, a fragment of pRA plasmid subjected to KpnI enzyme tangential treatment is taken as a vector, and a fragment I and a fragment II of a orce encoding gene herA are inserted into the pRA plasmid by using a multi-fragment one-step cloning kit independent of ligase to obtain an expression plasmid pRA-herA; the ratio of the mass of pRA plasmid to the volume of KpnI enzyme was 1. Mu.g: (1-2) mu L.
Other steps are the same as those of the first or second embodiment.
The specific embodiment IV is as follows: one difference between this embodiment and the first to third embodiments is that: the culturing step of the high-producing strain of orce based on the expression plasmid pRA-herA in step S2 is as follows: inoculating the spore preservation solution of the aspergillus oryzae into 100-200 mL of DPY culture medium, and carrying out shaking culture for 2-3 days at the temperature of 28-30 ℃ and the rotating speed of 180-200 rpm to obtain aspergillus oryzae mycelia; filtering and collecting Aspergillus oryzae mycelia, washing with sterile water for 3-5 times, adding 10-20 mL of cell wall dissolving solution, and gently oscillating for 2-3 hours at 28-30 ℃ to obtain protoplasts; washing protoplast for 2-3 times by using sterilized 0.8M NaCl solution, adding buffer solution II and buffer solution III, adding 2-10 mu g of expression plasmid pRA-herA, mixing uniformly, then carrying out ice bath for 10-20 min, adding 1mL of buffer solution III into the mixed system, incubating for 10-20 min at room temperature, adding 10mL of buffer solution II, centrifuging for 5-10 min at the speed of 800-1000 rpm at the temperature of 0-4 ℃ after mixing uniformly, adding 1mL of buffer solution II after removing supernatant, transferring 100-200 mu L of mixed solution to an improved Chlamydia medium plate after mixing uniformly, adding 5mL of a covering medium at the temperature of 40-50 ℃, sealing the plate after the covering medium is solidified, and culturing in an inverted manner for 3-7 days; after mycelium grows out from the pRA-herA transformant, the mycelium is verified by a PCR method, and the obtained positive transformant is subjected to 2 times of subculture to obtain the high-yield strain carrying the orce acid synthase gene.
Other steps are the same as those of the first to third embodiments.
Fifth embodiment: one to four differences between the present embodiment and the specific embodiment are: the DPY medium in step S2 is prepared as follows: 2g of dextrin, 1g of polypeptone, 0.5g of yeast powder, 10mg of adenine, 925mg of ammonium sulfate, 150mg of methionine and 60mg of arginine, and water is added for quantification to 100mL.
Other steps are the same as those of the first to fourth embodiments.
Specific embodiment six: the present embodiment differs from the first to fifth embodiments in that: the cell wall lysate in step S2 was prepared by dissolving 1.0% of the carbohydrase in solution I.
Other steps are the same as those of the first to fifth embodiments.
Seventh embodiment: one difference between the present embodiment and the first to sixth embodiments is that: each 200mL of solution I consisted of 0.8M sodium chloride solution and 10mM sodium dihydrogen phosphate solution.
Other steps are the same as those of embodiments one to six.
Eighth embodiment: one difference between the present embodiment and the first to seventh embodiments is that: the cover medium in step S2 consisted of 1.2M sorbitol and 0.5% agar powder.
Other steps are the same as those of embodiments one to seven.
Detailed description nine: one of the differences between this embodiment and the first to eighth embodiments is: step S3, inoculating hypha of the high-yield orcein strain into a sterilized culture medium filled with rice, and standing and culturing for two weeks at 28-30 ℃; extracting the cultured thalli for 3-5 times by using ethyl acetate, and concentrating to obtain a fermentation liquid extract; then the reversed phase chromatography is used for subdivision, and then the moss acid is obtained through silica gel separation and high performance liquid chromatography.
Other steps are the same as those of embodiments one to eight.
The following examples are used to verify the benefits of the present invention:
example 1: a method for preparing orcein by using aspergillus oryzae comprises the following steps:
step S1: constructing an expression plasmid pRA-herA;
hericium erinaceus is a large fungus capable of producing compounds with a sequoyitol skeleton. Amplifying by taking genomic DNA of the bacterium as a template, taking P1F as a forward primer and P1R as a reverse primer to obtain a fragment I of the gene herA encoding the tongue with the acid synthase, and then taking P2F as the forward primer and P2R as the reverse primer to obtain a fragment I of the gene herA encoding the tongue with the acid synthase as the template and amplifying to obtain a fragment II of the gene herA encoding the tongue with the acid synthase; the fragment of pRA plasmid which is subjected to KpnI enzyme tangential treatment is taken as a vector, the fragment I and the fragment II of the gene herA encoded by the orcinol synthase and the pRA plasmid fragment which is subjected to KpnI enzyme tangential linearization treatment are mixed according to the molar ratio of 1:1:2, the fragment I and the fragment II of the gene herA encoded by the orcinol are inserted into the pRA plasmid by using a non-ligase dependent multi-fragment one-step cloning kit, and the ratio of the mass of the pRA plasmid to the volume of KpnI is 1 mug: 1 μl; after the connection is completed, the connection system is transformed into escherichia coli DH5 alpha, positive clones are obtained after overnight culture, and finally, the expression plasmid pRA-herA is obtained after PCR verification and enzyme digestion verification.
Hericium erinaceus (Hericium erinaceus) belongs to Hericium genus, and is preserved in China center for type culture Collection, with preservation address of university of Wuhan, china, and preservation date of 2018, 11 months and 20 days, and preservation number of CCTCC AF2018025.
The primer P1F has a sequence of ccgGAATTCGAGCTCGGTACCATGTCCTCCATCGCGGATACG and the primer P1R has a sequence of TTTATCGCGATCATGCCGGTCGTCTCCACGGCG; the primer P2F has a sequence of ACCGGCATGATCGCGATAAACCAGGGCTC and the primer P2R has a sequence of tactacaGATCCCCGGGTACCTCAAGCAGCAAGGCTCTCGAGG;
step S2: obtaining a high-yield orcein strain;
uniformly smearing spores of Aspergillus oryzae on PDA (potato dextrose agar) culture medium, and culturing at 30deg.C for one week to obtain a large number of Aspergillus oryzae spores; inoculating spore preservation solution of Aspergillus oryzae (Aspergillus oryzae) into 100mL DPY culture medium, and shake culturing at 30deg.C and 200rpm for 2 days to obtain Aspergillus oryzae mycelium with good growth state; filtering and collecting thallus by using a sterilized funnel with a filter hole diameter of 5mm in a sterile environment, filtering and collecting Aspergillus oryzae mycelia, washing with sterile water for 5 times to remove residual culture medium on the thallus surface, obtaining clean thallus, and repeatedly squeezing in the funnel to remove water. Then transferring the thalli into a 50mL sterilizing centrifuge tube, adding 20mL cell wall dissolving liquid, and gently oscillating for 3 hours at the temperature of 28 ℃, wherein the enzymolysis degree of the protoplast can be observed by a microscope in the enzymolysis process.
The enzymatic solution was filtered into 50mL of sterile centrifuge tubes using a sterilized Miracloth filter cloth (Merck Germany), then centrifuged at 800rpm for 10 minutes at 4℃and the supernatant was gently drained in a super clean bench, the bottom precipitated as Aspergillus oryzae protoplasts, the protoplasts were washed 2 times with sterilized 0.8M NaCl solution, a suitable amount of buffer II and buffer III mixed solution was prepared in a 4:1 ratio, and the protoplast concentration was adjusted to 2X 10 with the aid of a microscope mixed solution 8 Placing 200mL of protoplast solution with a concentration of well regulated into a new 50mL centrifuge tube, adding 10 mug of expression plasmid pRA-herA, lightly blowing with a pipetting gun to ensure that the mixed system is fully mixed, then carrying out ice bath for 20min, adding 1mL of buffer III into the mixed system, incubating for 20min at room temperature, then adding 10mL of buffer II, after mixing, centrifuging for 10min at the speed of 800rpm at 4 ℃, removing the supernatant, adding 1mL of buffer II, lightly blowing with the pipetting gun, mixing, transferring 200mL of mixed solution to a modified Czochralski culture medium plate, then adding 5mL of a covering culture medium with the temperature of 50 ℃, adding the covering culture medium, lightly shaking to ensure that the covering culture medium is uniformly mixed with 200mL of mixed solution, uniformly covering the surface of the modified Czochralski culture medium plate, sealing the plate after the covering culture medium is solidified, and carrying out inversion culture for 7 days.
After the Aspergillus oryzae transformants containing pRA-herea had grown to hyphae on the surface of the modified Chlamydia medium plates, they were grown to colonies. And (3) selecting a proper amount of mycelium into 50 mu L of TE buffer (1M Tris,0.5M EDTA,PH8.0), shaking and uniformly mixing, taking 1 mu L of mycelium as a template, carrying out PCR verification by taking P1F and P1R as templates, and carrying out 2 times of subculture on positive transformants in the same modified Chlamydomonas reinhardtii medium plate to obtain a high-yield strain (A.oryzae/pRA-hereA) carrying the orcloth acid synthase genes.
The DPY culture medium is prepared according to the following steps: 2g of Dextrin (Dextrin), 1g of Polypeptone (Polypeptone), 0.5g of Yeast powder (Yeast Extract), 10mg of Adenine (Adenine), 925mg of ammonium sulfate, 150mg of Methionine (Methionine) and 60mg of Arginine (Arginine) were quantified by adding water to 100mL.
The cell wall dissolving solution is prepared by dissolving 1.0% of carbohydrase (Takara Shuzo) in the solution I; the solution I consists of a 0.8M sodium chloride solution and a 10mM sodium dihydrogen phosphate solution.
Buffer II was composed of 1.2M Sorbitol (Sorbitol), 50mM calcium chloride solution, 50mM sodium chloride solution and 10mM tromethamine (Tris) per 200mL, and the pH was adjusted to 7.5.
Each 200mL of buffer III consists of 40% polyethylene glycol-4000 (PEG-4000), 50mM calcium chloride solution and 50mM tromethamine (Tris) by mass percent.
The improved Chlamydia medium is prepared by the following steps: each 200mL of modified Czapek medium contained 7.0g of Czapek-Dox, 9.3g of NaCl, 1.8g (NH) 4 ) 2 SO 4 20mg Adenine (Adenine), 300mg Methionine (Methionine) and 3g Agar powder (Agar).
The cover medium consisted of 1.2M Sorbitol (Sorbitol) and 0.5% Agar powder (Agar).
Step S3: preparing the orcein;
inoculating mycelium of high-yield strain (A.oryzae/pRA-herA) carrying a Brown acid synthetase gene into sterilized culture medium filled with rice (each 500mL triangular flask contains 50 g rice and 30mL water, and rice is sterilized after soaking for three hours), and standing at 28deg.C for two weeks; when mycelium covers the surface of the culture medium and a large number of spores are produced, the mycotic acid synthesized by the mycelium is secreted in the culture medium. HPLC analysis of ethyl acetate crude extract of host strain Aspergillus oryzae and high-yield strain of orcinolic acid (A.s oryzae/pRA-herA) metabolite is shown in figure 1, figure 1 shows the HPLC analysis chart of orcinolic acid, a represents AO-herA, and b represents AO-WT; the transformants were assayed for metabolites by HPLC. The results show that the A.oryzae/pRA-hereA transformant produced a new compound compared to the wild type A.oryzae strain.
FIG. 2 is a UV spectrum of a tongue acid, a is 207nm, b is 262nm, and c is 300nm; the spectrum characteristics of the orc are shown in fig. 2, and to further verify the structure of the novel compound, we analyzed the ultraviolet absorption spectrum thereof. The results show that: the novel compounds have absorption wavelengths of 207nm, 262nm and 300nm, consistent with the reported UV of the orotic acid.
FIG. 3 is a chart of LC-MS detection of orcein; the mass spectrum characteristics of the orcein are shown in figure 3, which we performed LC-MS detection in order to further verify the structure of this new compound. The results showed that [ M+H ]] + 169.0498, consistent with the reported LC-MS of orcinolic acid.
FIG. 4 shows the acid of the tongue coating color 1 H nuclear magnetic resonance spectrum; to further verify the structure of this new compound, we performed mass spectrometry detection, as shown in figure 4. Nuclear Magnetic Resonance (NMR) detection results: 1 H NMR(400MHz,CD 3 OD) delta ppm 2.51 (3H, s, 6-Me), 6.17 (1H, s, H-3), 6.22 (1H, s, H-5), and the reported acid of the tongue fur 1 H NMR was consistent.
FIG. 5 shows the acid of the tongue coating color 13 C nuclear magnetic resonance spectrum; to further verify the structure of this new compound, we performed mass spectrometry detection, as shown in figure 5. Nuclear Magnetic Resonance (NMR) detection results: 13 C NMR(400MHz,CD 3 OD) delta ppm 25.1 (6-Me), 102.5 (C-3), 106.5 (C-1), 113.1 (C-5), 146.1 (C-6), 164.5 (C-2), 167.7 (C-4), 175.9 (C-7). Nuclear magnetic resonance results and reported 13 The C NMR results were consistent.
Extracting the cultured thallus for 3 times by using equal amount of ethyl acetate, merging the extracting solutions, and concentrating at low pressure to obtain a fermentation liquid extract. Coarse segmentation is carried out on the fermentation broth extract by utilizing normal phase chromatography of silica gel filler, TLC is utilized to preliminarily judge segments of the distribution of the tongue fur color acid, segments containing the tongue fur color acid are combined, then reversed phase chromatography of C18 filler is utilized to carry out subdivision, TLC is utilized to judge the position of the tongue fur color acid, and finally, agilent HPLC1260 Infinicity II liquid chromatograph is utilized to carry out preparation under 264nm wavelength detection, thus obtaining pure product (purity is more than 98%). The structure was confirmed by means of a 400M nuclear magnetic resonance apparatus, and the structural data (the solvent was deuterium-bearing methanol) were as follows:
the normal phase chromatographic packing used in the separation preparation process is 200-300 meshes of silica gel, the reverse phase chromatographic packing is C18 chromatographic packing, the high performance liquid chromatograph used in the preparation is Agilent 1260 Infinicity II, the chromatographic column is Agilent ZORBAX RX-C18, 9.4X1250 mm, and the detection wavelength is 254nm.
The nucleotide sequence of the expression plasmid pRA-herA is as follows:
ATGTCCTCCATCGCGGATACGCAGCATTTCAATGTCCCGGTCTTCGCAGGCCACGGTACAACGGCCATCAACACACCCCAGACCCGTGAGCGCGCCCTTCGCGATGCTTCCTCGCCATCAGGCTCTATTCTACTCTCCTCTTGCTTCGATAGTTTCCAAGAAGAGCTCGCTACATTCACTGATGAGGAGCGCAAGGCTGCAGGCGTCGAAGCTGGGGACTTCGATAAGCCTGAGTCTCTCCTCTCTCTATCTCAGGAGCGCTACCTCTCCAATCCAGTCATCTCTGGGATCACGCTCTTCCTCATCCAAACGCTGAGGTACCTCTCCTTCGTCGAGTCCTACTCTTCGCCGTCGTCTCCGCGCTTCGCGGCCATCCTCTCCCAGAACCTCGCACACCAGCTTGGTGTTCTTGGATTTTCTTCTGGTATTCTCCCAGCATCAGTCGTCGGCACCTCAGTTTCGGCATTGGAGTTCATCTCAAACGCTGTCGAGGCATTCCGCCTCGCGTTCTGGATCGGAGTTCGCGCCCAACTTTATCGCGTCGCAGCCTTTGAATCCGCAAATAGTCTCGGAGATGATGCGGCGCTCCCATGGAGCGTTGTGTTCCTGGGGATTGGGCGGCAAGAGGCAGATGAGGCAGTGCGCAAGTACCGTGAATCGAATGAAAATGCAGAGTCTCTGCACGTGACCGCTGTGATGGATGAGACTTGCGTCACCATATCTGGACGTCCTGACGTTCTCGCTGCCTTCGCGTCCCGACTTCCGACTTCTGCGCCTCCGCACAAGACGACCGTAGATACCCTTTATCACTCCCCGATTCACACAGGCACGACACGCGATCTGGTCCTGGAAGATGTGTCCCGCCGTGGGATTCAGTTCCCTTCGTTCTCGGACATCAAGATCCCCGTCCGCTCCATGCACACTGGCGAGCTGCTCGATTCATCTCGCGAGGGATCGTTCGTAGAGGCGGTCGTCGATATGGTCCTCACGCAGCCAGTGAACTGGGATCGCGTCGTCAGCTCGCTTGTGTCAGCCGCGCCAGAGGGCGAAGCCGTGCGCTTGATCAACGTCGGACCTGGTGCTGGGCTTACTCGCAGCATGGAGCGGGCATTCCCCACGCGCAATGCATTGTCTGTAGATCTGACTGCCCCGGAGAAGAATTCCGCCGCGAACAAGATGTCTCCCGTTCAGGAGCCGATTGCTATTGTCGGCATGGCGGTTAACATGCCCGGAGCACCGAGCGTCGAGAAGCTGTGGGAGGTGCTCGAGAAGGGCATCAACACTATTGCGGAGATCCCTGAGCACCGGTTCAAGGTCTCAGACTACAACAACCCCGCCGATGCCAAGAGTGCCCGGTCGATGAAGGCACATACGGGCAACTTCCTCGACGATCCTGATGCATTTGACAACAAGTTCTTCAAGATCTCGCCGCGTGAGGCACGCAGCATGGATCCTCAAGGCCGCGTGCTGCTTCACACCGCGTACGAGGCGCTGGAGGATTCAGGTTATGTACCCAACGCCACGCCGACATTCCAGCCGGACTCGTTCGGGTGCTACATCGGTTGCGCCACGGGCGATTACGTTGAGAATCTCCGAAACGATATTGACGTATATTACAGCACTGGCACTCTGCGCGCCTTCCTCAGTGGTCGGATTTCATACGCTATGAAACTCAGCGGTCCATCTGTGGTCATTGATACTGCGTGCTCGTCTTCGATCATCGCCGTGTACCAGGCGTGTCGTGCACTCATGAACGGGGACTGCACTGCGGCCATGGCAGGTGGTGTCAACGTGATCGCTGCTCCCGACATGTTCATGGGTCTAGATCGTGGTCATTTCCTCAGCCCTACGGGCCAGTGCAAGGCGTTCGATGACTCTGCCGATGGATACTCGCGTAGCGAAGGCTGTGGAATTTTCGTCCTGAAGCGGCTGTCAGATGCCATCGCTGAGGACGACAACATCCTCGGCGTCATCCGCGGTGTTGAGGTTAACCAAAGCGGCCTCGCGAGCTCCATCACTCATCCGCATTCGCCGACGCAACAGATCCTTTTCAAGAAGGCGCTCGAGAAGTCTGGCATTGATGCGCGTCGCATCAACGTTGTCGAAGCTCACGGCACTGGCACGCAGGCTGGCGATCCCAACGAGCTCGATAGTATCCGCGGCGTCTTTGCTGTCGGCCGTACACCCGCGAACCCGCTTCACATCACGTCCGTGAAGGCCAACATCGGGCATCTCGAGGCTGCGTCGGGCTCCGCTGGCCTGGCAAAGCTTCTGCTCATGCTTAAGCACCGCACGATTCCCGCCCAGATCTCGTTGAAGAATCTGAACCCGAAGATCGTGGCTCTCGAGAAGGATCACACGGTCATCGACAGGGAGCACGCGCCTTGGAACCCGTCGGAAGAGGGACTGACGAGAATTGCCATGCTCAACAACTTCGGCGCCGCTGGTTCCAATGGGGCTCTGTTGTTGGAGGAATATGTCCCGGCGGGCTCGAAGGCACCTGAGGTCGAGTCTGCTGCGGCCTTCATCGTTGGTCTGTCAGCGAAGACGGACGAGGCACTCAATGCCCTGCGCATGCGTTACATCGAGTGGCTCGGCGATGCCAGGAATGCATCCATCTCCCTCGCCGATTTCGCATACACTGCTACAGCTCGCAGGCAGCTGTACGGCCAGCGTCTCGCTGTCTCTGCAGGCACCAAGGAGGAGCTTGTCGAGAAGTTGAGAGCCGCGTCGCAGGTCGCTGTGACTGAGCGGCCAGCGAAAGTTGCTTTCGTCTTCTCTGGCCAGGGCAGCCAGTACCTCGGGATGGGATCTGCCCTCTACAAGACCGTGCCTCTCTTCAAGCGTACCGTCGACGAGTGCCACGCTATCTTAACTGCGTCCGGCTTCCCGGGCGTTCTCGCCATCATCAATCCTGCTGGTGAGACCAGTGGTCTTACTCAGCTGGAGGAGTTCGAAGCATATCAGGCGGCGATCTTCTCCCTTGAGTACGCGCTCGCCAAGTTGTGGATGTCATGGGGACTGGTTCCCGAGGTGGTCGTAGGCCACAGTCTGGGCGAGTACGCAGCGCAGGTCATCGCTGGCGTCTTGACGCTCAAGGGCGCGCTCACTCTCATTGCCAACCGCGTCCGCTTCATGGTCAGCAAGTGCGCCGTGGAGACGACCGGCATGATCGCGATAAACCAGGGCTCCGAGGCGGTTGCGAAAATGCTGGCAGCTTCGATGGACTTCCCCGACACTTCTGTTGCATGCTTTAACAGCAACACTGACTGCGTCGTTTCGGGCCCTATTCCTCAGCTCAAGGCACTGAAGGCACACCTCGACAGTGAAGTACGCTGCAAGAACGTCCTCTTGACGGTGCCGTTCGGGTACCATAGCTCCGCCATGCACCCCCTTCTCGACGACCTTTCCACTATTGCTAAGCATGTTACCATCCGCGCGCCCACTATTCCGATTATCTCCAATGTCACCGGTGAGGTCGTTATGCCCGGCGATGAGGGCGTTTTCGACTCGGAGTACTACTCTCGCCACTGCGCGCAGCCAGTACTCTTCGAGAAGGGCCTCACTTCACTCGCGGCTATTCCGGAGCTTGCGAACATCGACGCATGGATCGAGATTGGTCCCCACAGCATCACGCTTCCCATGTTCAAGGTTCACCCGTCGATCTCGAAGAGCACCATGCTCTTGGGCTCCCTGAAGAAGAACCACGACCCGTGGGCAATCGTCTCTTCGACTTTGGCTCAGCTGTACACGTCCCCGATTCAACTCAGGTGGCGTGAGGTCTTTGGCCATGTCTCTTCTCCTTCGACGCTTTCCCTTCCGTCGTACCCCTTCACGAAGTCCAAGTTCTGGGTCTCGTTCAAGGAGGAGGCACCTGGCGCGGTTGTATCGGCGTCCACCTCCGTCCCGCTCGCGAAGCACGTCGATTTAGTCAATAACTTCTCGATGCTATACTCCTGGGCCCAGTTCCCGTCGGCGGCGAACCAGCGCGTCGCAATTTTCGAGACGCCCATCTCGCAGCTCGGGAAGTCCATCATGGGCCATAGCGTTGGAGACCACCCGCTCTGCCCCGCGTCCGTGTACCACGAGCTCGCACTTGCAGGTATCGAGATGGCTAGGTCCCATCTGCACCTTAAGATTGACGACTGCTTCGTCATGCTTCGCGACATCGACTACGCGAAGCCGCTGGTCTACAACGAGCACGTTGCCCGGATGGTCAGGACATCGATCACACTTGACGTTGATGGCTCGGGCTCTTTCAGCGTTGGCTCGCAGGTAGATGGCTCGCCCGAGGAGGTCCATTGCTTCGGGAAGTTCAAGCACCAGTCGACATCGAAGGCCTCAACCAAATTCGCTCGCGTTCTTCCCATCGTAACTCGTCAAATCAGCTCCGTCTCGTCGCCTAACGATGGTTTCGCGGAGACGTTCTCTACTCGCACGGCATACGAGGTCATCTTCCCGCGCGTGGTCGACTACGCAAAGGAGTACCACACGATGAAGACGCTCACCGTCGCCTCGAACGGTATGGAAGCATACGCGATCGTCCAGCTGCCTCGCGATCACGACCGCAGCAAGTTTATCGTCCACCCTGTCTTCATGGACACCATGCTTCACGTTGCCGGCTTCGTCGCGAACATGCAGGGCGGAGTCAACGATGCCTACATCTGCAGCAAGGTCGACACAGTGAAGGCGATCCCGGCTTTGATCGACAACGACGCGGAGTACGGCGTGCTGATCAGCAACGCCTGGGTCGCGGATGAGGGCGTCATGCTTGCGGAGGCCTACGCCGTCCAGTTGAAGTCTCCAGGTAAGATCGTCGCGCACCTCAAGGGCATGCACTTCCGCAAGGTGCGCCTCAATAGCCTGAAGCGTGGTCTCGCGATGGCCGCGGGCACTAGCCCGGCGCATGCTGCGCCGAAGCGGGCGGAGGCGCCTGTGAAGAAGGCTGCGCCTGCTTCCCCGATGTCCTCCAAGGTCGTTTCCTCAATCACCTTCGTCGAGCCGCCTCGAGATACAGCACCTACTATCGACGTCCTCGCGGAGGTCACGCGCATCGTGGCCGAGACTTGCGACATCACTGCATCCACGATCCAGCCCGACGGAGACCTCGAGGCGTACGGCGTGGATTCGCTGATGTCCATTGAGATCTTCACCAAGATGCAGAGCGCCTTCCCTAGTGCTGACCTTGACGCGAACGTCCTTTCCTCGTGCCGCAATGTTGCCCAGATCGTCGCTGAGGTGTCGTCCAAGTTCTCCCAGGAGGACTCTGGCCCATCCACGCCGCGCACACTCGTCACTGACGAGAAGCTTGGCGAGCCCAGCGTCATCGCGAACTTCGACGAGGTCGAGTCAAGCCGCTGCTGGCGTCCGTCCTCGGCATCGGCCTCCAGGAGATCACCGACGACGCGGACTTCGAATCGCTCGGCTTAGACTCGCTGACATCCATCGAGGCGCATTCGGCCCTGCAGAGCGAGTACTCGCTGACGCTGCCGACCACCCTGTTCGAGACATACACAACGGCGAAGGCCGTCAACGCCTTCCTCACATCGCAGCTGCGTCCTCGGGGCAAGGCCGTCGAGGCCGTTAAGGAGACCGAGTGCACCCTTCGGACTACAAGGACTCGGACATCGCGACCGCCGCGAAAGTCGCGCAGATCGTCGACGGCAACCTCAACCCGCTCGTCACCGCGCTGCGCCTCGACTCGGTTCCCGTCGGTGCGCAGAAGGCGAAGACACCCGGCCGCGCGCCCTTATTCCTGATTCACGATGGTAGCGGCCTTGTGAACTACATCCAGCGCCTCTCCCCGCTTGACCGCGACATCTGGGGCATTCATAATCCCCACTTCATCACCAGCCAGCCGTGGGAGAGTGTTGTGTCGATGGCTGCGGAGTACTCTGAGTTCGCGACGAAGACGACCTCTGAGCCTCTTATCCTTGGCTGGTCGTTCGGTGGTGTCGTTGCCTTCGAAGCTGCGTGTCAGCTCATGAAGAAGGGCGTTGCGGTGAAGGGCGTCCTCCTCATCGACTCCCCTACTCCTCTCGCCCACGTTCCGCTCTCCGACGCCCTCCTCGAGTCCGTCGCGAAGCTGGATGGCCGCGCCGACACGCAGGTCGGCAAGCTCGTGAAGACGCAGTTCCAGATGAACTCGCGCATGCTCGGCCGCTATGACCCGCTTGCCGCGGGCGGGCCATTTCCCTCGATCGTCCTCCTCCGCTCGAGAGAGGGCTTCAAACCCGCCGGCGTCGCCGACGTGCCGACGTGGCTTGCGGACAGGAGCGATGCGCAGCTGGCCATATCCGGGTGGGAGCGCGTCGTGGGCACGCCGATCAAGGTCATCGACATCCCCGGCAACCATTTCCAGCCTTTCCACACCTCTAATATCGAGGAAGTTTCTCGTCGCATTGCTGAGGGGTGCGCACACCTCGAGAGCCTTGCTGCTTGA。
Claims (9)
1. a method for preparing orcein by using aspergillus oryzae is characterized in that the preparation method comprises the following steps:
step S1: expression plasmid pRA-herAIs constructed according to the following steps;
amplifying to obtain the coding gene of the orcinol acid synthase by taking the genomic DNA of the hericium erinaceus as a template, taking P1F as a forward primer and taking P1R as a reverse primerherAThen P2F is used as a forward primer, P2R is used as a reverse primer, and the coding gene of the orce synthase is usedherAThe fragment I of (2) is used as a template to amplify and obtain the coding gene of the orce synthaseherAFragment two of (2); the fragment of pRA plasmid which is undergone the process of KpnI enzyme tangential treatment is used as carrier, and the coding gene of orce synthase is usedherAFragment one and fragment two of (A) are inserted into pRA plasmid to obtain expression plasmid pRA-herA；
Hericium erinaceus (Bull. Ex Fr.) persHericium erinaceus) The preservation number of the composition is CCTCC AF 2018025;
primer P1F has the sequence ccgGAATTCGAGCTCGGTACCATGTCCTCCATCGCGGATACG,
the sequence of the primer P1R is TTTATCGCGATCATGCCGGTCGTCTCCACGGCG; the primer P2F has a sequence of ACCGGCATGATCGCGATAAACCAGGGCTC and the primer P2R has a sequence of tactacaGATCCCCGGGTACCTCAAGCAGCAAGGCTCTCGAGG;
step S2: obtaining a high-yield orcein strain;
inoculating spore preservation solution of aspergillus oryzae into a DPY culture medium, and carrying out shake culture for 2-3 days to obtain aspergillus oryzae mycelia; then adding cell wall dissolving liquid, and oscillating for 2-3 hours to obtain protoplasts; adding buffer II and buffer III into protoplast, and adding expression plasmid pRA-herAAdding buffer solution III into a mixed system, incubating for 10-20 min at room temperature, adding buffer solution II, centrifuging for 10-20 min after uniform mixing, adding buffer solution II after supernatant removal, transferring to an improved Chlamydia cell culture medium plate after uniform mixing, adding a cover culture medium, and culturing for 3-7 days in an inverted manner; to contain pRA-herAAfter mycelium grows out of the transformant, verifying the transformant by using a PCR method, and carrying out 2 times of subculture on the obtained positive transformant to obtain a high-yield strain carrying the orcein synthase gene;
buffer II consisted of 1.2M sorbitol, 50mM calcium chloride solution, 50mM sodium chloride solution and 10mM tromethamine per 200mL and pH was adjusted to 7.5; each 200 of mL buffer solution III consists of 40 percent of polyethylene glycol-4000, 50 percent of mM calcium chloride solution and 50 percent of mM tromethamine in percentage by mass; the improved Chlamydia medium is prepared by the following steps: each 200. 200mL modified Chlamydia medium contained 7.0. 7.0g Chlamydia medium, 9.3g NaCl, 1.8. 1.8g (NH) 4 ) 2 SO 4 20, mg adenine, 300mg AThioamino acid and 3g agar powder;
step S3: preparing the orcein;
inoculating mycelium of the high-yield orcein strain into a sterilized rice culture medium, and extracting and concentrating the cultured thalli to obtain a fermentation broth extract; separating the fermented liquid extract with silica gel, and preparing with high performance liquid chromatograph to obtain the orcein.
2. The method for preparing orcinol using Aspergillus oryzae according to claim 1, wherein the gene encoding orcinol synthase is used in the step S1herAFragments one and two and pRA plasmid fragments subjected to KpnI cleavage linearization were prepared according to (1-2): (1-2): 2, connecting by using a multi-fragment connection kit, transferring a connection system to escherichia coli DH5 alpha after connection, culturing overnight to obtain a positive clone, and finally obtaining an expression plasmid pRA (plasmid vector assembly) after PCR (polymerase chain reaction) verification and enzyme digestion verificationherA。
3. The method for preparing lachrymal acid by Aspergillus oryzae according to claim 1, wherein in the step S1, the fragment of pRA plasmid which is tangentially processed by KpnI enzyme is used as a vector, and the lachrymal acid encoding gene is cloned by a multi-fragment one-step cloning kit independent of ligaseherAFragment one and fragment two of (A) are inserted into pRA plasmid to obtain expression plasmid pRA- herAThe method comprises the steps of carrying out a first treatment on the surface of the The ratio of the mass of pRA plasmid to the volume of KpnI enzyme was 1. Mu.g: (1-2) mu L.
4. A process for preparing orcinol from Aspergillus oryzae according to claim 1, wherein the step S2 is based on the expression plasmid pRA-herAThe culturing steps of the high-yield strain of the orcinol acid are as follows: inoculating spore preservation solution of aspergillus oryzae into 100-200 mL of DPY culture medium, and carrying out shaking culture at the temperature of 28-30 ℃ and the rotating speed of 180-200 rpm for 2-3 days to obtain aspergillus oryzae mycelia; filtering and collecting Aspergillus oryzae mycelia, washing the Aspergillus oryzae mycelia with sterile water for 3-5 times, adding 10-20 mL of cell wall dissolving solution, and oscillating at 28-30 ℃ for 2-3 hours to obtain protoplasts; by sterilizationWashing protoplast for 2-3 times with 0.8M NaCl solution, adding buffer II and buffer III, and adding 2-10 μg of expression plasmid pRA-herAAdding 1mL buffer solution III into a mixed system, incubating at room temperature for 10-20 min, adding 10mL buffer solution II, centrifuging at a rotation speed of 800-1000 rpm for 5-10 min at 0-4 ℃ after mixing, adding 1mL buffer solution II after removing supernatant, transferring 100-200 mu L of mixed solution to an improved Chlamydia culture medium plate after mixing, adding 5mL of a covering culture medium at 40-50 ℃, sealing the plate after the covering culture medium is solidified, and culturing for 3-7 days in an inverted mode; to contain pRA-herAAfter mycelium grows out from the transformant, the transformant is verified by a PCR method, and after 2 times of subculture is carried out on the obtained positive transformant, the high-yield strain carrying the orcein synthase gene is obtained.
5. The method for preparing orcinol using aspergillus oryzae according to claim 1 or 4, wherein the DPY medium in the step S2 is prepared by the following steps: 2g dextrin, 1g polypeptone, 0.5g yeast powder, 10mg adenine, 925mg ammonium sulfate, 150mg methionine and 60mg arginine, and water was added to quantify to 100mL.
6. The method for preparing orcinol using koji mold according to claim 4, wherein the cell wall lysate of step S2 is prepared by dissolving 1.0% of the carbohydrase in the solution I.
7. A method for preparing orcinol using Aspergillus oryzae according to claim 6, wherein each 200. 200mL solution I consists of 0.8. 0.8M sodium chloride solution and 10. 10mM sodium dihydrogen phosphate solution.
8. A process for preparing orcinol using Aspergillus oryzae according to claim 1 or 4, wherein the cover medium in step S2 consists of 1.2. 1.2M sorbitol and 0.5% agar powder.
9. The method for preparing the orcein by using the aspergillus oryzae according to claim 1, wherein in the step S3, hyphae of the high-yield orcein strain are inoculated into a sterilized culture medium filled with rice, and the culture medium is subjected to stationary culture for two weeks at 28-30 ℃; extracting the cultured thalli for 3-5 times by using ethyl acetate, and concentrating to obtain a fermentation liquid extract; then the reversed phase chromatography is used for subdivision, and then the moss acid is obtained through silica gel separation and high performance liquid chromatography.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202211110735.0A CN115976093B (en) | 2022-09-13 | 2022-09-13 | Method for preparing orcein by using aspergillus oryzae |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202211110735.0A CN115976093B (en) | 2022-09-13 | 2022-09-13 | Method for preparing orcein by using aspergillus oryzae |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN115976093A CN115976093A (en) | 2023-04-18 |
| CN115976093B true CN115976093B (en) | 2023-06-27 |
Family
ID=85966916
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202211110735.0A Active CN115976093B (en) | 2022-09-13 | 2022-09-13 | Method for preparing orcein by using aspergillus oryzae |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN115976093B (en) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2020232553A1 (en) * | 2019-05-22 | 2020-11-26 | Hyasynth Biologicals Inc. | Methods and cells for production of phytocannabinoids and phytocannabinoid precursors |
| CN113699130A (en) * | 2021-08-26 | 2021-11-26 | 中南民族大学 | Polyketide synthase PreuA-TEPreu3Construction of (A) and its application in preparation of nervonic acid |
| CN113832123A (en) * | 2021-09-07 | 2021-12-24 | 中南民族大学 | Polyketide synthase Preu 3-delta CMeT and application thereof in preparation of orchidic acid |
-
2022
- 2022-09-13 CN CN202211110735.0A patent/CN115976093B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2020232553A1 (en) * | 2019-05-22 | 2020-11-26 | Hyasynth Biologicals Inc. | Methods and cells for production of phytocannabinoids and phytocannabinoid precursors |
| CN113699130A (en) * | 2021-08-26 | 2021-11-26 | 中南民族大学 | Polyketide synthase PreuA-TEPreu3Construction of (A) and its application in preparation of nervonic acid |
| CN113832123A (en) * | 2021-09-07 | 2021-12-24 | 中南民族大学 | Polyketide synthase Preu 3-delta CMeT and application thereof in preparation of orchidic acid |
Non-Patent Citations (2)
| Title |
|---|
| High-efficient production of mushroom polyketide compounds in a platform host Aspergillus oryzae;HAN,H. et al;Microbial Cell Factories;第22卷(第60期);正文1-10页 * |
| 苔色酸酯的合成及抗真菌作用的研究;洪阁;李松年;刘培勋;;中国新药杂志(14);1099-1101 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN115976093A (en) | 2023-04-18 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106148256B (en) | The genetic engineering bacterium and its construction method of production alpha-arbutin and application | |
| CN112831421B (en) | Cephalosporin compound production strain and application thereof | |
| CN113717910B (en) | Tri-enzyme co-expression recombinant bacterium and application thereof in (S) -citronellol synthesis | |
| CN104726347B (en) | One plant of fox excrement mould fungal bacterial strain and the method for preparing left-handed 7 hydroxyl butylphenyl phthaleine using the bacterial strain | |
| Hamdi et al. | A new process for red pigment production by submerged culture of Monascus purpureus | |
| CN116987603A (en) | Recombinant saccharomyces cerevisiae strain for high yield of cannabigerolic acid as well as construction method and application thereof | |
| NL2028177B1 (en) | Process for producing acetoin by utilizing wheat b-starch | |
| CN115976093B (en) | Method for preparing orcein by using aspergillus oryzae | |
| CN113337432B (en) | Methylophilus for producing pyrroloquinoline quinone and application thereof | |
| CN110358687B (en) | Gibberellin for producing D-pantolactone hydrolase and application and fermentation method thereof | |
| CN114672510B (en) | Method for preparing L-tryptophan-L-alanine cyclic dipeptide by utilizing aspergillus oryzae | |
| CN118109530A (en) | Method for preparing original-illidine type sesquiterpene skeleton by using aspergillus oryzae | |
| CN116262903A (en) | Aspergillus oryzae engineering bacteria, construction method and application | |
| CN105821098A (en) | Self-flocculating fermentation production of alpha-arbutin | |
| CN117660577B (en) | Application of LtaSA protein or coding gene thereof in riboflavin production | |
| CN105331550B (en) | A method of it producing the recombination eukaryon bacterial strain of sweet wormwood diene and prepares sweet wormwood diene using the recombination eukaryon bacterial strain | |
| CN117737149B (en) | Method for synthesizing high-purity S-vitronectin by enzyme catalysis | |
| CN1954081A (en) | Biotransformation of colchicinoid compounds | |
| CN113337433B (en) | Pseudomonas capable of producing pyrroloquinoline quinone and application thereof | |
| CN107354182A (en) | A kind of method that grey green soy bean endogenetic fungus fermentation prepares the oxazolidinone compounds of (R) 4 benzyl 2 | |
| Paranthaman et al. | Production on tannin acyl hydrolase from pulse milling by-products using solid state fermentation | |
| CN108456689A (en) | The method for improving ansamitocin P-3 biosynthesis yield | |
| CN118240727A (en) | Recombinant corynebacterium glutamicum, construction method thereof and application thereof in whole cell transformation production of hydroxytyrosol | |
| CN104651242B (en) | A kind of Fungal Alpha amylase genetic engineering bacterium and its construction method | |
| CN115161373A (en) | Method for producing glycyrrhetinic glycoside by utilizing solid biomass continuous fermentation |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |