CN115976093A - Method for preparing nervonic acid by using aspergillus oryzae - Google Patents
Method for preparing nervonic acid by using aspergillus oryzae Download PDFInfo
- Publication number
- CN115976093A CN115976093A CN202211110735.0A CN202211110735A CN115976093A CN 115976093 A CN115976093 A CN 115976093A CN 202211110735 A CN202211110735 A CN 202211110735A CN 115976093 A CN115976093 A CN 115976093A
- Authority
- CN
- China
- Prior art keywords
- hera
- pra
- fragment
- acid
- aspergillus oryzae
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
A method for preparing nerchinic acid by aspergillus oryzae, which relates to the technical field of microbial chemistry. The invention aims to solve the problems that the commercial nervonic acid has high selling price, and the traditional nervonic acid preparation method has low purity, low yield and complex synthesis process. The method comprises the following steps: inserting a fragment I and a fragment II of a lichen acid synthase encoding gene herA into a pRA plasmid by taking the fragment of the pRA plasmid subjected to KpnI enzyme digestion linearization as a vector to obtain an expression plasmid pRA-herA; then obtaining high-yield bryozoan strains; inoculating the mycelium of the high-yield bryozoan strain into a sterilized rice culture medium, and extracting and concentrating the cultured thallus to obtain a fermentation liquid extract; separating the fermentation liquid extract with silica gel, and preparing with high performance liquid chromatograph to obtain nervonic acid. The invention can obtain a method for preparing nervonic acid by using aspergillus oryzae.
Description
Technical Field
The invention relates to the technical field of microbial chemistry, in particular to a method for preparing nervonic acid by utilizing aspergillus oryzae.
Background
The nervonic acid (2,4-dihydroxy-6-methylbenzoic acid) is a dihydroxybenzoic acid derivative, and a compound taking the same as a structural framework has biological activities of anti-inflammation, antibiosis, anti-tumor, antioxidation, diabetes resistance and the like, and has potential application value in the aspect of clinical drug development.
Presently, bryozoans have been isolated and identified from herbs, lichens, bacteria and fungi. However, the current commercialized nervonic acid is only produced by a chemical synthesis mode, the selling price is about 1000 yuan/100 mg, and the preparation method has the problems of low yield, instability, complex synthesis process and the like, thereby seriously restricting the application of the nervonic acid in the field of medicine. Therefore, a new preparation method is needed to overcome the defects of the existing preparation technology of the nervonic acid.
Disclosure of Invention
The invention aims to solve the problems that the commercialized nervonic acid is high in price, and the traditional method for preparing the nervonic acid is low in purity and yield and complex in synthesis process, and provides a method for preparing the nervonic acid by utilizing aspergillus oryzae, so that aspergillus oryzae strains capable of efficiently producing the nervonic acid (the yield of the nervonic acid is about 0.34g/1 kg) can be successfully obtained.
A method for preparing nervonic acid by Aspergillus oryzae comprises the following steps:
step S1: constructing an expression plasmid pRA-herA;
amplifying to obtain a first fragment of the lichen acid synthase encoding gene herA by taking genome DNA of hericium erinaceus as a template, P1F as a forward primer and P1R as a reverse primer, and then amplifying to obtain a second fragment of the lichen acid synthase encoding gene herA by taking P2F as the forward primer and P2R as the reverse primer and taking the first fragment of the lichen acid synthase encoding gene herA as the template; inserting a fragment I and a fragment II of a lichen acid synthase encoding gene herA into a pRA plasmid by taking the fragment of the pRA plasmid subjected to KpnI enzyme digestion linearization as a vector to obtain an expression plasmid pRA-herA;
the sequence of the primer P1F is ccgGAATTCGAGCTCGGTACCATGTCCTCCATCGCGGATACG, and the sequence of the primer P1R is TTTATCGCGATCATGCCGGTCGTCTCCACGGCG; the sequence of the primer P2F is ACCGGCATGATCGCGATAAACCAGGGCTC, and the sequence of the primer P2R is tactacaGATCCCCGGGTACCTCAAGCAGCAAGGCTCTCGAGG;
step S2: obtaining high-yield bryozoan strains;
inoculating spore preservation solution of aspergillus oryzae into a DPY culture medium, and performing shake culture for 2-3 days to obtain aspergillus oryzae mycelia; then adding cell wall dissolving liquid, and carrying out mild oscillation for 2-3 hours to obtain a protoplast; adding a buffer solution II and a buffer solution III into a protoplast, adding an expression plasmid pRA-herA, uniformly mixing, carrying out ice bath for 10-20 min, adding the buffer solution III into a mixed system, incubating for 10-20 min at room temperature, then adding the buffer solution II, uniformly mixing, centrifuging for 10-20 min, removing a supernatant, adding the buffer solution II, uniformly mixing, transferring to an improved Chaudou culture medium plate, adding a covering culture medium, and carrying out inverted culture for 3-7 days; after hyphae grow out from the transformants containing pRA-herA, verifying the transformants by using a PCR method, and carrying out subculture on the obtained positive transformants for 2 times to obtain high-yield strains carrying the licheninic acid synthetase gene;
every 200mL of buffer II consisted of 1.2M sorbitol, 50mM calcium chloride solution, 50mM sodium chloride solution and 10mM tromethamine, and the pH was adjusted to 7.5; every 200mL of buffer solution III consists of 40 percent by mass of polyethylene glycol-4000, 50mM of calcium chloride solution and 50mM of tromethamine; the improved Chachi culture medium is prepared by the following steps: each 200mL of the modified Chaudou medium contained 7.0g of Chaudou medium, 9.3g of NaCl, 1.8g of (NH) 4 ) 2 SO 4 20mg of adenine, 300mg of methionine and 3g of agar powder;
and step S3: preparing bryozoan;
inoculating the mycelium of the high-yield bryozoan strain into a sterilized rice culture medium, and extracting and concentrating the cultured thallus to obtain a fermentation liquid extract; separating the fermentation liquid extract with silica gel, and preparing with high performance liquid chromatograph to obtain nervonic acid.
An expression plasmid pRA-herA obtained by a method for preparing nerchinic acid by aspergillus oryzae, the nucleotide sequence of which is shown in a sequence table SEQ ID NO. 1.
The invention has the beneficial effects that:
firstly, the invention takes aspergillus oryzae as a host, and can provide abundant raw materials of acetyl coenzyme A and malonyl coenzyme A to synthesize the nervonic acid; secondly, the expression plasmid pRA-herA used in the invention carries a pAmyB amylase promoter, and can efficiently drive the efficient expression of the enterogastic acid synthase encoding gene herA when rice is taken as a culture medium; thirdly, the high-yield strain A.oryzae/pRA-herA takes rice culture as a culture medium, and has the advantages of low cost, simple operation, short culture period and simple and feasible separation and purification.
The aspergillus oryzae heterologous expression strain is very suitable for large-scale fermentation production, breaks through the resource limitation of traditional separation, is used for fermentation by adopting the culture medium and culture conditions, and is used for separating and extracting fermentation products and identifying various wave spectrums, the aspergillus oryzae heterologous expression strain can be used for producing the nervonic acid in large quantity, the yield exceeds 340mg/1Kg rice, the source problem of the nervonic acid can be effectively solved, and sufficient raw materials can be provided for the synthesis of natural products containing nervonic acid skeleton structures and related medical intermediates.
The invention provides a method for preparing nervonic acid in a large scale by using aspergillus oryzae as a host, wherein more than 340mg of nervonic acid can be obtained by fermenting every 1kg of rice.
The invention provides a method for preparing nervonic acid by aspergillus oryzae.
Drawings
FIG. 1 is a Bryoid HPLC analysis chart, wherein a represents AO-herA, and b represents AO-WT;
FIG. 2 is a photograph of the UV spectrum of orchitic acid, wherein a represents 207nm, b represents 262nm, and c represents 300nm;
FIG. 3 is a Bryoid LC-MS detection spectrum;
FIG. 4 is nervonic acid 1 H nuclear magnetic resonance spectroscopy;
FIG. 5 is nervonic acid 13 C nuclear magnetic resonance spectrum.
Detailed Description
The first specific implementation way is as follows: the method for preparing nervonic acid by aspergillus oryzae comprises the following steps:
step S1: constructing an expression plasmid pRA-herA;
amplifying to obtain a first fragment of the lichen acid synthase encoding gene herA by taking genome DNA of hericium erinaceus as a template, P1F as a forward primer and P1R as a reverse primer, and then amplifying to obtain a second fragment of the lichen acid synthase encoding gene herA by taking P2F as the forward primer and P2R as the reverse primer and taking the first fragment of the lichen acid synthase encoding gene herA as the template; inserting a fragment I and a fragment II of a lichen acid synthase encoding gene herA into a pRA plasmid by taking the fragment of the pRA plasmid subjected to KpnI enzyme digestion linearization as a vector to obtain an expression plasmid pRA-herA;
the sequence of the primer P1F is ccgGAATTCGAGCTCGGTACCATGTCCTCCATCGCGGATACG, and the sequence of the primer P1R is TTTATCGCGATCATGCCGGTCGTCTCCACGGCG; the sequence of the primer P2F is ACCGGCATGATCGCGATAAACCAGGGCTC, and the sequence of the primer P2R is tactacaGATCCCCGGGTACCTCAAGCAGCAAGGCTCTCGAGG;
step S2: obtaining high-yield bryozoan strains;
inoculating spore preservation solution of aspergillus oryzae into a DPY culture medium, and performing shake culture for 2-3 days to obtain aspergillus oryzae mycelia; then adding cell wall dissolving solution, and carrying out mild oscillation for 2-3 hours to obtain protoplasts; adding a buffer solution II and a buffer solution III into a protoplast, adding an expression plasmid pRA-herA, uniformly mixing, carrying out ice bath for 10-20 min, adding the buffer solution III into a mixed system, incubating for 10-20 min at room temperature, then adding the buffer solution II, uniformly mixing, centrifuging for 10-20 min, removing a supernatant, adding the buffer solution II, uniformly mixing, transferring to an improved Chaudou culture medium plate, adding a covering culture medium, and carrying out inverted culture for 3-7 days; after hyphae grow out from the pRA-herA-containing transformant, verifying the hyphae by using a PCR (polymerase chain reaction) method, and carrying out subculture on the obtained positive transformant for 2 times to obtain a high-yield strain carrying a bryozoac acid synthetase gene;
every 200mL of buffer II consisted of 1.2M sorbitol, 50mM calcium chloride solution, 50mM sodium chloride solution and 10mM tromethamine, and the pH was adjusted to 7.5; every 200mL of buffer solution III is prepared from 40% polyethylene glycol-4000,50mM calcium chloride solution and 50mM tromethamine; the improved Chachi culture medium is prepared by the following steps: each 200mL of the modified Chaudou medium contained 7.0g of Chaudou medium, 9.3g of NaCl, 1.8g of (NH) 4 ) 2 SO 4 20mg of adenine, 300mg of methionine and 3g of agar powder;
and step S3: preparing bryozoan;
inoculating the mycelium of the high-yield bryozoan strain into a sterilized rice culture medium, and extracting and concentrating the cultured thallus to obtain a fermentation liquid extract; separating the fermentation liquid extract with silica gel, and preparing with high performance liquid chromatograph to obtain nervonic acid.
The second embodiment is as follows: the present embodiment differs from the present embodiment in that: in the step S1, the first fragment and the second fragment of the gene herA coded by the bryoid synthase and the pRA plasmid fragment subjected to KpnI enzyme digestion linearization are subjected to the following steps (1-2): (1-2): 2, connecting by using a multi-fragment connection kit, transforming a connection system to escherichia coli DH5 alpha after connection, obtaining a positive clone after overnight culture, and finally obtaining the expression plasmid pRA-herA after PCR verification and enzyme digestion verification.
Other steps are the same as those in the first embodiment.
The third concrete implementation mode: the first or second differences from the present embodiment are as follows: in the step S1, a fragment of pRA plasmid subjected to KpnI enzyme digestion linearization is taken as a vector, and a first fragment and a second fragment of lichen acid coding gene herA are inserted into the pRA plasmid by utilizing a ligase independent multi-fragment one-step cloning kit to obtain an expression plasmid pRA-herA; the ratio of the mass of the pRA plasmid to the volume of KpnI enzyme was 1 μ g: and (1-2) mu L.
The other steps are the same as those in the first or second embodiment.
The fourth concrete implementation mode is as follows: the difference between this embodiment and one of the first to third embodiments is as follows: the cultivation of the bryozoan high-producing strain based on the expression plasmid pRA-herA in step S2 comprises the following steps: inoculating spore preservation solution of aspergillus oryzae into 100-200 mL of DPY culture medium, and carrying out shaking culture at the temperature of 28-30 ℃ and the rotating speed of 180-200 rpm for 2-3 days to obtain aspergillus oryzae mycelia; filtering and collecting Aspergillus oryzae mycelium, washing with sterile water for 3-5 times, adding 10-20 mL of cell wall dissolving liquid, and carrying out mild oscillation for 2-3 hours at the temperature of 28-30 ℃ to obtain protoplast; washing protoplasts for 2-3 times by using a sterilized 0.8M NaCl solution, adding a buffer solution II and a buffer solution III, adding 2-10 mu g of expression plasmid pRA-herA, uniformly mixing, carrying out ice bath for 10-20 min, adding 1mL of the buffer solution III into a mixed system, incubating at room temperature for 10-20 min, then adding 10mL of the buffer solution II, uniformly mixing, centrifuging at the temperature of 0-4 ℃ at the rotating speed of 800-1000 rpm for 5-10 min, removing supernatant, adding 1mL of the buffer solution II, uniformly mixing, transferring 100-200 mu L of the uniformly mixed solution to an improved Chaudsen culture medium plate, then adding 5mL of a covering culture medium at the temperature of 40-50 ℃, sealing the plate after the covering culture medium is solidified, and carrying out inverted culture for 3-7 days; after hyphae grow out from the transformants containing pRA-herA, the transformants are verified by a PCR method, and the obtained positive transformants are subcultured for 2 times to obtain high-yield strains carrying the orcinol synthase gene.
The other steps are the same as those in the first to third embodiments.
The fifth concrete implementation mode: the difference between this embodiment and one of the first to fourth embodiments is: the DPY medium in step S2 was prepared as follows: 2g dextrin, 1g polypeptone, 0.5g yeast powder, 10mg adenine, 925mg ammonium sulfate, 150mg methionine and 60mg arginine, and water was added to the mixture to a fixed amount of 100mL.
The other steps are the same as those in the first to fourth embodiments.
The sixth specific implementation mode is as follows: the difference between this embodiment and one of the first to fifth embodiments is: the cell wall lysis solution in step S2 was prepared by dissolving 1.0% carbohydrase in solution I.
The other steps are the same as those in the first to fifth embodiments.
The seventh concrete implementation mode: the difference between this embodiment and one of the first to sixth embodiments is: each 200mL of solution I consisted of a 0.8M sodium chloride solution and a 10mM sodium dihydrogen phosphate solution.
The other steps are the same as those in the first to sixth embodiments.
The specific implementation mode eight: the difference between this embodiment and the first to seventh embodiments is: the overlay medium in step S2 consisted of 1.2M sorbitol and 0.5% agar powder.
The other steps are the same as those in the first to seventh embodiments.
The specific implementation method nine: the difference between this embodiment and the first to eighth embodiments is: step S3, inoculating hypha of the high-yield orcein strains into a sterilized culture medium filled with rice, and standing and culturing for two weeks at the temperature of 28-30 ℃; extracting the cultured thalli for 3-5 times by using ethyl acetate, and concentrating to obtain a fermentation liquid extract; then, the bryozoan is subdivided by using a reverse phase chromatography, and is prepared by silica gel separation and a high performance liquid chromatograph to obtain the bryozoan.
The other steps are the same as those in the first to eighth embodiments.
The following examples were employed to demonstrate the beneficial effects of the present invention:
example 1: a method for preparing nervonic acid by Aspergillus oryzae comprises the following steps:
step S1: constructing an expression plasmid pRA-herA;
hericium erinaceus is a large fungus that produces compounds having a nervonic acid skeleton. The genome DNA of the strain is taken as a template, P1F is taken as a forward primer, P1R is taken as a reverse primer, a first fragment of the enterocoelia chromogenes encoding gene herA is obtained through amplification, then P2F is taken as the forward primer, P2R is taken as the reverse primer, the first fragment of the enterocoelia chromogenes encoding gene herA is taken as a template, and a second fragment of the enterocoelia chromogenes encoding gene herA is obtained through amplification; mixing a first fragment and a second fragment of a gene herA coded by a lichen acid synthase and a pRA plasmid fragment subjected to KpnI digestion linearization treatment according to a molar ratio of 1:1 mu L of the solution; and after the connection is finished, transforming the connection system into escherichia coli DH5 alpha, obtaining a positive clone after overnight culture, and finally obtaining the expression plasmid pRA-herA after PCR verification and enzyme digestion verification.
Hericium erinaceus (Hericium erinaceus) belongs to Hericium, and is preserved in China center for type culture collection, wherein the preservation address is Wuhan university in China, the preservation date is 2018, 11 months and 20 days, and the preservation number is CCTCC AF2018025.
The sequence of the primer P1F is ccgGAATTCGAGCTCGGTACCATGTCCTCCATCGCGGATACG, and the sequence of the primer P1R is TTTATCGCGATCATGCCGGTCGTCTCCACGGCG; the sequence of the primer P2F is ACCGGCATGATCGCGATAAACCAGGGCTC, and the sequence of the primer P2R is tactacaGATCCCCGGGTACCTCAAGCAGCAAGGCTCTCGAGG;
step S2: obtaining high-yield bryozoan strains;
uniformly smearing Aspergillus oryzae spores on PDA (potato dextrose agar) culture medium, and culturing at 30 deg.C for one week to obtain large amount of Aspergillus oryzae spores; inoculating spore stock solution of Aspergillus oryzae (Aspergillus oryzae) into 100mL DPY culture medium, and culturing at 30 deg.C and 200rpm for 2 days under shaking to obtain Aspergillus oryzae mycelium with good growth state; filtering and collecting thallus with sterilized funnel with filter hole diameter of 5mm in sterile environment, filtering and collecting Aspergillus oryzae mycelium, washing with sterile water for 5 times to remove residual culture medium on thallus surface, and repeatedly squeezing in funnel to remove water. Then transferring the thallus into a 50mL sterilized centrifuge tube, adding 20mL cell wall dissolving solution, and gently oscillating for 3 hours at the temperature of 28 ℃, wherein the enzymolysis degree of the protoplast can be observed by a microscope in the enzymolysis process.
Filtering the enzymolysis solution with a sterilized Miracloth (Merck Germany) into a 50mL sterilized centrifuge tube, centrifuging at 4 deg.C for 10min at 800rpm, gently discharging the supernatant in a super clean bench, precipitating the bottom to give protoplast of Aspergillus oryzae, washing the protoplast with sterilized 0.8M NaCl solution for 2 times, preparing a mixture of buffer II and buffer III at a ratio of 4:1, and adjusting the concentration of the protoplast to 2 × 10 with the aid of the mixture solution 8 cells/mL, 200mL of the adjusted protoplast solution was added to a new 50mL centrifuge tube, and 10. Mu.g of expression plasmid was addedAnd pRA-herA, lightly blowing and beating the mixed system by using a pipette gun to fully mix the mixed system, carrying out ice bath for 20min, adding 1mL of buffer solution III into the mixed system, incubating for 20min at room temperature, then adding 10mL of buffer solution II, mixing the mixture evenly, centrifuging the mixture at the temperature of 4 ℃ for 10min at the speed of 800rpm, removing the supernatant, adding 1mL of buffer solution II, lightly blowing and beating the mixture evenly by using the pipette gun, mixing the mixture evenly, transferring 200mL of the mixed solution to an improved Kerch culture medium plate, then adding 5mL of a covering culture medium at the temperature of 50 ℃, adding the covering culture medium, gently shaking the mixture evenly to mix the covering culture medium and 200mL of the mixed solution evenly, uniformly covering the surface of the improved Kerch culture medium plate, sealing the plate after the covering culture medium is solidified, and carrying out inverted culture for 7 days.
After hyphae grow on the surface of the modified Czochralski medium plate, the Aspergillus oryzae transformants containing pRA-herA grow into colonies. And (2) picking a proper amount of hyphae into 50 mu L of TE buffer solution (1M Tris,0.5M EDTA and PH8.0), shaking and uniformly mixing, then taking 1 mu L of the template, taking P1F and P1R as the templates for PCR verification, and carrying out subculture on positive transformants on the same improved Chaudou culture medium plate for 2 times to obtain a high-yield strain (A.oryzae/pRA-herA) carrying the nervonic acid synthetase gene.
The DPY culture medium is prepared by the following steps: 2g Dextrin (Dextrin), 1g Polypeptone (Polypeptone), 0.5g Yeast powder (Yeast Extract), 10mg Adenine (Adenine), 925mg ammonium sulfate, 150mg Methionine (Methionine) and 60mg Arginine (Arginine), and water was added to the mixture to a volume of 100mL.
The cell wall dissolving solution is prepared by dissolving 1.0 percent of carbohydrase (Takara Shuzo) in solution I; the solution I consisted of a 0.8M sodium chloride solution and a 10mM sodium dihydrogen phosphate solution.
Each 200mL of buffer II consisted of 1.2M Sorbitol (Sorbitol), 50mM calcium chloride solution, 50mM sodium chloride solution and 10mM tromethamine (Tris), and the pH was adjusted to 7.5.
Each 200mL of the buffer solution III consists of 40% by mass of polyethylene glycol-4000 (PEG-4000), 50mM of calcium chloride solution and 50mM of tromethamine (Tris).
The improved Chachi culture medium is prepared by the following steps: each 200mL of the modified Chaudou medium contained 7.0g of Czapek-Dox medium, 9.3g of NaCl, 1.8g of (NH) 4 ) 2 SO 4 20mg of Adenine (Adenine), 300mg of Methionine (Methionine) and 3g of Agar powder (Agar).
The overlay medium consisted of 1.2M Sorbitol (Sorbitol) and 0.5% Agar powder (Agar).
And step S3: preparing bryozoan;
inoculating hypha of a high-yield strain (A.oryzae/pRA-herA) carrying a lichenin synthase gene into a sterilized culture medium filled with rice (50 g of rice and 30mL of water in each 500mL triangular flask, and sterilizing the rice after soaking for three hours), and performing standing culture at 28 ℃ for two weeks; when hyphae cover the surface of the culture medium and produce a large amount of spores, the bryozoan synthesized by the thalli is secreted in the culture medium. HPLC analysis of ethyl acetate crude extract of host strain Aspergillus oryzae and high yield strain of lichen acid (A.s oryzae/pRA-herA) metabolite is shown in FIG. 1, FIG. 1 is lichen acid HPLC analysis map, a represents AO-herA, b represents AO-WT; the metabolites of the transformants were detected by HPLC. The results show that the A.oryzae/pRA-herA transformant produced a new compound compared to the wild type A.oryzae strain.
FIG. 2 is a photograph of the UV spectrum of orchitic acid, wherein a represents 207nm, b represents 262nm, and c represents 300nm; the spectrum of nervonic acid is shown in fig. 2, and in order to further verify the structure of the new compound, we analyzed its uv absorption spectrum. The results show that: the new compounds have absorption wavelengths of 207nm, 262nm and 300nm, consistent with the reported UV of nervonic acid.
FIG. 3 is a Bryoid LC-MS detection spectrum; the mass spectrum characteristics of nervonic acid are shown in fig. 3, and in order to further verify the structure of the novel compound, the novel compound is subjected to LC-MS detection. The results show that [ M + H] + Is 169.0498, consistent with the reported LC-MS of orcinol.
FIG. 4 is bryozoac acid 1 H nuclear magnetic resonance spectroscopy; to further validate the structure of this new compound, we performed mass spectrometric detection of it, as shown in figure 4. Nuclear Magnetic Resonance (NMR) detection results: 1 H NMR(400MHz,CD 3 OD)δppm:2.51(3H,s,6-Me),6.17(1H,s,H-3),6.22(1H,s,H-5)，with the reported bryozoac acids 1 H NMR was consistent.
FIG. 5 is bryozoac acid 13 C nuclear magnetic resonance spectrum; to further validate the structure of this new compound, we performed mass spectrometric detection of it, as shown in figure 5. Nuclear Magnetic Resonance (NMR) detection results: 13 C NMR(400MHz,CD 3 OD) delta ppm 25.1 (6-Me), 102.5 (C-3), 106.5 (C-1), 113.1 (C-5), 146.1 (C-6), 164.5 (C-2), 167.7 (C-4), 175.9 (C-7). Nuclear magnetic resonance results and reported 13 The C NMR results were consistent.
Extracting the cultured thallus with equal amount of ethyl acetate for 3 times, mixing extractive solutions, and concentrating under low pressure to obtain fermented liquid extract. Performing coarse segmentation on the fermentation liquid extract by using normal phase chromatography of silica gel filler, primarily judging the distribution section of the nervonic acid by using TLC, combining the segmented sections containing the nervonic acid, then performing subdivision by using reverse phase chromatography of C18 filler, then judging the position of the nervonic acid by using TLC, and finally preparing the pure product (the purity is more than 98%) by using an Agilent HPLC1260 Infinity II liquid chromatograph and detecting the wavelength at 264 nm. The structure was confirmed by means of a 400M nuclear magnetic instrument, the structural data (solvent deuterium with methanol) being as follows:
the normal phase chromatographic packing used in the separation preparation process is 200-300 meshes of silica gel, the reverse phase chromatographic packing is C18 chromatographic packing, the high performance liquid chromatograph used for the preparation is Agilent 1260Infinity II, the chromatographic column is Agilent ZORBAX RX-C18, the thickness is 9.4 multiplied by 250mm, and the detection wavelength is 254nm.
The nucleotide sequence of the expression plasmid pRA-herA is as follows:
ATGTCCTCCATCGCGGATACGCAGCATTTCAATGTCCCGGTCTTCGCAGGCCACGGTACAACGGCCATCAACACACCCCAGACCCGTGAGCGCGCCCTTCGCGATGCTTCCTCGCCATCAGGCTCTATTCTACTCTCCTCTTGCTTCGATAGTTTCCAAGAAGAGCTCGCTACATTCACTGATGAGGAGCGCAAGGCTGCAGGCGTCGAAGCTGGGGACTTCGATAAGCCTGAGTCTCTCCTCTCTCTATCTCAGGAGCGCTACCTCTCCAATCCAGTCATCTCTGGGATCACGCTCTTCCTCATCCAAACGCTGAGGTACCTCTCCTTCGTCGAGTCCTACTCTTCGCCGTCGTCTCCGCGCTTCGCGGCCATCCTCTCCCAGAACCTCGCACACCAGCTTGGTGTTCTTGGATTTTCTTCTGGTATTCTCCCAGCATCAGTCGTCGGCACCTCAGTTTCGGCATTGGAGTTCATCTCAAACGCTGTCGAGGCATTCCGCCTCGCGTTCTGGATCGGAGTTCGCGCCCAACTTTATCGCGTCGCAGCCTTTGAATCCGCAAATAGTCTCGGAGATGATGCGGCGCTCCCATGGAGCGTTGTGTTCCTGGGGATTGGGCGGCAAGAGGCAGATGAGGCAGTGCGCAAGTACCGTGAATCGAATGAAAATGCAGAGTCTCTGCACGTGACCGCTGTGATGGATGAGACTTGCGTCACCATATCTGGACGTCCTGACGTTCTCGCTGCCTTCGCGTCCCGACTTCCGACTTCTGCGCCTCCGCACAAGACGACCGTAGATACCCTTTATCACTCCCCGATTCACACAGGCACGACACGCGATCTGGTCCTGGAAGATGTGTCCCGCCGTGGGATTCAGTTCCCTTCGTTCTCGGACATCAAGATCCCCGTCCGCTCCATGCACACTGGCGAGCTGCTCGATTCATCTCGCGAGGGATCGTTCGTAGAGGCGGTCGTCGATATGGTCCTCACGCAGCCAGTGAACTGGGATCGCGTCGTCAGCTCGCTTGTGTCAGCCGCGCCAGAGGGCGAAGCCGTGCGCTTGATCAACGTCGGACCTGGTGCTGGGCTTACTCGCAGCATGGAGCGGGCATTCCCCACGCGCAATGCATTGTCTGTAGATCTGACTGCCCCGGAGAAGAATTCCGCCGCGAACAAGATGTCTCCCGTTCAGGAGCCGATTGCTATTGTCGGCATGGCGGTTAACATGCCCGGAGCACCGAGCGTCGAGAAGCTGTGGGAGGTGCTCGAGAAGGGCATCAACACTATTGCGGAGATCCCTGAGCACCGGTTCAAGGTCTCAGACTACAACAACCCCGCCGATGCCAAGAGTGCCCGGTCGATGAAGGCACATACGGGCAACTTCCTCGACGATCCTGATGCATTTGACAACAAGTTCTTCAAGATCTCGCCGCGTGAGGCACGCAGCATGGATCCTCAAGGCCGCGTGCTGCTTCACACCGCGTACGAGGCGCTGGAGGATTCAGGTTATGTACCCAACGCCACGCCGACATTCCAGCCGGACTCGTTCGGGTGCTACATCGGTTGCGCCACGGGCGATTACGTTGAGAATCTCCGAAACGATATTGACGTATATTACAGCACTGGCACTCTGCGCGCCTTCCTCAGTGGTCGGATTTCATACGCTATGAAACTCAGCGGTCCATCTGTGGTCATTGATACTGCGTGCTCGTCTTCGATCATCGCCGTGTACCAGGCGTGTCGTGCACTCATGAACGGGGACTGCACTGCGGCCATGGCAGGTGGTGTCAACGTGATCGCTGCTCCCGACATGTTCATGGGTCTAGATCGTGGTCATTTCCTCAGCCCTACGGGCCAGTGCAAGGCGTTCGATGACTCTGCCGATGGATACTCGCGTAGCGAAGGCTGTGGAATTTTCGTCCTGAAGCGGCTGTCAGATGCCATCGCTGAGGACGACAACATCCTCGGCGTCATCCGCGGTGTTGAGGTTAACCAAAGCGGCCTCGCGAGCTCCATCACTCATCCGCATTCGCCGACGCAACAGATCCTTTTCAAGAAGGCGCTCGAGAAGTCTGGCATTGATGCGCGTCGCATCAACGTTGTCGAAGCTCACGGCACTGGCACGCAGGCTGGCGATCCCAACGAGCTCGATAGTATCCGCGGCGTCTTTGCTGTCGGCCGTACACCCGCGAACCCGCTTCACATCACGTCCGTGAAGGCCAACATCGGGCATCTCGAGGCTGCGTCGGGCTCCGCTGGCCTGGCAAAGCTTCTGCTCATGCTTAAGCACCGCACGATTCCCGCCCAGATCTCGTTGAAGAATCTGAACCCGAAGATCGTGGCTCTCGAGAAGGATCACACGGTCATCGACAGGGAGCACGCGCCTTGGAACCCGTCGGAAGAGGGACTGACGAGAATTGCCATGCTCAACAACTTCGGCGCCGCTGGTTCCAATGGGGCTCTGTTGTTGGAGGAATATGTCCCGGCGGGCTCGAAGGCACCTGAGGTCGAGTCTGCTGCGGCCTTCATCGTTGGTCTGTCAGCGAAGACGGACGAGGCACTCAATGCCCTGCGCATGCGTTACATCGAGTGGCTCGGCGATGCCAGGAATGCATCCATCTCCCTCGCCGATTTCGCATACACTGCTACAGCTCGCAGGCAGCTGTACGGCCAGCGTCTCGCTGTCTCTGCAGGCACCAAGGAGGAGCTTGTCGAGAAGTTGAGAGCCGCGTCGCAGGTCGCTGTGACTGAGCGGCCAGCGAAAGTTGCTTTCGTCTTCTCTGGCCAGGGCAGCCAGTACCTCGGGATGGGATCTGCCCTCTACAAGACCGTGCCTCTCTTCAAGCGTACCGTCGACGAGTGCCACGCTATCTTAACTGCGTCCGGCTTCCCGGGCGTTCTCGCCATCATCAATCCTGCTGGTGAGACCAGTGGTCTTACTCAGCTGGAGGAGTTCGAAGCATATCAGGCGGCGATCTTCTCCCTTGAGTACGCGCTCGCCAAGTTGTGGATGTCATGGGGACTGGTTCCCGAGGTGGTCGTAGGCCACAGTCTGGGCGAGTACGCAGCGCAGGTCATCGCTGGCGTCTTGACGCTCAAGGGCGCGCTCACTCTCATTGCCAACCGCGTCCGCTTCATGGTCAGCAAGTGCGCCGTGGAGACGACCGGCATGATCGCGATAAACCAGGGCTCCGAGGCGGTTGCGAAAATGCTGGCAGCTTCGATGGACTTCCCCGACACTTCTGTTGCATGCTTTAACAGCAACACTGACTGCGTCGTTTCGGGCCCTATTCCTCAGCTCAAGGCACTGAAGGCACACCTCGACAGTGAAGTACGCTGCAAGAACGTCCTCTTGACGGTGCCGTTCGGGTACCATAGCTCCGCCATGCACCCCCTTCTCGACGACCTTTCCACTATTGCTAAGCATGTTACCATCCGCGCGCCCACTATTCCGATTATCTCCAATGTCACCGGTGAGGTCGTTATGCCCGGCGATGAGGGCGTTTTCGACTCGGAGTACTACTCTCGCCACTGCGCGCAGCCAGTACTCTTCGAGAAGGGCCTCACTTCACTCGCGGCTATTCCGGAGCTTGCGAACATCGACGCATGGATCGAGATTGGTCCCCACAGCATCACGCTTCCCATGTTCAAGGTTCACCCGTCGATCTCGAAGAGCACCATGCTCTTGGGCTCCCTGAAGAAGAACCACGACCCGTGGGCAATCGTCTCTTCGACTTTGGCTCAGCTGTACACGTCCCCGATTCAACTCAGGTGGCGTGAGGTCTTTGGCCATGTCTCTTCTCCTTCGACGCTTTCCCTTCCGTCGTACCCCTTCACGAAGTCCAAGTTCTGGGTCTCGTTCAAGGAGGAGGCACCTGGCGCGGTTGTATCGGCGTCCACCTCCGTCCCGCTCGCGAAGCACGTCGATTTAGTCAATAACTTCTCGATGCTATACTCCTGGGCCCAGTTCCCGTCGGCGGCGAACCAGCGCGTCGCAATTTTCGAGACGCCCATCTCGCAGCTCGGGAAGTCCATCATGGGCCATAGCGTTGGAGACCACCCGCTCTGCCCCGCGTCCGTGTACCACGAGCTCGCACTTGCAGGTATCGAGATGGCTAGGTCCCATCTGCACCTTAAGATTGACGACTGCTTCGTCATGCTTCGCGACATCGACTACGCGAAGCCGCTGGTCTACAACGAGCACGTTGCCCGGATGGTCAGGACATCGATCACACTTGACGTTGATGGCTCGGGCTCTTTCAGCGTTGGCTCGCAGGTAGATGGCTCGCCCGAGGAGGTCCATTGCTTCGGGAAGTTCAAGCACCAGTCGACATCGAAGGCCTCAACCAAATTCGCTCGCGTTCTTCCCATCGTAACTCGTCAAATCAGCTCCGTCTCGTCGCCTAACGATGGTTTCGCGGAGACGTTCTCTACTCGCACGGCATACGAGGTCATCTTCCCGCGCGTGGTCGACTACGCAAAGGAGTACCACACGATGAAGACGCTCACCGTCGCCTCGAACGGTATGGAAGCATACGCGATCGTCCAGCTGCCTCGCGATCACGACCGCAGCAAGTTTATCGTCCACCCTGTCTTCATGGACACCATGCTTCACGTTGCCGGCTTCGTCGCGAACATGCAGGGCGGAGTCAACGATGCCTACATCTGCAGCAAGGTCGACACAGTGAAGGCGATCCCGGCTTTGATCGACAACGACGCGGAGTACGGCGTGCTGATCAGCAACGCCTGGGTCGCGGATGAGGGCGTCATGCTTGCGGAGGCCTACGCCGTCCAGTTGAAGTCTCCAGGTAAGATCGTCGCGCACCTCAAGGGCATGCACTTCCGCAAGGTGCGCCTCAATAGCCTGAAGCGTGGTCTCGCGATGGCCGCGGGCACTAGCCCGGCGCATGCTGCGCCGAAGCGGGCGGAGGCGCCTGTGAAGAAGGCTGCGCCTGCTTCCCCGATGTCCTCCAAGGTCGTTTCCTCAATCACCTTCGTCGAGCCGCCTCGAGATACAGCACCTACTATCGACGTCCTCGCGGAGGTCACGCGCATCGTGGCCGAGACTTGCGACATCACTGCATCCACGATCCAGCCCGACGGAGACCTCGAGGCGTACGGCGTGGATTCGCTGATGTCCATTGAGATCTTCACCAAGATGCAGAGCGCCTTCCCTAGTGCTGACCTTGACGCGAACGTCCTTTCCTCGTGCCGCAATGTTGCCCAGATCGTCGCTGAGGTGTCGTCCAAGTTCTCCCAGGAGGACTCTGGCCCATCCACGCCGCGCACACTCGTCACTGACGAGAAGCTTGGCGAGCCCAGCGTCATCGCGAACTTCGACGAGGTCGAGTCAAGCCGCTGCTGGCGTCCGTCCTCGGCATCGGCCTCCAGGAGATCACCGACGACGCGGACTTCGAATCGCTCGGCTTAGACTCGCTGACATCCATCGAGGCGCATTCGGCCCTGCAGAGCGAGTACTCGCTGACGCTGCCGACCACCCTGTTCGAGACATACACAACGGCGAAGGCCGTCAACGCCTTCCTCACATCGCAGCTGCGTCCTCGGGGCAAGGCCGTCGAGGCCGTTAAGGAGACCGAGTGCACCCTTCGGACTACAAGGACTCGGACATCGCGACCGCCGCGAAAGTCGCGCAGATCGTCGACGGCAACCTCAACCCGCTCGTCACCGCGCTGCGCCTCGACTCGGTTCCCGTCGGTGCGCAGAAGGCGAAGACACCCGGCCGCGCGCCCTTATTCCTGATTCACGATGGTAGCGGCCTTGTGAACTACATCCAGCGCCTCTCCCCGCTTGACCGCGACATCTGGGGCATTCATAATCCCCACTTCATCACCAGCCAGCCGTGGGAGAGTGTTGTGTCGATGGCTGCGGAGTACTCTGAGTTCGCGACGAAGACGACCTCTGAGCCTCTTATCCTTGGCTGGTCGTTCGGTGGTGTCGTTGCCTTCGAAGCTGCGTGTCAGCTCATGAAGAAGGGCGTTGCGGTGAAGGGCGTCCTCCTCATCGACTCCCCTACTCCTCTCGCCCACGTTCCGCTCTCCGACGCCCTCCTCGAGTCCGTCGCGAAGCTGGATGGCCGCGCCGACACGCAGGTCGGCAAGCTCGTGAAGACGCAGTTCCAGATGAACTCGCGCATGCTCGGCCGCTATGACCCGCTTGCCGCGGGCGGGCCATTTCCCTCGATCGTCCTCCTCCGCTCGAGAGAGGGCTTCAAACCCGCCGGCGTCGCCGACGTGCCGACGTGGCTTGCGGACAGGAGCGATGCGCAGCTGGCCATATCCGGGTGGGAGCGCGTCGTGGGCACGCCGATCAAGGTCATCGACATCCCCGGCAACCATTTCCAGCCTTTCCACACCTCTAATATCGAGGAAGTTTCTCGTCGCATTGCTGAGGGGTGCGCACACCTCGAGAGCCTTGCTGCTTGA。
Claims (9)
1. a method for preparing nervonic acid by Aspergillus oryzae is characterized by comprising the following steps:
step S1: constructing an expression plasmid pRA-herA;
amplifying to obtain a first fragment of the lichen acid synthase encoding gene herA by taking genome DNA of hericium erinaceus as a template, P1F as a forward primer and P1R as a reverse primer, and then amplifying to obtain a second fragment of the lichen acid synthase encoding gene herA by taking P2F as the forward primer and P2R as the reverse primer and taking the first fragment of the lichen acid synthase encoding gene herA as the template; inserting a fragment I and a fragment II of a lichen acid synthase encoding gene herA into a pRA plasmid by taking the fragment of the pRA plasmid subjected to KpnI enzyme digestion linearization as a vector to obtain an expression plasmid pRA-herA;
the sequence of the primer P1F is ccgGAATTCGAGCTCGGTACCATGTCCTCCATCGCGGATACG, and the sequence of the primer P1R is TTTATCGCGATCATGCCGGTCGTCTCCACGGCG; the sequence of the primer P2F is ACCGGCATGATCGCGATAAACCAGGGCTC, and the sequence of the primer P2R is tactacaGATCCCCGGGTACCTCAAGCAGCAAGGCTCTCGAGG;
step S2: obtaining high-yield bryozoan strains;
inoculating spore preservation solution of aspergillus oryzae into a DPY culture medium, and performing shake culture for 2-3 days to obtain aspergillus oryzae mycelia; then adding cell wall dissolving liquid, and oscillating for 2-3 hours to obtain protoplast; adding a buffer solution II and a buffer solution III into the protoplast, then adding expression plasmid pRA-herA, uniformly mixing, carrying out ice bath for 10-20 min, adding the buffer solution III into the mixed system, incubating at room temperature for 10-20 min, then adding the buffer solution II, uniformly mixing, centrifuging for 10-20 min, removing the supernatant, adding the buffer solution II, uniformly mixing, transferring to an improved Chaech culture medium plate, adding a covering culture medium, and carrying out inverted culture for 3-7 days; after hyphae grow out from the transformants containing pRA-herA, verifying the transformants by using a PCR method, and carrying out subculture on the obtained positive transformants for 2 times to obtain high-yield strains carrying the licheninic acid synthetase gene;
every 200mL of buffer II consisted of 1.2M sorbitol, 50mM calcium chloride solution, 50mM sodium chloride solution and 10mM tromethamine, and the pH was adjusted to 7.5; every 200mL of buffer solution III consists of 40 percent of polyethylene glycol-4000, 50mM of calcium chloride solution and 50mM of tromethamine by mass percentage; the improved Chao's medium is prepared by the following steps: each 200mL of the modified Chaudou medium contained 7.0g of Chaudou medium, 9.3g of NaCl, 1.8g of (NH) 4 ) 2 SO 4 20mg of adenine, 300mg of methionine and 3g of agar powder;
and step S3: preparing bryozoan;
inoculating the mycelium of the high-yield bryozoan strain into a sterilized rice culture medium, and extracting and concentrating the cultured thallus to obtain a fermentation liquid extract; separating the fermentation liquid extract with silica gel, and preparing with high performance liquid chromatograph to obtain nervonic acid.
2. The method for preparing orchidic acid by aspergillus oryzae according to claim 1, wherein in step S1, the first herA fragment and the second herA fragment of the gene coded by orchidic acid synthase and the pRA plasmid fragment linearized by KpnI are treated according to the following steps (1-2): (1-2): 2, connecting by using a multi-fragment connection kit, transforming a connection system to escherichia coli DH5 alpha after connection, obtaining a positive clone after overnight culture, and finally obtaining the expression plasmid pRA-herA after PCR verification and enzyme digestion verification.
3. The method for preparing nervonic acid by aspergillus oryzae according to claim 1, wherein in step S1, the fragment of pRA plasmid linearized by KpnI digestion is used as a vector, and the first fragment and the second fragment of nervonic acid encoding gene herA are inserted into the pRA plasmid by using a ligase-independent multi-fragment one-step cloning kit to obtain expression plasmid pRA-herA; the ratio of the mass of pRA plasmid to the volume of KpnI enzyme was 1. Mu.g: and (1-2) mu L.
4. The method for preparing nerchinic acid by aspergillus oryzae as claimed in claim 1, wherein the bryomelic acid high-producing strain based on expression plasmid pRA-herA in step S2 is cultured as follows: inoculating spore preservation solution of aspergillus oryzae into 100-200 mL of DPY culture medium, and carrying out shaking culture at the temperature of 28-30 ℃ and the rotating speed of 180-200 rpm for 2-3 days to obtain aspergillus oryzae mycelia; filtering and collecting aspergillus oryzae mycelia, washing the aspergillus oryzae mycelia for 3-5 times by using sterile water, then adding 10-20 mL of cell wall dissolving solution, and oscillating for 2-3 hours at the temperature of 28-30 ℃ to obtain protoplasts; washing protoplasts for 2-3 times by using a sterilized 0.8M NaCl solution, adding a buffer solution II and a buffer solution III, adding 2-10 mu g of expression plasmid pRA-herA, uniformly mixing, carrying out ice bath for 10-20 min, adding 1mL of the buffer solution III into a mixed system, incubating at room temperature for 10-20 min, then adding 10mL of the buffer solution II, uniformly mixing, centrifuging at the temperature of 0-4 ℃ at the rotating speed of 800-1000 rpm for 5-10 min, removing supernatant, adding 1mL of the buffer solution II, uniformly mixing, transferring 100-200 mu L of the uniformly mixed solution to an improved Chaudhur culture medium plate, then adding 5mL of a covering culture medium at the temperature of 40-50 ℃, sealing the plate after the covering culture medium is solidified, and carrying out inverted culture for 3-7 days; after hyphae grow out from the transformants containing pRA-herA, the transformants are verified by a PCR method, and the obtained positive transformants are subcultured for 2 times to obtain high-yield strains carrying the orcinol synthase gene.
5. The method for preparing orchidic acid by Aspergillus oryzae according to claim 1 or 4, wherein the DPY medium in step S2 is prepared by the following steps: 2g dextrin, 1g polypeptone, 0.5g yeast powder, 10mg adenine, 925mg ammonium sulfate, 150mg methionine and 60mg arginine, and water was added to quantify 100mL.
6. The method of claim 4, wherein the cell wall lysis solution of step S2 is prepared by dissolving 1.0% of carbohydrase in solution I.
7. The method of claim 6, wherein the amount of orcein per 200mL of solution I comprises 0.8M NaCl solution and 10mM Na-dihydrogen phosphate solution.
8. The method of claim 1 or 4, wherein the step S2 of coating the medium comprises 1.2M sorbitol and 0.5% agar powder.
9. The method for preparing orchidic acid by aspergillus oryzae as claimed in claim 1, wherein step S3 comprises inoculating hyphae of the high-yield orchidic acid strain into a sterilized culture medium filled with rice, and performing static culture at 28-30 ℃ for two weeks; extracting the cultured thalli for 3-5 times by using ethyl acetate, and concentrating to obtain a fermentation liquid extract; and then, subdividing by using a reverse phase chromatography, and separating by using silica gel and preparing by using a high performance liquid chromatograph to obtain the nervonic acid.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202211110735.0A CN115976093B (en) | 2022-09-13 | 2022-09-13 | Method for preparing orcein by using aspergillus oryzae |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202211110735.0A CN115976093B (en) | 2022-09-13 | 2022-09-13 | Method for preparing orcein by using aspergillus oryzae |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN115976093A true CN115976093A (en) | 2023-04-18 |
| CN115976093B CN115976093B (en) | 2023-06-27 |
Family
ID=85966916
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202211110735.0A Active CN115976093B (en) | 2022-09-13 | 2022-09-13 | Method for preparing orcein by using aspergillus oryzae |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN115976093B (en) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2020232553A1 (en) * | 2019-05-22 | 2020-11-26 | Hyasynth Biologicals Inc. | Methods and cells for production of phytocannabinoids and phytocannabinoid precursors |
| CN113699130A (en) * | 2021-08-26 | 2021-11-26 | 中南民族大学 | Polyketide synthase PreuA-TEPreu3Construction of (A) and its application in preparation of nervonic acid |
| CN113832123A (en) * | 2021-09-07 | 2021-12-24 | 中南民族大学 | Polyketide synthase Preu 3-delta CMeT and application thereof in preparation of orchidic acid |
-
2022
- 2022-09-13 CN CN202211110735.0A patent/CN115976093B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2020232553A1 (en) * | 2019-05-22 | 2020-11-26 | Hyasynth Biologicals Inc. | Methods and cells for production of phytocannabinoids and phytocannabinoid precursors |
| CN113699130A (en) * | 2021-08-26 | 2021-11-26 | 中南民族大学 | Polyketide synthase PreuA-TEPreu3Construction of (A) and its application in preparation of nervonic acid |
| CN113832123A (en) * | 2021-09-07 | 2021-12-24 | 中南民族大学 | Polyketide synthase Preu 3-delta CMeT and application thereof in preparation of orchidic acid |
Non-Patent Citations (2)
| Title |
|---|
| HAN,H. ET AL: "High-efficient production of mushroom polyketide compounds in a platform host Aspergillus oryzae", MICROBIAL CELL FACTORIES, vol. 22, no. 60, pages 1 - 10 * |
| 洪阁;李松年;刘培勋;: "苔色酸酯的合成及抗真菌作用的研究", 中国新药杂志, no. 14, pages 1099 - 1101 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN115976093B (en) | 2023-06-27 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN109439701B (en) | Method for preparing ergothioneine by biosynthesis and fermentation medium | |
| CN104893989B (en) | Rhizopus microsporus must shape mutation ZJPH1308 and the application in sitagliptin intermediate is prepared | |
| CN102061320B (en) | Preparation method of 11 alpha,17 alpha-dyhydroxyl-androst-4-ene-3,20-dione | |
| CN105695340B (en) | Aspergillus oryzae and application thereof | |
| CN104046586B (en) | One strain gene engineering bacterium and the application in producing (2R, 3R)-2,3-butanediol thereof | |
| CN104694401A (en) | Penicillium verrucosum LPPV001 and method for producing ergosterol peroxide by same | |
| CN114369613A (en) | Yeast strain for constructing high-yield CBGA synthesis by modifying galactose promoter and construction method and application thereof | |
| CN109486688A (en) | A kind of trichoderma reesei genetic engineering bacterium and its preparation method and application | |
| CN109971651B (en) | Tobacco endophytic fungus and application thereof in preparation of ergosterol 5,8 peroxide | |
| CN115976093A (en) | Method for preparing nervonic acid by using aspergillus oryzae | |
| CN116987603A (en) | Recombinant saccharomyces cerevisiae strain for high yield of cannabigerolic acid as well as construction method and application thereof | |
| CN113337432B (en) | Methylophilus for producing pyrroloquinoline quinone and application thereof | |
| CN106893726B (en) | Promoter and recombinant yeast strain | |
| CN107903227B (en) | Succinic anhydride compound, gene and protein related to succinic anhydride compound and preparation method of succinic anhydride compound | |
| CN114672510B (en) | Method for preparing L-tryptophan-L-alanine cyclic dipeptide by utilizing aspergillus oryzae | |
| CN105331550B (en) | A method of it producing the recombination eukaryon bacterial strain of sweet wormwood diene and prepares sweet wormwood diene using the recombination eukaryon bacterial strain | |
| CN112626103A (en) | Yarrowia lipolytica engineering bacterium for producing limonene and application | |
| CN118109530A (en) | Method for preparing original-illidine type sesquiterpene skeleton by using aspergillus oryzae | |
| CN112646854B (en) | Echinocandin B synthetic medium and application | |
| CN113046251B (en) | Production of pneumocandin B 0 The gene engineering bacterium, its preparation method and application | |
| CN116262903A (en) | Aspergillus oryzae engineering bacteria, construction method and application | |
| CN103073550B (en) | The isolation technique of ring (L-PROLINE-Valine) in Phellinus bacterium | |
| CN113493745B (en) | Genetically engineered bacterium for producing cephalosporin C and construction method thereof | |
| CN105331597A (en) | Preparation technology of high-purity agarase | |
| CN117467638A (en) | Rabdosia from olive chaetomium globosum, coding gene and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |